ID: 1133496495

View in Genome Browser
Species Human (GRCh38)
Location 16:6323079-6323101
Sequence ATCGAATGAGTACATGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133496486_1133496495 27 Left 1133496486 16:6323029-6323051 CCCAGCTTCCCTCTGCATATAAG 0: 1
1: 0
2: 1
3: 22
4: 219
Right 1133496495 16:6323079-6323101 ATCGAATGAGTACATGAGCATGG 0: 1
1: 0
2: 1
3: 6
4: 95
1133496487_1133496495 26 Left 1133496487 16:6323030-6323052 CCAGCTTCCCTCTGCATATAAGG 0: 1
1: 0
2: 3
3: 15
4: 196
Right 1133496495 16:6323079-6323101 ATCGAATGAGTACATGAGCATGG 0: 1
1: 0
2: 1
3: 6
4: 95
1133496493_1133496495 18 Left 1133496493 16:6323038-6323060 CCTCTGCATATAAGGGGCAGGAA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1133496495 16:6323079-6323101 ATCGAATGAGTACATGAGCATGG 0: 1
1: 0
2: 1
3: 6
4: 95
1133496492_1133496495 19 Left 1133496492 16:6323037-6323059 CCCTCTGCATATAAGGGGCAGGA 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1133496495 16:6323079-6323101 ATCGAATGAGTACATGAGCATGG 0: 1
1: 0
2: 1
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133496495 Original CRISPR ATCGAATGAGTACATGAGCA TGG Intronic
910652703 1:89587120-89587142 ATTGAATGAGCACTTGAGGAGGG + Intronic
911300369 1:96165497-96165519 ATCAAATAAGTACATAAACATGG + Intergenic
912035945 1:105313806-105313828 AGCTAATGAGTACATGTGCTAGG - Intergenic
918596549 1:186300618-186300640 ATCAAAAGAATACATGAGCATGG + Intronic
920222747 1:204416279-204416301 ATCCAATGACTACATGGGGAAGG - Intergenic
924025434 1:239827799-239827821 CTCGAATGAATTAATGAGCAGGG - Intronic
1063773451 10:9231218-9231240 ATCCAATGAGTAAAAGAACATGG + Intergenic
1064148755 10:12845365-12845387 CTCGAATGTGAACATGAACAAGG + Intergenic
1064305973 10:14166887-14166909 ATTGACTGAGTAAATGAACAAGG - Intronic
1067670093 10:48312114-48312136 ATCGAGTGAGTACAAAGGCATGG - Intronic
1071342659 10:84663063-84663085 ATAGAATGAGTACAGAAGCTTGG + Intergenic
1072414110 10:95232567-95232589 ACGGTATGAGTACAGGAGCAAGG - Intergenic
1072838983 10:98748949-98748971 AAAGAATGAGTAGATGAACAAGG + Intronic
1073562072 10:104505607-104505629 ATTGAATGATTACAGGAGCTGGG + Intergenic
1080177531 11:29384000-29384022 ATCCTATGTGTACTTGAGCAAGG - Intergenic
1090857702 11:130624644-130624666 ATAGAATGGGTACAAAAGCAGGG + Intergenic
1092300544 12:7245133-7245155 ATTAAATGATTACATGAGTATGG - Intergenic
1093336697 12:17913190-17913212 ATAGAATAAGTGCATGAACAAGG + Intergenic
1095973090 12:47918300-47918322 ACTGAATGAGTAAATGAGTAGGG + Intronic
1098311727 12:69155640-69155662 ATCAAAATAATACATGAGCATGG + Intergenic
1101266444 12:103093345-103093367 ATAGAATGTGTAAATGGGCATGG - Intergenic
1102540185 12:113613229-113613251 ATTGAATGAACACATGGGCATGG - Intergenic
1104014628 12:124953694-124953716 AGGGAATGTGCACATGAGCAGGG - Intronic
