ID: 1133507003

View in Genome Browser
Species Human (GRCh38)
Location 16:6422215-6422237
Sequence AAAAAAAAGGAGAGGTGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1654
Summary {0: 1, 1: 0, 2: 14, 3: 141, 4: 1498}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133507003_1133507009 8 Left 1133507003 16:6422215-6422237 CCCGACCACCTCTCCTTTTTTTT 0: 1
1: 0
2: 14
3: 141
4: 1498
Right 1133507009 16:6422246-6422268 CTCAACTTTCTTTAGATTCAGGG 0: 1
1: 1
2: 2
3: 25
4: 236
1133507003_1133507008 7 Left 1133507003 16:6422215-6422237 CCCGACCACCTCTCCTTTTTTTT 0: 1
1: 0
2: 14
3: 141
4: 1498
Right 1133507008 16:6422245-6422267 ACTCAACTTTCTTTAGATTCAGG 0: 1
1: 0
2: 2
3: 12
4: 240
1133507003_1133507010 9 Left 1133507003 16:6422215-6422237 CCCGACCACCTCTCCTTTTTTTT 0: 1
1: 0
2: 14
3: 141
4: 1498
Right 1133507010 16:6422247-6422269 TCAACTTTCTTTAGATTCAGGGG 0: 1
1: 0
2: 10
3: 50
4: 404
1133507003_1133507011 19 Left 1133507003 16:6422215-6422237 CCCGACCACCTCTCCTTTTTTTT 0: 1
1: 0
2: 14
3: 141
4: 1498
Right 1133507011 16:6422257-6422279 TTAGATTCAGGGGTACATGTAGG 0: 1
1: 0
2: 6
3: 18
4: 140
1133507003_1133507012 25 Left 1133507003 16:6422215-6422237 CCCGACCACCTCTCCTTTTTTTT 0: 1
1: 0
2: 14
3: 141
4: 1498
Right 1133507012 16:6422263-6422285 TCAGGGGTACATGTAGGTGCAGG 0: 1
1: 0
2: 4
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133507003 Original CRISPR AAAAAAAAGGAGAGGTGGTC GGG (reversed) Intronic
900077614 1:830531-830553 AGAAAATTGGAGAAGTGGTCTGG - Intergenic
900740072 1:4325717-4325739 AAAAAAAAGGGGAGGAGCACAGG + Intergenic
901120911 1:6892983-6893005 AAAAAAAAAGAGCTGTGGCCGGG + Intronic
901235574 1:7665715-7665737 AAAAAAAAAGAGAGAAAGTCAGG + Intronic
901464286 1:9411326-9411348 AAGAAAAGAGAGAGGTGGGCAGG - Intergenic
901611742 1:10504208-10504230 AAAAGAAAGGAGAGCTGGGAGGG - Intronic
901708398 1:11094594-11094616 AAAAAAAAAAAAAGGTGGCCTGG - Intronic
901745700 1:11371937-11371959 AAAAAAAAGAAAAAGTGGCCAGG - Intergenic
901750751 1:11406129-11406151 AAAAAAAATGGTAGGTAGTCCGG - Intergenic
901826582 1:11865845-11865867 AAAAAAAAAAAGAGGAGGTTAGG - Intergenic
901885427 1:12219368-12219390 AAAAAAGAGAAAAGGTGGCCGGG - Intergenic
901910793 1:12456205-12456227 ATAAAAAAAGAAAGGTGGGCTGG + Intronic
901944824 1:12693215-12693237 AAGCGAAAGGAGAGGTGTTCGGG + Intergenic
902142028 1:14365036-14365058 AAAAAAAAAGAGAGGGGGCCGGG - Intergenic
902148853 1:14426069-14426091 AAAGGAAAGGAGAGGAGGCCGGG - Intergenic
902310497 1:15578281-15578303 AAAAAAGAGGGGAGGAAGTCCGG - Intronic
902314599 1:15608670-15608692 AAAAAAAAGGTGGGGGGGCCAGG - Intergenic
902582358 1:17416071-17416093 AAAAAAAAGGGGGGGGGGGCGGG + Intronic
902667606 1:17950597-17950619 AAAAAAATGGATAGCTGGCCGGG - Intergenic
902830762 1:19010774-19010796 AAAAGAAAGGAGGAGTGGGCAGG + Intergenic
902832057 1:19021577-19021599 AAAAAAAAATTGAGGTGGCCAGG - Intergenic
902851294 1:19159589-19159611 AAAAAAAAGGAGTGGGGCTGGGG - Intronic
