ID: 1133496497

View in Genome Browser
Species Human (GRCh38)
Location 16:6323083-6323105
Sequence AATGAGTACATGAGCATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133496494_1133496497 -10 Left 1133496494 16:6323070-6323092 CCTTTTTCGATCGAATGAGTACA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1133496497 16:6323083-6323105 AATGAGTACATGAGCATGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 262
1133496487_1133496497 30 Left 1133496487 16:6323030-6323052 CCAGCTTCCCTCTGCATATAAGG 0: 1
1: 0
2: 3
3: 15
4: 196
Right 1133496497 16:6323083-6323105 AATGAGTACATGAGCATGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 262
1133496493_1133496497 22 Left 1133496493 16:6323038-6323060 CCTCTGCATATAAGGGGCAGGAA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1133496497 16:6323083-6323105 AATGAGTACATGAGCATGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 262
1133496492_1133496497 23 Left 1133496492 16:6323037-6323059 CCCTCTGCATATAAGGGGCAGGA 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1133496497 16:6323083-6323105 AATGAGTACATGAGCATGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133496497 Original CRISPR AATGAGTACATGAGCATGGG AGG Intronic
900790960 1:4680428-4680450 AAAGTGGACATGAACATGGGGGG + Intronic
901332065 1:8417826-8417848 AGCAAGTACATGAGCATGGTTGG - Intronic
902433818 1:16384091-16384113 AATAATTACAGGAGCATTGGAGG + Intronic
905279945 1:36842659-36842681 AATGAGTTTATGCCCATGGGGGG + Intronic
905470008 1:38184843-38184865 ACTGAGGACATGAGCATGCCAGG - Intergenic
906705464 1:47891710-47891732 AAAGACTGCTTGAGCATGGGAGG + Intronic
906920430 1:50058701-50058723 AAGGATTACCTGAGCCTGGGGGG - Intronic
908183128 1:61625961-61625983 AAGGATTACTTGAGCTTGGGAGG - Intergenic
909623442 1:77689987-77690009 AAGGATTGCTTGAGCATGGGAGG + Intergenic
911324163 1:96449930-96449952 AAGGATCACCTGAGCATGGGAGG - Intergenic
912729385 1:112088725-112088747 AATGAGTGCTTCAGGATGGGTGG - Intergenic
913575391 1:120168163-120168185 AAAGAGTACAAGAGCATCAGAGG - Intronic
914557696 1:148783803-148783825 AAAGAGTACAAGAGCATCAGAGG - Intergenic
914615138 1:149346427-149346449 AAAGAGTACAAGAGCATCAGAGG + Intergenic
915594102 1:156886737-156886759 CCTGTGTACATGAGCCTGGGGGG - Intergenic
916450768 1:164918288-164918310 AATCAGTCCAGGAGCATGAGGGG + Intergenic
917162263 1:172070998-172071020 AAGGATCACATGAGCCTGGGAGG + Intronic
917476635 1:175374412-175374434 TATGAGGGCATGAGCATGTGTGG + Intronic
917518623 1:175729726-175729748 AATGAATGAATCAGCATGGGTGG + Intronic
918086975 1:181253972-181253994 AATGGGTAAATGAGCTTGAGAGG - Intergenic
921009472 1:211126591-211126613 AAGGATTACTTGAGCCTGGGAGG + Intronic
921275182 1:213512008-213512030 AATGACTAAATGAGCATGTGAGG + Intergenic
922760565 1:228127511-228127533 AAAGATTGCTTGAGCATGGGAGG - Intergenic
924744020 1:246815895-246815917 CAGGAGTCCAAGAGCATGGGAGG - Intergenic
1063783090 10:9349477-9349499 AGTGAGTACATTTACATGGGTGG + Intergenic
