ID: 1133496487

View in Genome Browser
Species Human (GRCh38)
Location 16:6323030-6323052
Sequence CCTTATATGCAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133496487_1133496495 26 Left 1133496487 16:6323030-6323052 CCAGCTTCCCTCTGCATATAAGG 0: 1
1: 0
2: 3
3: 15
4: 196
Right 1133496495 16:6323079-6323101 ATCGAATGAGTACATGAGCATGG 0: 1
1: 0
2: 1
3: 6
4: 95
1133496487_1133496496 27 Left 1133496487 16:6323030-6323052 CCAGCTTCCCTCTGCATATAAGG 0: 1
1: 0
2: 3
3: 15
4: 196
Right 1133496496 16:6323080-6323102 TCGAATGAGTACATGAGCATGGG 0: 1
1: 0
2: 1
3: 4
4: 101
1133496487_1133496497 30 Left 1133496487 16:6323030-6323052 CCAGCTTCCCTCTGCATATAAGG 0: 1
1: 0
2: 3
3: 15
4: 196
Right 1133496497 16:6323083-6323105 AATGAGTACATGAGCATGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133496487 Original CRISPR CCTTATATGCAGAGGGAAGC TGG (reversed) Intronic
900847331 1:5114433-5114455 GCTTATAAGATGAGGGAAGCAGG + Intergenic
900848025 1:5119182-5119204 GCTTATAAGATGAGGGAAGCAGG + Intergenic
901128652 1:6948252-6948274 CCATATATGAAGATGGCAGCTGG - Intronic
905008088 1:34727300-34727322 ACCTAGATGCAGAAGGAAGCTGG - Intronic
908061320 1:60352772-60352794 CCTTATATGAAGAGGAAATTTGG + Intergenic
908414178 1:63896690-63896712 GCTTATAAGCAGAGGGGAGCAGG + Intronic
908513896 1:64873060-64873082 CCTTATGTGCAGAGGTCAGAGGG - Intronic
911506373 1:98757466-98757488 CCTTATAAGAAGAGGAAATCTGG - Intronic
911942966 1:104070622-104070644 GCTTAGATGCAGAGGAAAACTGG + Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
914739488 1:150451838-150451860 CCATATAAGAAGAGGGAAACTGG + Intronic
915594910 1:156891236-156891258 CATTATCTGCAAAGGGGAGCAGG + Intergenic
915661402 1:157408675-157408697 CCTTATAAAAAGAGGGAATCTGG - Intergenic
916002635 1:160631618-160631640 CCTTATAAGAAGAGGAAATCTGG + Intronic
918127566 1:181597776-181597798 CATTTTATGCAGATGGCAGCAGG + Intronic
918363441 1:183782389-183782411 CATTACATGGACAGGGAAGCTGG + Intronic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066277547 10:33883839-33883861 CCTTAGGTGCAGAGCCAAGCAGG + Intergenic
1067834390 10:49629152-49629174 CCTTATAGGCAGTGGGTAGGAGG - Intronic
1068701694 10:60026666-60026688 CCTTATTTACAGAGGAAAGGAGG + Exonic
1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG + Intergenic
1071200747 10:83219110-83219132 CATTAAATGAACAGGGAAGCAGG - Intergenic
1072072805 10:91936332-91936354 CCTGATGTGCAGAGTAAAGCAGG + Intronic
1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG + Intronic
1073857655 10:107696142-107696164 CCTTATTTACAGAGAGAAGAGGG + Intergenic
1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG + Exonic
1074578786 10:114696432-114696454 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1076183119 10:128426111-128426133 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG + Intergenic
1078570295 11:12452147-12452169 CCTTATATGCAAGCGGAAACAGG + Intronic
1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG + Intronic
1081851251 11:46276702-46276724 CCTTTCACACAGAGGGAAGCTGG + Intergenic
1082615383 11:55353941-55353963 CCTTATTAACAAAGGGAAGCTGG - Intergenic
1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG + Intronic
1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG + Intergenic
1085558744 11:77450424-77450446 CCATATTTGCAAAGGGAAGTAGG + Intronic
1085865225 11:80282832-80282854 CCTTATCAACAGAGGGCAGCAGG - Intergenic
1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG + Intergenic
1088759109 11:112912676-112912698 CCTTGTATGCAGTGGTAAGGAGG + Intergenic