902883019 1:19385352-19385374 AGAAGAAAGGAGAGGAGGGCAGG + Intronic
902934751 1:19757005-19757027 AAAAAAAAGTGAAGGAGGTCGGG + Intronic
903060911 1:20668013-20668035 AAAAAAAAAAAGAGGTGGCCGGG + Intronic
903111966 1:21143262-21143284 AAAATAAAGGAGAGGAGGGGAGG + Intronic
903455989 1:23487133-23487155 AAAAAAAAAAAGAGGGGGCCGGG - Intergenic
903508732 1:23857488-23857510 AAAAAAAAAGAGTGGTTTTCTGG - Intronic
903561441 1:24231117-24231139 AAAAAAAAGGTGACCTAGTCTGG + Intergenic
903928327 1:26847840-26847862 ATAAAAAGAGAGAGGAGGTCGGG - Intronic
904136376 1:28315811-28315833 AAAAAAAAGGGGGGGGGGGCGGG - Intergenic
904144429 1:28378566-28378588 AAAAAAAAGGGGGGGGGGGCTGG - Intronic
904146265 1:28394584-28394606 AAAAAAAAGAAAAGATGGCCAGG - Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904382042 1:30118120-30118142 ATAGAAAAAGAGAGATGGTCAGG + Intergenic
904519282 1:31081997-31082019 AAAAAAAAGGATAGGAGGCCAGG + Intergenic
904562414 1:31407501-31407523 AAAAAAAAAAAGAAGTGGCCTGG - Intergenic
904639489 1:31913563-31913585 AAAAAAAAATAGATGTTGTCAGG - Intronic
904670958 1:32165202-32165224 AAAAGAAAAGAAAGTTGGTCTGG - Intronic
904766600 1:32853475-32853497 AAAAAAAAGAAAAGGCGGTGGGG + Intronic
905125727 1:35714928-35714950 AAGGGAAAGGAGAGGTGGCCTGG + Exonic
905135326 1:35794867-35794889 AAAAAAAAGGAGAGGCAGCGGGG - Intergenic
905230360 1:36511383-36511405 AAAAAAAAAAAGAGGAAGTCAGG - Intergenic
905542466 1:38771343-38771365 AAAAAAAAAGAAATGTGGGCTGG + Intergenic
905551518 1:38844468-38844490 AAGAAACAGGAGAGGTGGTCGGG + Intronic
905575301 1:39039339-39039361 AAAAAAAAAGAGGGGAGGCCAGG + Intergenic
905723110 1:40224567-40224589 AAAAAAAAAAAGATGTGGCCAGG - Intronic
905867985 1:41386654-41386676 AAGAAATAGGAGAGGAGGTGTGG - Intergenic
905872326 1:41412197-41412219 AAAAACAAGGAGAGGCCATCAGG + Intergenic
906378149 1:45313531-45313553 AAAAATAAGGCCAGGTGGCCAGG - Intergenic
906379228 1:45321535-45321557 AAAAAAAAAGAAAGGCGGTGTGG - Intergenic
906412234 1:45587951-45587973 AAAAAAAGGGCCAGGTGGTGTGG + Intronic
906648881 1:47496268-47496290 AAAAAAAAGGAGGGGGTGCCAGG - Intergenic
906925463 1:50110967-50110989 AAAAAAAAGGGGAGGGGGACAGG + Intronic
907022894 1:51086392-51086414 AAAAAAAAGCAGGGGTGTGCTGG + Intergenic
907077245 1:51590047-51590069 AAAAAAAGAGAGAGGTAGGCAGG + Intronic
907342331 1:53744819-53744841 AAAAAAAATGAGTGTTGGTGAGG + Intergenic
907361150 1:53916185-53916207 AAAAAAAAAAAGAGGTGATTGGG + Intergenic
907377368 1:54054645-54054667 GAAACAAAGGAGGAGTGGTCAGG - Intronic
907402757 1:54234773-54234795 AAAAAAAAAGAGATGGAGTCTGG + Intronic
907403576 1:54240465-54240487 AAAAAAAAGGGGGGGGGGGCGGG + Intronic
907786974 1:57622026-57622048 AAGAAACAGGAGAGGTGGGAGGG + Intronic
907947139 1:59146566-59146588 AAAAAAAAGAAGAGGAGGGAGGG + Intergenic
908403159 1:63789660-63789682 AAAAAAAAGGAGAGGAAGGATGG - Intronic
908709602 1:67000305-67000327 AAAAAAAAGGAGGGGGAGTAGGG + Exonic
908767744 1:67569690-67569712 AAAAAAAAGGAGAGGGAGTGGGG + Intergenic