1065125258 10:22567907-22567929 AATAAAAACATGCGCATGGGAGG + Intronic
1065126995 10:22583535-22583557 ACTGAGGACATTAGCATGGTGGG + Intronic
1065586527 10:27223818-27223840 GAGGATTACATGAGCCTGGGAGG + Intronic
1065816220 10:29485164-29485186 AATGAGCACATGAGAGGGGGAGG - Intronic
1068388255 10:56359872-56359894 AATGAGTACATGAGTGAGGGTGG + Intronic
1071492013 10:86142723-86142745 CATGAGTCCATGAGTATGGTAGG + Intronic
1072409554 10:95187425-95187447 AATGCGGCCATGAGCAAGGGTGG - Intergenic
1073013505 10:100380131-100380153 AAGGAGCACTTGAGCCTGGGAGG + Intergenic
1075443753 10:122499570-122499592 AGTGAGCACATGGGCAGGGGAGG - Intronic
1076614074 10:131744824-131744846 CAGGAGGACAGGAGCATGGGAGG + Intergenic
1078061355 11:8047162-8047184 AAAGAGTACATGAGTTTGGGGGG - Intronic
1079010824 11:16826706-16826728 AGTGAGGACATGAGCATGAAAGG - Intronic
1080502794 11:32886452-32886474 AAGGATTACCTGAGCCTGGGAGG - Intergenic
1081147817 11:39585049-39585071 AAGGATTACTTGAGCCTGGGAGG - Intergenic
1082262036 11:50083789-50083811 AAAGAAGACATGAGCATGGTAGG - Intergenic
1082898804 11:58222955-58222977 AATCAGTACAAGAGCATTAGCGG - Intergenic
1084515430 11:69635785-69635807 AGTGAGAAGATGAGGATGGGTGG + Intergenic
1084690891 11:70725824-70725846 AATGTGTACAGAAGCATGGGGGG + Intronic
1084936071 11:72587391-72587413 AATGACTGCATGAGCCAGGGTGG - Intronic
1085387510 11:76165384-76165406 AAGGAGGACATGTGCACGGGGGG + Intergenic
1087871668 11:103301893-103301915 AATGAGTACATGGGCAAGAAAGG - Intronic
1088227069 11:107632852-107632874 AATGAGAACAAGAGAATGGATGG - Intronic
1088550511 11:111008396-111008418 AAAAACTACATGAGGATGGGAGG - Intergenic
1092480830 12:8857770-8857792 AATGAGGACAAGAACAGGGGAGG - Intronic
1093336699 12:17913194-17913216 AATAAGTGCATGAACAAGGGAGG + Intergenic
1094643386 12:32298091-32298113 AAGGATTACTTGAGCCTGGGAGG + Intronic
1094788392 12:33879262-33879284 AATGAGCAGATGAGCATATGAGG + Intergenic
1096643683 12:53015588-53015610 GAGGATCACATGAGCATGGGAGG + Intronic
1096783397 12:54003670-54003692 TATGAGTACATGAGATTGGAGGG + Intronic
1097853431 12:64436668-64436690 GAAGAGTACTTGAGCCTGGGAGG - Intronic
1098212558 12:68181897-68181919 AATGCTGACATGAGGATGGGTGG - Intergenic
1101215134 12:102573869-102573891 AATGAGTACTTAAGCACTGGAGG + Intergenic
1101266442 12:103093341-103093363 AATGTGTAAATGGGCATGGCGGG - Intergenic
1101287481 12:103330038-103330060 AAGGAGTAAATGAGCAAAGGAGG - Intronic
1103095088 12:118126267-118126289 AATGTGTTCAAGAGCATGGCCGG + Intronic
1103134872 12:118498608-118498630 AATGAGATCCTGGGCATGGGAGG - Intergenic
1103251145 12:119500983-119501005 ATTGAGTAGATGAGTTTGGGAGG - Intronic
1104074607 12:125378048-125378070 AATGAGGATATGGGAATGGGAGG + Intronic
1106200644 13:27534023-27534045 AATGAGTATGTGAGGGTGGGTGG - Intergenic
1106993336 13:35450395-35450417 AATGATTGCTTGAGCCTGGGAGG + Intronic
1109326835 13:60878186-60878208 AACAAGTACATGAGCATGAATGG - Intergenic
1109456068 13:62591843-62591865 AATGCCTGCATGAGCATGAGTGG - Intergenic