1104491530 12:129197950-129197972 ATCCAATTAAAACATGAGCAAGG + Intronic
1104673010 12:130693218-130693240 ATTGAATCATTACATGACCATGG - Intronic
1109353563 13:61212817-61212839 ATTAGATGAGTTCATGAGCATGG + Intergenic
1109951571 13:69507280-69507302 ATCAAATGAGTATATTTGCAAGG + Intergenic
1110575823 13:77053817-77053839 AAAGAATGACTACATGAGAAAGG - Intronic
1111458252 13:88511046-88511068 GTCTAACTAGTACATGAGCATGG - Intergenic
1114142676 14:19933451-19933473 ATCATGTGTGTACATGAGCAGGG - Intergenic
1115423017 14:33220038-33220060 ATAGAATCAGTACATGGCCATGG + Intronic
1117272458 14:54158846-54158868 ATGTAATGAATAAATGAGCAGGG - Intergenic
1121939097 14:98052247-98052269 ATTGTTTTAGTACATGAGCATGG - Intergenic
1122356878 14:101128253-101128275 ATAAAATGAGTAGATGAGGAAGG + Intergenic
1125515337 15:40316086-40316108 ATAGAATGGGCACATGATCATGG - Intergenic
1126472887 15:49034228-49034250 ATCTTATGAGTACATCATCAAGG - Intronic
1127046627 15:55032782-55032804 ATCAATTGAATACATGACCAAGG - Intergenic
1127370373 15:58333251-58333273 ATAGAATCAGTAAATGAGAAAGG + Intronic
1133496495 16:6323079-6323101 ATCGAATGAGTACATGAGCATGG + Intronic
1137366718 16:47865792-47865814 ATTGAATGAATGAATGAGCAAGG - Intergenic
1141377253 16:83542845-83542867 ATAAAATGAGGTCATGAGCACGG - Intronic
1156898262 18:42271399-42271421 ATTGAATGTGTACATGAGTTGGG + Intergenic
1159644258 18:70898812-70898834 GTTAAATGACTACATGAGCAAGG - Intergenic
1160351257 18:78181532-78181554 ATTAAATGAATACATGAGGAAGG - Intergenic
1162059988 19:8088766-8088788 ATTGAATGGGTGAATGAGCAAGG + Intronic
1164552778 19:29225633-29225655 ATGGAATGACCACATGAGCAAGG + Intergenic
932503758 2:72208870-72208892 ATCAAATGAATACATAGGCAAGG + Intronic
939536231 2:143432968-143432990 ATAGAAAGAGTACATTAGCACGG + Intronic
941153597 2:161946831-161946853 ATAAAATTACTACATGAGCAAGG - Intronic
945845267 2:214936868-214936890 ATATAATGAGTAGATCAGCAAGG + Intronic
946679473 2:222197902-222197924 ATCAAATAACTACATGGGCAAGG + Intergenic
1172382499 20:34507108-34507130 ATAGAATTACTACATGATCAAGG - Intronic
1172493903 20:35364118-35364140 ATAGAATGTGTACAAGAACATGG - Intronic
1172767268 20:37357431-37357453 ATGGAGTGAGTACCTGATCATGG - Intronic
1173562750 20:44017902-44017924 AATGAATGAGTGAATGAGCAAGG + Intronic
1177733151 21:25054910-25054932 AGTTAATGAGTACATGAGGAAGG - Intergenic
1178405819 21:32322525-32322547 GTCGCATGAGTACTTGAACATGG - Exonic
1185009829 22:48306719-48306741 GTCAAATGAGGAAATGAGCAGGG + Intergenic
952490534 3:33867701-33867723 ATGGAATGAGAAAATGAGAAAGG + Exonic
962669268 3:137688692-137688714 AAGGAATAAGTACAGGAGCATGG - Intergenic
965341344 3:167494960-167494982 ATCTAATTAGTACTTGAGCCGGG - Intronic
971334330 4:25708911-25708933 CTCTAACGAGTACATGAACATGG - Intergenic
971595771 4:28526537-28526559 ATCAAATGAGTCCATGACAAAGG - Intergenic