909010528 1:70329795-70329817 AAAAAAAAGAACTGGTGGCCAGG + Intronic
909654792 1:78019855-78019877 AAAAAAAAGGAGAGCAGGCTGGG + Intronic
910007906 1:82422348-82422370 AGAAAAAAGGTGAGGTAGACTGG - Intergenic
910165642 1:84324945-84324967 TAATAAAATGAGAAGTGGTCCGG + Intronic
910548713 1:88451601-88451623 AAATAAAAGGAGTGGTGGTATGG - Intergenic
911074010 1:93855509-93855531 AAAGAAAAGAAGAGAAGGTCTGG + Intergenic
911209652 1:95125994-95126016 AAAAAAAAGGAAAAGAGGCCAGG + Intronic
911424868 1:97695832-97695854 AAAGAAAGTGAGAGGTGGCCGGG + Intronic
912582542 1:110733940-110733962 AAAAAAAAGGGGGGGTGGTGGGG - Intergenic
912626883 1:111212834-111212856 AAAAAAAAGGGGGGGGGGGCGGG - Intronic
912918507 1:113842210-113842232 AAAAAAAAGTAGGGGTGGGTGGG + Intronic
913142691 1:115956975-115956997 AAAAAAAAGGTGGGGTGGGGGGG - Intergenic
913284457 1:117213965-117213987 AAAAAAAAGAAGAAGAGATCAGG - Intergenic
913288090 1:117245901-117245923 AAAAAAAAGCAGAGATGGGAGGG - Intergenic
913458150 1:119055315-119055337 AAAAAATCTGAGAAGTGGTCAGG + Intronic
913495444 1:119424075-119424097 AAAAAAATGGAGGGGTGGGGTGG + Intergenic
913970603 1:143412829-143412851 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
913999321 1:143679402-143679424 AAAAAAAAGGAGCGGGGGGTCGG + Intergenic
914064979 1:144238440-144238462 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
914114172 1:144727914-144727936 AAAAAAAAGAAAAGTTGGCCGGG + Intergenic
914754500 1:150554981-150555003 AAAAAAAAAAAAAGGTGGTCAGG - Intronic
914782844 1:150801412-150801434 AAAAAAGAAGAGATGTGGCCAGG - Intronic
914903442 1:151725093-151725115 AAAAAAAAGGCGAGGTGCGGTGG - Intronic
915075829 1:153307493-153307515 AAAGACAAGGAGAGATTGTCTGG - Intronic
915157662 1:153891588-153891610 AAAAAAAAAAAGAGGTGGGGGGG + Intronic
915170577 1:153974400-153974422 AAAACAAGGGAGAAGTGGTGGGG + Exonic
915175519 1:154011515-154011537 AAAAAAAAATAGAGATGGCCAGG - Intronic
915207178 1:154278785-154278807 AAAAAAAAAGAGTGGTGGCCGGG + Intergenic
915356649 1:155259152-155259174 AAAAAAAAGCTGAGGTGGGAGGG - Intronic
915432876 1:155880192-155880214 AAAAAAAAAGAGAAATAGTCAGG + Intronic
915578794 1:156800749-156800771 AAAAAAAAAAAGTGGTGGTGGGG - Exonic
916038732 1:160944145-160944167 ACTAAAAAGGAGAGATGGCCAGG - Intergenic
916043601 1:160981956-160981978 AAAAAAAAAGAAATGGGGTCGGG + Intergenic
916337251 1:163686838-163686860 AAAAAATATGAGAGGTGGTATGG + Intergenic
916412272 1:164558656-164558678 AAAGAAAAGCAGGGGTGGGCGGG + Intronic
916710395 1:167400290-167400312 AAAAAATAAGATAGGTGGGCTGG - Intronic
916871701 1:168921713-168921735 AGAAAAATGGAGAAGTGGTGAGG - Intergenic
917345812 1:174027109-174027131 AAAAAAAATCAGAGGAGGCCAGG - Intergenic
917493847 1:175522108-175522130 AAAAAAAAGGAGAAGTGGAGTGG - Intronic
917496901 1:175548670-175548692 AAAAAAAAGGCGGGATGGGCAGG + Intronic
917769588 1:178262781-178262803 AAAAAAAATGAGTGGGGGGCAGG - Intronic
917951388 1:180040458-180040480 AAAAAAAAATAGAGGTGGGGGGG + Intronic