1110221144 13:73075358-73075380 AATGACTAGATGAGCCTGAGTGG - Intronic
1110303471 13:73956833-73956855 AATGATCACTTGAGCCTGGGAGG + Intronic
1111144402 13:84161546-84161568 AATGAGTTCATGAGCTTTGCAGG - Intergenic
1113509765 13:110843826-110843848 AATGGGAACAGCAGCATGGGGGG - Intergenic
1113868571 13:113544518-113544540 AAAGAGTAAATGAGCAAGCGTGG - Intronic
1113933929 13:113983221-113983243 AATGGTGGCATGAGCATGGGTGG + Intronic
1113934281 13:113985219-113985241 AATGGTGGCATGAGCATGGGTGG + Intronic
1113934625 13:113987209-113987231 AATGGTGGCATGAGCATGGGTGG + Intronic
1115990574 14:39145697-39145719 AAGGGTTTCATGAGCATGGGAGG - Intergenic
1116044170 14:39722453-39722475 AATGTGAACAAGAGCATGGAGGG - Intergenic
1117829265 14:59733716-59733738 AGGGAGAACATGAGCAGGGGTGG - Intronic
1119401900 14:74368377-74368399 AAGGAATACCTGAGCCTGGGAGG + Intergenic
1119478320 14:74944633-74944655 AATGATCACCTGAGCCTGGGAGG - Intronic
1122356879 14:101128257-101128279 AATGAGTAGATGAGGAAGGAAGG + Intergenic
1126671914 15:51123752-51123774 AATGAGTTCATGTGCTTCGGAGG - Intergenic
1126823016 15:52523420-52523442 AATGAATACTTAAGCAGGGGAGG - Intronic
1126973943 15:54152155-54152177 AATGAGTTCATGAGGGTGAGGGG - Intronic
1129174170 15:73828124-73828146 AATGAATAAATGAGCAAGTGAGG + Intergenic
1131790387 15:95958179-95958201 GATGGGTCCATGAGGATGGGAGG + Intergenic
1132236284 15:100224304-100224326 AGTGAGTACAGGAGGGTGGGGGG + Intronic
1133420501 16:5642626-5642648 AGTGAGGACATGAGGCTGGGTGG - Intergenic
1133496497 16:6323083-6323105 AATGAGTACATGAGCATGGGAGG + Intronic
1133562938 16:6966397-6966419 AAGGGGTACATGACCCTGGGGGG + Intronic
1134241854 16:12512501-12512523 AAAGATCACTTGAGCATGGGAGG - Intronic
1134276310 16:12779671-12779693 AATGAAAACATGAGAATGGCCGG - Intronic
1135698192 16:24609149-24609171 AATGAAAACATGAGCAAAGGAGG + Intergenic
1136013506 16:27380320-27380342 CATGAGTGCATGAGCAAGAGCGG + Intergenic
1137797413 16:51233726-51233748 AATGAATTCAAGAGTATGGGTGG + Intergenic
1138231509 16:55340348-55340370 AATGAGGACATGAGGATGGATGG + Intergenic
1139703238 16:68722559-68722581 CATGAGTACATGAGCACGTGGGG + Intronic
1140633544 16:76883299-76883321 AATGAAAACATGAGCCTGGATGG + Intergenic
1140922084 16:79548744-79548766 CATGAGTCCATGAGTATGGTGGG - Intergenic
1144171516 17:12663989-12664011 GATTAGGACATGAACATGGGAGG - Intergenic
1144892292 17:18500985-18501007 GATGAGGACACGAGGATGGGAGG + Intergenic
1145139922 17:20443303-20443325 GATGAGGACACGAGGATGGGAGG - Intergenic
1147003813 17:37385505-37385527 AAGGAGTACATGAAGCTGGGTGG + Intronic
1147633124 17:41945420-41945442 GAGGATTACATGAGCCTGGGAGG + Intronic
1148056765 17:44802911-44802933 AATGATTGCTTGAGCCTGGGAGG + Exonic
1148129342 17:45253742-45253764 CATGTGTACATGGGCATGTGTGG + Intergenic
1148742868 17:49902508-49902530 AGGGAGCACATCAGCATGGGAGG - Intergenic
1149031746 17:52091541-52091563 AACGAGTAACTGAGAATGGGGGG - Intronic