1089360391 11:117882157-117882179 CATTCTATGAAGAGGGATGCCGG - Intergenic
1089564359 11:119363285-119363307 CCATTTATGCAGCGGGCAGCGGG - Intronic
1089745885 11:120616466-120616488 CATTATCTTCAGACGGAAGCTGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG + Exonic
1091603344 12:1930864-1930886 CCTGAAATGCTGAGGGCAGCAGG - Intergenic
1093604741 12:21076211-21076233 CCCTATATTCATAGGGAAGAAGG - Intronic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1097274770 12:57805473-57805495 ACTTCTATGCAGATGGAGGCTGG - Intronic
1097432658 12:59528967-59528989 CCTTATATCCAGAGGGAAAGAGG + Intergenic
1097435752 12:59550606-59550628 CCTTATATCCAGGGGGAAAGAGG + Intergenic
1097585021 12:61504933-61504955 CCTTTTCTGTAGTGGGAAGCAGG - Intergenic
1097872734 12:64614635-64614657 CCTTATTTGCAAAGGGAATATGG - Intronic
1097894361 12:64809727-64809749 TCACAGATGCAGAGGGAAGCTGG - Intronic
1098041037 12:66354227-66354249 CCTTAGATGCAGAGAGACCCGGG - Intronic
1099828267 12:87807150-87807172 CCTAATATGCAATGGGAAGCTGG - Intergenic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1102659405 12:114512903-114512925 CCTTTTATGAAGGGGGAAGTAGG - Intergenic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1109376026 13:61494309-61494331 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1109667856 13:65562782-65562804 CCTTAAATACAGAGGGAAATTGG - Intergenic
1114374781 14:22132621-22132643 CCTTGTATGGAGACGGGAGCAGG - Intergenic
1114478817 14:23018087-23018109 CCTTATAAGAAGAGGGAATTTGG + Intronic
1116517169 14:45817064-45817086 CCTAATATGCAGGGGGAAATAGG + Intergenic
1118229369 14:63933193-63933215 ACTTAAATGCAGAGCGATGCAGG - Intronic
1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG + Intergenic
1120825117 14:88948028-88948050 CCTTATATGCACAGGCACACCGG + Intergenic
1124399792 15:29338223-29338245 CCTTATATGCAGAGGGGCTGTGG - Intronic
1125283104 15:38064171-38064193 CCTTATAAGAAGAGGAAATCTGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125489003 15:40132719-40132741 CCTAATATCCAGCGGGAAACAGG + Intergenic
1126178836 15:45765276-45765298 CCTTATATTCAAAGGCAAGTAGG - Intergenic
1126189955 15:45868861-45868883 CCTCATATTCAGGGAGAAGCAGG + Intergenic
1126419658 15:48457916-48457938 CCTTATATGATAAGGGAGGCAGG - Intronic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1127728007 15:61769849-61769871 CCTGATGTGCAGAGGGATTCAGG - Intergenic
1130040708 15:80403953-80403975 ATTTAGATTCAGAGGGAAGCCGG - Intergenic
1131902533 15:97104035-97104057 GGTTATATGTAGAGGGAAGATGG + Intergenic
1132942878 16:2516976-2516998 CCTTTTCTACAGAGGGCAGCAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1137365138 16:47853602-47853624 GCTTTTATGCAGAGGTAAACAGG + Intergenic
1138948983 16:61887572-61887594 CCTTACATGAAGAGGAAATCCGG - Intronic
1139372055 16:66475099-66475121 GCTTATGTGAAGTGGGAAGCAGG + Intronic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1144256619 17:13474723-13474745 CGGTAAATGCAGAGGGAAGCAGG + Intergenic
1146929837 17:36769131-36769153 CCTTATGGCCAGAGGGAATCTGG + Intergenic
1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG + Intergenic
1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG + Intergenic
1148767843 17:50049582-50049604 CGTTGTATGCTGAGGGCAGCAGG + Intergenic
1150920948 17:69481710-69481732 CCTTATATGAAGAGGAAATTTGG - Intronic
1155236596 18:23826053-23826075 ACATATCTGCAGAGGGAAGAGGG - Intronic
1160378708 18:78432579-78432601 CCTTGTATGCTGATTGAAGCGGG - Intergenic
1161487209 19:4542885-4542907 CCCACTCTGCAGAGGGAAGCGGG - Exonic