918228224 1:182506970-182506992 AAAAAAAAAGAAAGGTGAGCAGG - Intronic
918939684 1:190976005-190976027 AAAAAAAAGGAGAAGTGAAGAGG + Intergenic
919188028 1:194179991-194180013 AAAAAAAAAAACAGGTTGTCTGG + Intergenic
919318791 1:196007346-196007368 AAAAAAAAAAAAAGGTAGTCTGG + Intergenic
919407846 1:197207265-197207287 AAAAAAAAGGCAAGGTATTCAGG - Intergenic
919435533 1:197554843-197554865 AAAAAAAAAAAGAGGGGGTGGGG + Intronic
919659304 1:200228317-200228339 AAAAAAAAAAAAACGTGGTCAGG + Intergenic
919776148 1:201195135-201195157 AAAAAAAAGAAGAGATTTTCTGG - Intronic
919831209 1:201541355-201541377 AAAAAGAAGTAGAGGGGGTCTGG - Intergenic
919870281 1:201815377-201815399 TAAAAAAAGGTGGGGTGGTTGGG + Intronic
920092197 1:203462775-203462797 AAAAAAAAGTGGAGTTGGCCGGG + Intergenic
920092469 1:203464348-203464370 GAAAAAAAGGGGAGGTGGGGAGG - Intergenic
920329673 1:205197144-205197166 AAAAAAAAGGAGACATTGTTGGG + Intronic
920668699 1:207986345-207986367 AAAATAAAGGGGAGATTGTCTGG + Intergenic
920808873 1:209263239-209263261 AAAAAAAAAGAGAGAAGGACTGG - Intergenic
920987372 1:210903100-210903122 AAAAAAAAAGAGAGATGGCAGGG - Intronic
921328664 1:214013766-214013788 CAGATAAAGGAGAGGTGGCCTGG - Intronic
921329357 1:214020013-214020035 AAAAAGTAGGAAAGGTGGTCAGG - Intronic
921528671 1:216251734-216251756 AATAAAATAGAGAGGTGGGCTGG - Intronic
921677614 1:217993716-217993738 AAAAAAAAGAGGAGGAGGTGGGG + Intergenic
921883275 1:220277458-220277480 AAAAAAATAGACAGTTGGTCAGG - Intergenic
922290042 1:224202386-224202408 AAAAAAAAAGAGACTGGGTCCGG + Intergenic
922332418 1:224588957-224588979 AAAAAAAAAAACAGGGGGTCAGG - Intronic
922424368 1:225479923-225479945 AAAAAAAAAAAGAAGTGGCCAGG + Intergenic
922565665 1:226600145-226600167 AAAAAAAAGGCTAGGTGCTGTGG + Intronic
922778450 1:228229236-228229258 AAAAACAAGAAGAGTTGGTGAGG - Intronic
922820952 1:228485234-228485256 AAAAAAAAGGAAACTTGGCCGGG - Intergenic
922849742 1:228722619-228722641 AAAAAAAAAAAAAGGAGGTCAGG - Intergenic
923084952 1:230696111-230696133 CAAAGAAAGGAGAGATGTTCTGG - Intergenic
923202771 1:231727952-231727974 AAAAAAAAGGAGGGGTAGGGGGG + Intronic
923533998 1:234834469-234834491 AAAAAAAAAGAGACCTGGTTTGG - Intergenic
923592959 1:235336391-235336413 AAAAAAAAGAAGAACTTGTCTGG + Intronic
923649404 1:235859488-235859510 AAAAAAAAGGCCTGGTGCTCAGG - Intronic
923781553 1:237029978-237030000 AAAAAAAAGAGACGGTGGTCAGG + Intergenic
923826483 1:237506148-237506170 AAAAAAAAGGAGTGTTGGTGGGG - Intronic
924306808 1:242698061-242698083 ACAGAAAAGGAGAGATGGGCGGG + Intergenic
924704935 1:246493161-246493183 AAAAAAAGGAGGAGGTGGCCAGG + Intronic
924735504 1:246752073-246752095 AAAAAAAAGGAGAATTAGCCGGG - Intronic
1063214353 10:3910456-3910478 AAAAAAAAAGTGACGTGGTGTGG + Intergenic
1063399603 10:5729807-5729829 AAAAAAAAAGAGAAAAGGTCTGG - Intronic
1063440222 10:6067002-6067024 AAAAAAGGGGAGAGGTGGTGAGG + Intergenic
1063485829 10:6419983-6420005 AAAAAAAAGGAGATTTCGGCTGG - Intergenic