1153116743 18:1666259-1666281 TATCAGTACCTGAGCATTGGAGG - Intergenic
1156197482 18:34791264-34791286 ACTGGGAACTTGAGCATGGGAGG - Intronic
1156299599 18:35824616-35824638 AATAAGTAGATGGGAATGGGAGG + Intergenic
1157329363 18:46692273-46692295 GAAGAGTACATGAGCAGGGTAGG + Intronic
1161498765 19:4601682-4601704 AATGAGTGCATGAGGTAGGGAGG + Intergenic
1161611995 19:5248197-5248219 AATGGGGAAATGAGCGTGGGGGG + Intronic
1162490755 19:10990077-10990099 GAGGAGGACATGAGCCTGGGAGG - Intronic
1162789930 19:13057547-13057569 GAGGAGGACATGAGCAGGGGAGG - Intronic
1164141444 19:22469885-22469907 AATGATCACTTGAGCCTGGGAGG - Intronic
1164552779 19:29225637-29225659 AATGACCACATGAGCAAGGCAGG + Intergenic
1164642331 19:29835236-29835258 ACTGAGTACTGGAGCAAGGGTGG - Intergenic
926004607 2:9363671-9363693 AAGGATTGCATGAGCCTGGGAGG - Intronic
928409629 2:31044823-31044845 GATGATCACTTGAGCATGGGAGG + Intronic
928682799 2:33719887-33719909 AATGAGTTCATGTGCTTTGGGGG - Intergenic
929637645 2:43541596-43541618 AAGGATTGCATGAGCCTGGGAGG - Intronic
929731780 2:44502415-44502437 AAAGGGTACAAGGGCATGGGAGG - Intronic
931213522 2:60220370-60220392 TATAAGCACATGTGCATGGGTGG - Intergenic
932300115 2:70660915-70660937 AAGAAGTTCATGAGCATAGGAGG - Exonic
933711492 2:85329272-85329294 AAGGATTACTTGAGCCTGGGAGG + Intergenic
936482743 2:112900232-112900254 AAAGATCACTTGAGCATGGGAGG + Intergenic
937078814 2:119125957-119125979 AATGAGCATATGAGCATGAGAGG + Intergenic
938771517 2:134505021-134505043 TATGAGCACATGTGCATGAGAGG + Intronic
939883816 2:147659465-147659487 ACTGAGTTCTGGAGCATGGGGGG - Intergenic
941384335 2:164834722-164834744 AATATGCAAATGAGCATGGGTGG + Intronic
941411210 2:165159444-165159466 AAGGATTACTTGAGCCTGGGAGG - Intronic
944304083 2:198158567-198158589 CATGAGAACAGCAGCATGGGTGG - Intronic
945248431 2:207742592-207742614 AATGTGTACATGTGCATTGATGG - Intronic
947255621 2:228160555-228160577 CATGAGAACAGCAGCATGGGGGG + Intronic
947263692 2:228252615-228252637 AATGAGTCCTTGTGCATGGTAGG + Intergenic
947384115 2:229573566-229573588 AATGAGTGCATGAGAATGGAAGG - Intronic
947584104 2:231341940-231341962 AATGAGTACAGGTGGATGTGAGG + Intronic
947990622 2:234484812-234484834 AATTAGGACATGAGCATTTGGGG - Intergenic
948096235 2:235336271-235336293 CATCAGCACATGAGCATGGCTGG + Intergenic
948843945 2:240674353-240674375 TATCAGTAACTGAGCATGGGAGG - Intergenic
948849866 2:240700282-240700304 TATCAGTAACTGAGCATGGGAGG + Intergenic
1170555198 20:17509171-17509193 GATGAGGTCATGAGGATGGGGGG + Intronic
1172423222 20:34835566-34835588 AAGGATTACTTGAGCCTGGGAGG - Intergenic
1172767267 20:37357427-37357449 AGTGAGTACCTGATCATGGATGG - Intronic
1173285193 20:41664413-41664435 AATAATTATATAAGCATGGGGGG + Intergenic
1174033288 20:47648560-47648582 AATGATCACCTGAGCCTGGGAGG - Intronic
1174448415 20:50605686-50605708 AAGGAGCACCTGAGCCTGGGAGG + Intronic
1175033095 20:55974471-55974493 AATGAGAGCCTGACCATGGGAGG + Intergenic
1175793267 20:61756014-61756036 AGTGGGAACGTGAGCATGGGGGG - Intronic