1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG + Intronic
1163574864 19:18104721-18104743 ACTTAGGTGCAGAGGAAAGCCGG - Intronic
1164890729 19:31821095-31821117 CCTTCTAAGAAGAGGAAAGCTGG - Intergenic
1167230788 19:48281823-48281845 CCTTATAAGAAGAGGAAATCTGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
927460916 2:23297606-23297628 CCTTATAAGCAGAGGGGATTAGG - Intergenic
927670896 2:25068046-25068068 GCTCGTATGCACAGGGAAGCAGG - Intronic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929470078 2:42182918-42182940 CCTTATAAGAAGAGGAAATCTGG - Intronic
932353780 2:71051845-71051867 CCTTATATCCAGAGGGAGAGGGG - Intergenic
938248463 2:129796476-129796498 CCTTCACTGCAGTGGGAAGCTGG - Intergenic
942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG + Intronic
944429919 2:199622223-199622245 GCTTATAGGCAGAGGAAAGTAGG - Intergenic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
946585334 2:221180074-221180096 CCTTATGAGAAGAGGGAATCTGG + Intergenic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
948032964 2:234834669-234834691 TCTTCTATCCTGAGGGAAGCTGG - Intergenic
948075229 2:235160688-235160710 CCTTATAGGAGGAGGGAGGCAGG - Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
1169305918 20:4490334-4490356 CCTTTTCTGCAGAGTGAACCTGG - Intergenic
1169479846 20:5969747-5969769 GCTTTTATTCAGAGGGAAGTAGG - Intronic
1169730779 20:8783686-8783708 ACTAATATGCAGAGAAAAGCAGG - Intronic
1171233045 20:23502543-23502565 TCTTATGTGCAGCAGGAAGCAGG - Intergenic
1172593789 20:36135629-36135651 TCAGATATGTAGAGGGAAGCAGG - Intronic
1173048523 20:39536341-39536363 CCTTTTGTGCAAAGGGAAGGTGG + Intergenic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1174143639 20:48434954-48434976 CATGAGATGCAGAGGGGAGCAGG - Intergenic
1175206880 20:57317902-57317924 GCTTTTATGCTGAGGGAGGCGGG - Intergenic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1182948241 22:34345298-34345320 TCTCATATTCAGAGGAAAGCAGG + Intergenic
1183114834 22:35683388-35683410 CCTTATATGCAGATTGGAGAAGG + Intergenic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG + Intergenic
950749373 3:15116808-15116830 CCTTATAGGAAGAGGGAATTAGG - Intergenic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
955482535 3:59404186-59404208 CCTTATAGGCAGAGGCATGAGGG - Intergenic
957037029 3:75302907-75302929 CCTTATATGTGGAGAGAAGCAGG - Intergenic
957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG + Intergenic
957976286 3:87448838-87448860 CTTGATATGCAGAGGTAAGAAGG + Intergenic
958732396 3:97972869-97972891 CCTTTTATGAATAGAGAAGCAGG + Intergenic
958790678 3:98647480-98647502 CCTTATAAGAAGAGGAAATCTGG - Intergenic
960018141 3:112916517-112916539 CCTTATATAAAGAGGGAATTTGG + Intergenic
960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG + Intronic
961080808 3:124025695-124025717 CCTTATATATGGAGAGAAGCAGG - Intergenic
961102747 3:124215352-124215374 ACTGGTATGCAGTGGGAAGCTGG + Intronic
961278353 3:125745008-125745030 CCTTATATCCAGAGGGAGAGAGG - Intergenic
969533320 4:7741191-7741213 CCTTATAGGCGAAGGGAACCGGG + Exonic
969828181 4:9774857-9774879 CCTTATTTGCAGAAGGAATGAGG - Intronic
969922911 4:10557527-10557549 CCCTAGATGCAGAGGGATGAGGG - Intronic
971528116 4:27648398-27648420 CCTTATATTAAGAGGGAATTTGG - Intergenic
974554948 4:63434307-63434329 ACTTGTATGCAGATGGAAGATGG + Intergenic
975259330 4:72277880-72277902 TCTTATATGCCAAGGGAAGAAGG - Intergenic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG + Intergenic