975237822 4:72021088-72021110 AATGAATGAGTAAATGTGCAAGG - Intergenic
975786745 4:77898111-77898133 TTCGAATGAGAAAGTGAGCAAGG - Intronic
977783880 4:101010108-101010130 ATCAAATGCCTACAAGAGCAAGG + Intergenic
977839342 4:101682681-101682703 ATGACAAGAGTACATGAGCAAGG - Intronic
978595794 4:110375603-110375625 AGTGAATGAGTAGATGGGCAAGG + Intronic
981508968 4:145533988-145534010 ATTAAATGAGACCATGAGCATGG + Intronic
983152745 4:164304979-164305001 ATCAAATAAATTCATGAGCAAGG + Intronic
985653585 5:1118640-1118662 TTCGAATGAGTCCAGGAGGAAGG + Intergenic
986289731 5:6390222-6390244 ATAGAGTGAGTACATGGTCATGG - Intergenic
992220559 5:74567975-74567997 ATCCAGTGGGTACATGTGCAGGG + Intergenic
992385202 5:76278153-76278175 ACACAATGTGTACATGAGCATGG - Intronic
992975698 5:82117052-82117074 AACAAATGAGCAAATGAGCACGG - Intronic
993531391 5:89029041-89029063 CTGGGATTAGTACATGAGCAAGG + Intergenic
999868280 5:155725821-155725843 CTCTCATGAGAACATGAGCATGG - Intergenic
999951108 5:156651893-156651915 ATTGATTGATTCCATGAGCATGG + Intronic
1003451516 6:6238154-6238176 ATCAAATGTCTACATGAGTATGG - Intronic
1010188879 6:73174532-73174554 ATCAAATGAATACATGAATAAGG + Intronic
1016610561 6:145984294-145984316 AATGAATGACTACATGAGCATGG + Intergenic
1016942484 6:149494531-149494553 ATTGAATGGGCAGATGAGCAGGG - Intergenic
1020560105 7:9720258-9720280 AGGAAATGAGAACATGAGCAAGG + Intergenic
1023149596 7:37189318-37189340 TTCTAATGTGAACATGAGCAGGG + Intronic
1024218014 7:47264280-47264302 AACAAATGAGTAAATGTGCATGG + Intergenic
1026582491 7:71629968-71629990 AAGGAATGAGTACATGAGGAGGG - Intronic
1030743634 7:113139039-113139061 ATTGCATGAATGCATGAGCAAGG + Intergenic
1031896056 7:127348806-127348828 ATAGAATGGGTACATAAGAATGG - Intronic
1038275278 8:26116126-26116148 ATCTAACTGGTACATGAGCAGGG - Intergenic
1039164168 8:34658242-34658264 ATCTAATGAGGAAATGAGAAAGG + Intergenic
1042031544 8:64481372-64481394 AGGCAATGAGTATATGAGCAGGG + Intergenic
1042228680 8:66535756-66535778 ACCAGATGACTACATGAGCATGG + Intergenic
1044939842 8:97330763-97330785 ATTGAATCTATACATGAGCATGG + Intergenic
1046669060 8:117037464-117037486 ATGGGATGAATACGTGAGCAGGG + Intronic
1046700799 8:117398711-117398733 ATTGAAAGAGTAAATGAGCAGGG + Intergenic
1055533691 9:77214188-77214210 ATCGCATGAGTCCATGAGACAGG + Intronic
1057132937 9:92667215-92667237 ATCTAAGGAGTACAGTAGCAGGG + Intronic
1057321492 9:94017195-94017217 ATAGAATGTGTACATGGGGATGG + Intergenic
1189245370 X:39559243-39559265 ATCAAATGAGTACATGAGCCGGG - Intergenic
1190294234 X:49015291-49015313 ATAGAATGTTTACATCAGCAGGG + Intergenic
1197355475 X:125433936-125433958 AAAGGATGAGTAAATGAGCAAGG - Intergenic
1197848425 X:130830084-130830106 ATAGAATGAGCACATGACTAGGG - Intronic
1201012889 Y:9566277-9566299 ATAGAATGAGAACATGATGAGGG - Intergenic