1176904115 21:14479242-14479264 CATGAGGTCATGAGCATTGGTGG + Intergenic
1177504192 21:22000049-22000071 TATGAGGACATGAGAATTGGAGG - Intergenic
1179283170 21:39952396-39952418 AATGAGCACGTGAGCAAGTGAGG - Intergenic
1181156389 22:20924096-20924118 AAAGATTGCTTGAGCATGGGAGG + Intronic
1181939346 22:26463421-26463443 AATGAGGCCATGAGCAGGGGCGG + Intronic
1182975816 22:34623169-34623191 AAGCAGTGCATGAGGATGGGAGG + Intergenic
1183852305 22:40600625-40600647 AATGAGCACATGAGCATGTTCGG - Intronic
949238119 3:1836051-1836073 GAGGATTACATGAGCCTGGGAGG - Intergenic
949927212 3:9051114-9051136 AAGGATTACTTGAGCCTGGGAGG - Intronic
950871906 3:16236883-16236905 AATAAGAACATGAACATGGAAGG + Intergenic
952765461 3:36949487-36949509 AATGAGTAGATAAGCATCTGAGG - Intergenic
953239011 3:41131805-41131827 AATGAATTCATGTGCATGAGAGG - Intergenic
953995875 3:47519220-47519242 GAGGATTACATGAGCCTGGGAGG + Intergenic
956219519 3:66887091-66887113 AATGATTTCATGTACATGGGAGG - Intergenic
956571298 3:70698897-70698919 AATGAGTGGAAAAGCATGGGAGG + Intergenic
956677705 3:71751635-71751657 AGTGAGCACTTGAGCAAGGGAGG - Intronic
957191934 3:77021109-77021131 GAGGAATACATGAGCCTGGGAGG + Intronic
957459430 3:80497613-80497635 TAGGAGCACATGAGCATGGGAGG - Intergenic
957670598 3:83296274-83296296 AAGGAGTACATGTGCAGGTGGGG + Intergenic
957739248 3:84242101-84242123 AAGGAGAACATAAGGATGGGAGG + Intergenic
958973339 3:100637932-100637954 AATGTGTAGATGAGCAAGTGTGG + Intronic
962247348 3:133806543-133806565 AATCAGTATATGTGCATGGCTGG - Intronic
963321524 3:143814334-143814356 AATGAGTTGATGAGCATAGATGG + Intronic
963408403 3:144898622-144898644 AGTGAGTCCATGAGATTGGGTGG - Intergenic
964428947 3:156583680-156583702 AATAATTACATGAGCATTTGGGG - Intergenic
964606813 3:158569292-158569314 AATGAATACTCCAGCATGGGAGG - Intergenic
966064405 3:175800558-175800580 AATGAGTACATGATGAGGGGTGG - Intronic
967840420 3:194000911-194000933 AAGGATTGCATGAGCCTGGGAGG - Intergenic
968266084 3:197364487-197364509 GAGGAGTACTTGAGCCTGGGAGG - Intergenic
969044434 4:4326560-4326582 GAAGATCACATGAGCATGGGAGG - Intergenic
969266771 4:6069661-6069683 AAAGATTACTTGAGCCTGGGAGG + Intronic
969538468 4:7770965-7770987 AATGGGGACAAGAGCATGGTGGG - Intronic
970116668 4:12704856-12704878 AATGAATAGATGAGCATGAACGG - Intergenic
971894567 4:32575479-32575501 AAGGACTACTTGAGCCTGGGAGG + Intergenic
972707966 4:41564197-41564219 GATGAGGAAAGGAGCATGGGAGG + Intronic
974999078 4:69197956-69197978 AATGGGTAAATGAGCTTGAGAGG - Intronic
976848511 4:89517569-89517591 AATGAATACATAAGCAAAGGTGG - Intergenic
978512724 4:109538872-109538894 GAGGATTACTTGAGCATGGGAGG - Intronic
980556885 4:134419092-134419114 AATGGGCTCATGAGCATGAGTGG - Intergenic
980959721 4:139463074-139463096 GAGGATTACTTGAGCATGGGAGG + Intronic
981183707 4:141776233-141776255 AATAAGTAAATGGGCCTGGGTGG - Intergenic
981259194 4:142699305-142699327 AATGAGGACATGAGGAGGGAAGG - Intronic
981320556 4:143386959-143386981 AATGGGGAAATGAACATGGGAGG + Intronic
984666372 4:182433675-182433697 AATGAGGATTTGAACATGGGAGG + Intronic
984786497 4:183572169-183572191 AAGGATCACTTGAGCATGGGAGG - Intergenic
986091505 5:4512759-4512781 GATGAGCCCACGAGCATGGGTGG + Intergenic
988821120 5:34886889-34886911 AATGAGTACTTGGGTATGGATGG - Intronic
990322163 5:54640652-54640674 AATGAGTAAAAGAGCTTGTGGGG + Intergenic
991647010 5:68810291-68810313 AAGGACTACCTGAGCCTGGGAGG + Intergenic
992919019 5:81493372-81493394 AAGGATTACTTGAGCCTGGGAGG - Intronic
992935520 5:81699943-81699965 AAAGATTACCTGAGCCTGGGAGG - Intronic
997334953 5:133100893-133100915 AAGGACCACTTGAGCATGGGAGG - Intronic
997955018 5:138272551-138272573 AAGGATTACTTGAGTATGGGAGG + Intronic
998064931 5:139150464-139150486 CATGAGAACAGGAGCATAGGGGG - Intronic
998146890 5:139734137-139734159 ACGGAGTACATGGGCATGTGTGG + Intergenic
998362315 5:141599696-141599718 AATTAGCCCATGAGCAAGGGTGG - Intronic
999985076 5:156995801-156995823 AAAGATTACTTGAGCCTGGGAGG + Intergenic
1001701053 5:173706712-173706734 AATGAGGTCATGAGGGTGGGGGG - Intergenic
1003207803 6:4029431-4029453 AAGGATTACTTGAGCCTGGGAGG - Intronic
1004500403 6:16204869-16204891 AAGGATTGCATGAGCCTGGGAGG + Intergenic
1005755164 6:28919579-28919601 AATGAGCACTTGAGCAGGAGTGG - Intronic
1005795220 6:29353336-29353358 AATAAATATATGAACATGGGGGG - Intergenic
1006588218 6:35133264-35133286 AAGGATTACTTGAGCCTGGGAGG - Intronic
1006870490 6:37246811-37246833 AAGGACTGCTTGAGCATGGGAGG + Intronic
1007915143 6:45554399-45554421 CCTGAGTACATGTGCAGGGGTGG - Intronic
1013395049 6:109727376-109727398 AAAAAGTACTTGAGCCTGGGAGG - Intronic
1013748710 6:113376021-113376043 AGTAAGTACATGCGTATGGGTGG - Intergenic
1014683066 6:124457725-124457747 AATGAATACGTGAGTATGTGGGG - Intronic
1017367193 6:153657177-153657199 AATGATTAAATGAGAAAGGGAGG + Intergenic
1018468429 6:164074074-164074096 AATGAGTTCGTTATCATGGGAGG - Intergenic
1020962232 7:14819498-14819520 AAGGATTACTTGAGCCTGGGAGG + Intronic
1022949017 7:35317812-35317834 AAGGAGAACATGAACATTGGGGG - Intergenic
1023505533 7:40896514-40896536 CATGAGAACAGCAGCATGGGGGG - Intergenic
1024470920 7:49768321-49768343 AGTGAGTGCATGAGCAGGAGTGG + Intergenic
1025183554 7:56838149-56838171 AAAGAAGACATGAGCATGGTGGG - Intergenic
1027203743 7:76080624-76080646 AAAGAATAAATGAGCATGGTGGG - Intergenic
1027979191 7:85195540-85195562 GAAGAGTGCTTGAGCATGGGAGG - Intergenic
1031591413 7:123596520-123596542 GATGATTACTTGAGCCTGGGAGG + Intronic
1031634319 7:124083326-124083348 AAAGAGAAAATGAGGATGGGTGG - Intergenic
1032428292 7:131839720-131839742 AAGGATTACTTGAGCCTGGGAGG - Intergenic
1032876488 7:136044032-136044054 CATGAGAACAGCAGCATGGGGGG - Intergenic
1033261115 7:139844908-139844930 AATGAGGAAATGAGCAAGGAGGG - Intronic
1041931054 8:63286886-63286908 AATGTGTATAAGAGGATGGGGGG - Intergenic
1041965236 8:63668177-63668199 TATGAGTACATGAGATTTGGAGG + Intergenic