983395150 4:167184699-167184721 TCTTATACTCAGAGGAAAGCTGG - Intronic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
985826276 5:2193944-2193966 CCTAATATGGAAAGGGAGGCTGG - Intergenic
987295284 5:16545017-16545039 CCTTATTTTGAGAGGAAAGCAGG + Intronic
988094224 5:26582314-26582336 CATTATATGAAGAGAGAATCTGG + Intergenic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
992202438 5:74397663-74397685 CCTTATAAGAAGAGGGAATTTGG - Intergenic
992901223 5:81298883-81298905 CCTAATATTCAGAGAGAATCTGG + Intergenic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG + Intergenic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1004125245 6:12866692-12866714 TTTTATTTGCAGAGGGAAGCTGG - Intronic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006100759 6:31684729-31684751 CCTTAAATGCAAAGAGGAGCTGG - Intergenic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1009206646 6:60810378-60810400 CCTTATAAGTCCAGGGAAGCCGG - Intergenic
1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG + Intergenic
1009369199 6:62879850-62879872 CCTAATATTCAGAGGGAAAGAGG + Intergenic
1009943153 6:70312975-70312997 AATTAGATGCAGAGTGAAGCGGG - Intergenic
1012044160 6:94248313-94248335 CCTTATATGAAGAGGAAATTTGG - Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1016201587 6:141416914-141416936 CCCTACGTGCAGAGTGAAGCAGG + Intergenic
1019052453 6:169193471-169193493 GCTTCTATGCAAAGAGAAGCAGG + Intergenic
1025110590 7:56212932-56212954 CCATTTATGCATAGGGAAACTGG - Intergenic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG + Intergenic
1030604361 7:111623433-111623455 ACTTATTTGATGAGGGAAGCAGG - Intergenic
1031023550 7:116654427-116654449 CCTTAGATGCAAAGGAATGCAGG + Intergenic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1035074361 7:156168753-156168775 GCTTGTCTGCAGAGGGCAGCGGG + Intergenic
1036240067 8:7073919-7073941 CCTAATATCCAGGGGGAAACAGG - Intergenic
1038067558 8:23978895-23978917 ACTTATACACAGAGGGAAGGAGG - Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1042458994 8:69040203-69040225 TCTTATAGGCAGAGAGAACCTGG - Intergenic
1042886171 8:73554478-73554500 CCTTCTAGGCAGAAAGAAGCTGG + Intronic
1044500754 8:92952760-92952782 CCTTCTATCCAGAGGGAAAGGGG - Intronic
1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG + Intergenic
1046393089 8:113602486-113602508 CCATATATGCAGAGAGCAGAAGG - Intronic
1047427832 8:124762824-124762846 CCTTATATCCAGAGTCAACCAGG - Intergenic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1051035065 9:12734538-12734560 CCTTATAAGCAAAAGGCAGCAGG + Intergenic
1052238653 9:26245718-26245740 CCACATATTCAGAGGGAGGCTGG - Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1054859241 9:69932291-69932313 CCTTAGATGTAGAGGGAAATGGG + Intergenic
1057020264 9:91691885-91691907 GGGTATATGCAGAGGGAAACAGG + Intronic
1058003638 9:99892845-99892867 CCTTATATGAAGAGGAAATTTGG + Intergenic
1058519338 9:105803293-105803315 CCTAATATCCAGAGGGGAGAAGG - Intergenic
1060407205 9:123378732-123378754 CCTAACATGCAGATGAAAGCTGG + Exonic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1186103474 X:6181438-6181460 TCTTATAAGCAGCGGGAAACAGG - Intronic
1186925384 X:14328249-14328271 CCTTATAAGCACATGGAAGCTGG - Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1190224369 X:48534029-48534051 CCTTATAAGAAGAGGGACACTGG - Intergenic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1193972431 X:88071662-88071684 CCTTATAAACAAAGGGAATCGGG + Intergenic
1198286499 X:135196511-135196533 CCTTATATGAAGAGGGATATTGG - Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic