ID: 1133496496

View in Genome Browser
Species Human (GRCh38)
Location 16:6323080-6323102
Sequence TCGAATGAGTACATGAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133496493_1133496496 19 Left 1133496493 16:6323038-6323060 CCTCTGCATATAAGGGGCAGGAA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1133496496 16:6323080-6323102 TCGAATGAGTACATGAGCATGGG 0: 1
1: 0
2: 1
3: 4
4: 101
1133496487_1133496496 27 Left 1133496487 16:6323030-6323052 CCAGCTTCCCTCTGCATATAAGG 0: 1
1: 0
2: 3
3: 15
4: 196
Right 1133496496 16:6323080-6323102 TCGAATGAGTACATGAGCATGGG 0: 1
1: 0
2: 1
3: 4
4: 101
1133496486_1133496496 28 Left 1133496486 16:6323029-6323051 CCCAGCTTCCCTCTGCATATAAG 0: 1
1: 0
2: 1
3: 22
4: 219
Right 1133496496 16:6323080-6323102 TCGAATGAGTACATGAGCATGGG 0: 1
1: 0
2: 1
3: 4
4: 101
1133496492_1133496496 20 Left 1133496492 16:6323037-6323059 CCCTCTGCATATAAGGGGCAGGA 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1133496496 16:6323080-6323102 TCGAATGAGTACATGAGCATGGG 0: 1
1: 0
2: 1
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133496496 Original CRISPR TCGAATGAGTACATGAGCAT GGG Intronic
902433817 1:16384088-16384110 TAGAATAATTACAGGAGCATTGG + Intronic
902435187 1:16393891-16393913 TTCAGTGAGTAAATGAGCATAGG + Intronic
904863095 1:33554619-33554641 CAGAATGGGTAAATGAGCATTGG - Intronic
907916875 1:58878652-58878674 TGGAATTGGTAAATGAGCATTGG - Intergenic
908499639 1:64730284-64730306 ACGAAAGAATACATGAGTATAGG - Intergenic
910270551 1:85389697-85389719 TGGAATGAATAAATGAGCAAAGG + Intronic
911409049 1:97478619-97478641 TCCAAATGGTACATGAGCATTGG + Intronic
914031318 1:143962752-143962774 TCGGAACAGTAAATGAGCATTGG - Intronic
914158128 1:145105211-145105233 TCGGAACAGTAAATGAGCATTGG + Intronic
917579678 1:176362900-176362922 GACAATGAGTACACGAGCATTGG + Intergenic
919273013 1:195375474-195375496 TGTAATGATTACATGAGAATAGG + Intergenic
921111074 1:212037258-212037280 ACGAATGAGTACTTGAGAATAGG - Intronic
923936093 1:238762243-238762265 TCAAAATAGTAAATGAGCATTGG + Intergenic
924552842 1:245094455-245094477 TGGAATGAGTACACGAGCGAAGG + Intronic
1066285424 10:33961519-33961541 TTGAAATAGTAAATGAGCATTGG + Intergenic
1067448205 10:46365963-46365985 TCGAATGGGTACTTGAGGAAAGG - Intergenic
1067589172 10:47494803-47494825 TCGAATGGGTACTTGAGGAAAGG + Intergenic
1067877190 10:50017433-50017455 TCGAATGGGTACTTGAGGAAAGG - Intergenic
1068559189 10:58494206-58494228 TGGGATTAGTAAATGAGCATTGG - Intergenic
1068856270 10:61800477-61800499 TCTATTAAGAACATGAGCATTGG + Intergenic
1068933113 10:62611680-62611702 TTGAATGAGTAGATGAATATTGG - Intronic
1069446715 10:68479516-68479538 TGGAATGAGGACAGGAGCACTGG + Exonic
1070128916 10:73643271-73643293 TCGAAGGATTACCTGAGCCTGGG - Intergenic
1070483186 10:76905259-76905281 TAAAATGAGTGCATGAGGATGGG + Intronic
1070973776 10:80588837-80588859 ACGAATGAGTACATCAGCATTGG - Intronic
1073366206 10:102943837-102943859 TAGGATGAGAACATGAGCAGAGG - Intronic
1074130611 10:110570162-110570184 TTAAATGAGGACATGAGGATGGG - Intronic
1076551534 10:131281353-131281375 TCTAATTAGTCCATGTGCATTGG - Intronic
1086007481 11:82054901-82054923 TCAAATTGGTAGATGAGCATTGG - Intergenic
1087577446 11:100007235-100007257 TCAAATTGGTAAATGAGCATTGG + Intronic
1089798140 11:120999882-120999904 TGGAATCTGTACATGAGAATGGG + Intergenic
1091580190 12:1781893-1781915 TCATATGAGCAAATGAGCATTGG + Intronic
1092300543 12:7245132-7245154 TTAAATGATTACATGAGTATGGG - Intergenic
1092726311 12:11488953-11488975 TAGAATGAGTACCTCAGCAGTGG + Intronic
1093375134 12:18416560-18416582 TTGAAATAGTAAATGAGCATTGG - Intronic
1100177537 12:92048174-92048196 TTGAATGAGTACATAGGCAATGG - Intronic
1101287482 12:103330041-103330063 TTGAAGGAGTAAATGAGCAAAGG - Intronic
1105666144 13:22558695-22558717 TCAAATGAGGATATGAGAATAGG + Intergenic
1106497570 13:30294821-30294843 TCATATTAGTAAATGAGCATTGG - Intronic
1114365436 14:22021887-22021909 TGGAATGAGTACTTAAGCTTAGG + Intergenic
1120323701 14:82998879-82998901 TTGAATTGGTAAATGAGCATTGG + Intergenic
1122088237 14:99321561-99321583 TAGTGTGAGTACATGTGCATGGG - Intergenic
1125515336 15:40316085-40316107 TAGAATGGGCACATGATCATGGG - Intergenic
1130323518 15:82859792-82859814 TCAAATAAGTACATGGGCAAAGG + Intronic
1133455655 16:5940363-5940385 TCAAATGAGAACGTGAACATTGG - Intergenic
1133496496 16:6323080-6323102 TCGAATGAGTACATGAGCATGGG + Intronic
1134419554 16:14072428-14072450 TCTAATGAGTACATTTGTATTGG + Intronic
1146696544 17:34912970-34912992 TTGAATGAATAAAAGAGCATGGG - Intergenic
1159020556 18:63139613-63139635 TAAAATGAGGACAGGAGCATGGG - Intronic
1166481935 19:43181936-43181958 TGAAATGAGTCCATGGGCATTGG + Intronic
928219229 2:29389403-29389425 TGGCATGAGCACATGAGCAGAGG + Intronic
928835553 2:35540200-35540222 TCTAGTGAGTCCATAAGCATGGG + Intergenic
936225862 2:110650495-110650517 TTGAATCAGGACAGGAGCATGGG - Intronic
939028600 2:137043730-137043752 TTGTCTGAGAACATGAGCATGGG + Intronic
941056613 2:160796681-160796703 TCAAAATAGTAAATGAGCATGGG - Intergenic
947020671 2:225672056-225672078 TTGAAATAGTAAATGAGCATTGG + Intergenic
1169673497 20:8130564-8130586 TTGACTGAGTTCATAAGCATTGG + Intergenic
1170678095 20:18500790-18500812 TAGAATGATCACTTGAGCATGGG + Intergenic
1177380254 21:20331368-20331390 TTAAATGAGTTCATTAGCATGGG - Intergenic
1177687547 21:24457887-24457909 TACAATAAGTACATGAACATAGG + Intergenic
1179814109 21:43892626-43892648 TCGGAATAGTATATGAGCATTGG + Intronic
1185009830 22:48306720-48306742 TCAAATGAGGAAATGAGCAGGGG + Intergenic
951412972 3:22387611-22387633 TCAAGTGAGAACATGATCATCGG - Intergenic
952179307 3:30901346-30901368 TTGAATGAGTGCCTGATCATTGG - Intergenic
953081314 3:39621160-39621182 TTAAATGAGTTCATGAGAATGGG - Intergenic
955759757 3:62266640-62266662 TCCAATGAGTGGATCAGCATAGG - Intronic
957469059 3:80634877-80634899 TTGAAACGGTACATGAGCATTGG + Intergenic
965836898 3:172862802-172862824 TCAAATCAGGTCATGAGCATGGG + Intergenic
971382898 4:26116094-26116116 TTGAATGAGAACATGAGAAATGG - Intergenic
974560996 4:63517955-63517977 TCGAAATAGCAAATGAGCATTGG - Intergenic
976848512 4:89517572-89517594 TTGAATGAATACATAAGCAAAGG - Intergenic
978064933 4:104385715-104385737 AGGATTGAGTTCATGAGCATGGG - Intergenic
981508969 4:145533989-145534011 TTAAATGAGACCATGAGCATGGG + Intronic
982988040 4:162234807-162234829 TCGAATGAGTCTATGATCACAGG - Intergenic
983525581 4:168757438-168757460 TCAAATCATTACATGGGCATTGG - Intronic
984690888 4:182724896-182724918 TCGAATGGGTACATATGCTTGGG - Intronic
985088129 4:186335568-186335590 TGGAATGGTTAAATGAGCATTGG - Intergenic
986289730 5:6390221-6390243 TAGAGTGAGTACATGGTCATGGG - Intergenic
986545536 5:8892561-8892583 TTAGATGAGTTCATGAGCATAGG + Intergenic
989178564 5:38554680-38554702 CAGAATGTTTACATGAGCATAGG + Intronic
992385201 5:76278152-76278174 CACAATGTGTACATGAGCATGGG - Intronic
992931959 5:81657004-81657026 TCAAATGATTCCATGAGCGTGGG - Intronic
993496359 5:88613816-88613838 TGGAATAAAAACATGAGCATAGG + Intergenic
995446611 5:112251818-112251840 TCAAACGAATACATGAGCACAGG + Intronic
999868279 5:155725820-155725842 TCTCATGAGAACATGAGCATGGG - Intergenic
1000528789 5:162392401-162392423 ATGAATGAGTACATGAACAAAGG - Intergenic
1002016620 5:176329092-176329114 ACAAATGAGTGCATGAGAATGGG - Intronic
1005494109 6:26374030-26374052 TTGAATGTGTACCTGGGCATAGG - Intronic
1006768293 6:36528799-36528821 TTGAATGACTACATCAGAATGGG + Intronic
1011335057 6:86250977-86250999 TGTAATGATTACATGAGTATTGG + Intergenic
1011721568 6:90162209-90162231 TTGAATAAGTCAATGAGCATAGG + Intronic
1011737261 6:90323915-90323937 TCGAAATGGTAAATGAGCATTGG + Intergenic
1014741136 6:125148590-125148612 TTGAAAGAGAACATGAGCTTTGG - Intronic
1016344071 6:143092672-143092694 TCGAAATGGTAAATGAGCATTGG + Intronic
1016610562 6:145984295-145984317 ATGAATGACTACATGAGCATGGG + Intergenic
1017271550 6:152513314-152513336 TTAAATGAGTTCATAAGCATGGG + Intronic
1022241590 7:28517583-28517605 TCCAAAAAGTACATGAACATAGG - Intronic
1024852656 7:53739098-53739120 TTGAATTAGTAAATGAGCATTGG - Intergenic
1031269233 7:119624735-119624757 TCGAATGACTTTATGAGCACAGG - Intergenic
1034743369 7:153499059-153499081 TTGAAATAGCACATGAGCATTGG - Intergenic
1036994689 8:13642089-13642111 TGGAATGAATACATGATGATAGG + Intergenic
1041374339 8:57197591-57197613 TTGAATAAGTAGATGTGCATTGG + Intergenic
1044531475 8:93312616-93312638 TCCACTGAGAACATGAGAATAGG - Intergenic
1049875225 8:145013542-145013564 TGGAATGATTACTTGAGCCTAGG - Intergenic
1055690461 9:78824549-78824571 TCAAATGAGATCATGAGAATGGG - Intergenic
1190967248 X:55312481-55312503 TCGTATGAATAAATGAGCAACGG + Intergenic
1194836115 X:98685301-98685323 GCTAATGAGTACAGGAGTATGGG + Intergenic