1043282978 8:78491787-78491809 ATTGGGTACAAGAGCCTGGGAGG + Intergenic
1043749156 8:83913309-83913331 ATTGAGTACATGTAAATGGGAGG + Intergenic
1046364649 8:113210974-113210996 AAAGAGAACATGGACATGGGAGG - Intronic
1046928713 8:119821940-119821962 AATGATTGCTTGAGCCTGGGAGG + Intronic
1047257981 8:123230573-123230595 AATGATTGCTTGAGCCTGGGAGG - Intronic
1047387738 8:124425541-124425563 AATGTGTCCATAAGCATGGTGGG - Intergenic
1048690500 8:136956866-136956888 AATGTGCATATGGGCATGGGAGG - Intergenic
1049470599 8:142773558-142773580 CCTGAGAACATGAGGATGGGAGG - Intronic
1050534625 9:6621078-6621100 AAGGATCACATGAGCCTGGGAGG + Intronic
1051297488 9:15611784-15611806 AATGAATACAGGAGCATTGTTGG - Intronic
1055018038 9:71640216-71640238 AATCATTACTTGAGAATGGGTGG - Intergenic
1057763370 9:97894215-97894237 AAGGATTACTTGAGCCTGGGAGG - Intergenic
1057832335 9:98416988-98417010 AAAGAGGACATGAACAGGGGAGG - Intronic
1058752450 9:108052481-108052503 AAGGAGAGCATGAGCATGGCAGG + Intergenic
1059746972 9:117211927-117211949 CAAGATTGCATGAGCATGGGAGG - Intronic
1059858709 9:118432434-118432456 AATGAGTTCATGATTATGGCAGG - Intergenic
1060508253 9:124214508-124214530 AATGTGAACATGTGAATGGGAGG + Intergenic
1061338150 9:129956965-129956987 AATGAGAACTTGGGGATGGGTGG + Intronic
1185520560 X:735373-735395 AAAGATCACATGAGCCTGGGAGG - Intergenic
1185972886 X:4684317-4684339 GATGATTACTTGAGCCTGGGAGG + Intergenic
1186510771 X:10128334-10128356 AATGTGTTCATGGTCATGGGTGG + Intronic
1186840669 X:13481892-13481914 AATGATCACATGAGGATAGGTGG - Intergenic
1187097643 X:16164420-16164442 TGTGAGTACAGGAGCATGGGAGG - Intergenic
1187498474 X:19816716-19816738 AAGGAGCACTTGAGCCTGGGAGG + Intronic
1188240850 X:27787428-27787450 ATTGATTTCATGAGCATGTGAGG - Intergenic
1189275403 X:39781698-39781720 AAGGATCACCTGAGCATGGGAGG - Intergenic
1189688978 X:43595611-43595633 ACGGAGTACATAAGGATGGGAGG + Intergenic
1190079057 X:47341044-47341066 GATGATTACTTGAGCCTGGGAGG - Intergenic
1191208598 X:57860816-57860838 AATGAGTTCATGAGCTTTGCAGG + Intergenic
1191679861 X:63830022-63830044 AATGAGAAAAGCAGCATGGGGGG - Intergenic
1192536474 X:71932688-71932710 AAAGAGTACATGAGTGTAGGTGG + Intergenic
1194702477 X:97131014-97131036 AAGGATTACCTGAGCCTGGGAGG + Intronic
1194836116 X:98685304-98685326 AATGAGTACAGGAGTATGGGTGG + Intergenic
1195024292 X:100860849-100860871 AAGGATTACTTGAGCCTGGGAGG - Intronic
1195357130 X:104049335-104049357 AGTGAGTGCCTGAGAATGGGTGG + Intergenic
1196134146 X:112188787-112188809 AATGAGTATAGGAAAATGGGAGG - Intergenic
1196862841 X:120043716-120043738 GAGGAGTACTTGAGCCTGGGAGG + Intergenic
1196880261 X:120192628-120192650 GAGGAGTACTTGAGCCTGGGAGG - Intergenic
1198464926 X:136896528-136896550 AATGAGGTCATGAGAGTGGGTGG - Intergenic
1198700097 X:139387638-139387660 AATGAGTACATGTCTTTGGGAGG + Intergenic
1201402698 Y:13620403-13620425 AATGAGGACATGAGATTTGGGGG - Intergenic
1201475285 Y:14375010-14375032 AATGAATAAATGAGCCTGAGAGG + Intergenic