1064097564 10:12435239-12435261 AAAAAAAAGAAAAGGTGATGGGG + Intronic
1064322043 10:14314473-14314495 AAAAATAAGGGGAAGTGTTCTGG + Intronic
1064449791 10:15431525-15431547 AAAAAAAAAGAGAGATGGGGAGG - Intergenic
1064548416 10:16474590-16474612 AAAAAAAAAGAAATTTGGTCAGG + Intronic
1064662408 10:17618753-17618775 AAAAAAAAGGAAAGGAAGGCTGG + Intergenic
1064698030 10:17987876-17987898 AAAACAAAGGAAAGGTGGCAGGG + Intronic
1064800453 10:19064785-19064807 AAAAAAATTGAGAGGTGAGCTGG + Intronic
1065062933 10:21926246-21926268 AAAAAAAAGGAAAGGCTGGCTGG - Intronic
1065429273 10:25637196-25637218 AAAAAAAAGCAGGGGTGCTCTGG + Intergenic
1065627751 10:27649081-27649103 AAAAAAAAAGCGAGGTGGGGTGG - Intergenic
1065743737 10:28819688-28819710 AAAAAAAAGGAGGCGGGGACAGG + Intergenic
1065767838 10:29048161-29048183 AAAACAAAGGAGGGGGGTTCTGG - Intergenic
1065772282 10:29088609-29088631 AAAAAAAATGAAAGGAGGCCGGG - Intergenic
1065773051 10:29095383-29095405 AAAAAAAAAGAATGGTGGTGTGG - Intergenic
1065940672 10:30561780-30561802 AAAAAAAAGGGGGGGGGGTGGGG - Intergenic
1066128462 10:32365844-32365866 AAAAAAAAGGACAGGTGCAATGG + Intronic
1066577345 10:36840810-36840832 AAGAAAAAGAAGGGCTGGTCCGG + Intergenic
1066789951 10:39051208-39051230 AAAAGAAAGGAGAGATGTTGAGG + Intergenic
1067116758 10:43441260-43441282 AAAAAAAAGGCAAAGCGGTCTGG - Intronic
1067151654 10:43740060-43740082 AACAAAAAAGAGATGAGGTCAGG - Intergenic
1067220397 10:44339970-44339992 AAAATGAAGGAGATGTGGACTGG - Intergenic
1067270798 10:44789830-44789852 AAAAAAAAGATGAGGTCGTTGGG - Intergenic
1067479644 10:46586548-46586570 AAAAAAAAAAAGAGGTTGGCTGG + Intronic
1067615092 10:47755249-47755271 AAAAAAAAAAAGAGGTTGGCTGG - Intergenic
1067727122 10:48778778-48778800 ACAACCAAGGAGAGGTCGTCTGG - Exonic
1068055991 10:52013424-52013446 AAAAAAAAAGAAAGATGGTTGGG + Intronic
1068466278 10:57396977-57396999 AATAGAAAGGAAAGGTGGACAGG + Intergenic
1068579902 10:58727593-58727615 AAAAAAAAGGTGGGGTGGGGTGG + Intronic
1068829131 10:61472938-61472960 AAAAAAAAGAAGAGGAGTTAGGG + Intergenic
1068883148 10:62071560-62071582 AAAAAAAAAGAGAGAAGGTTTGG + Intronic
1069024500 10:63524425-63524447 AAAAAAAAAGAGTGGTGTCCAGG - Intronic
1069124800 10:64617262-64617284 AACATAAGGGAGAGGTGATCGGG - Intergenic
1069376089 10:67794562-67794584 AAAAAAAAAAACAGGTGGCCGGG + Intergenic
1069656711 10:70095071-70095093 GAAAGAAAGGAGAGGGGGCCAGG + Intronic
1069831141 10:71283122-71283144 AAAAAAAAAGAGAGGAGTTGTGG + Intronic
1069926431 10:71853743-71853765 AAAAAAAAGGAGGGGTGTGGTGG - Intergenic
1070000016 10:72369311-72369333 AAAAAAAAAAAGAGGTGGGCAGG + Intronic
1070060035 10:72973057-72973079 AAAAAAAAGGAGAGCAGGCTGGG - Intergenic
1070300363 10:75199252-75199274 AAAAAAAAAGAAAGGAGGGCAGG + Intergenic
1070735776 10:78862699-78862721 ATAAAAAAGGAGACATGGACTGG + Intergenic
1070871598 10:79758726-79758748 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071152722 10:82653653-82653675 AAAAAAAAACAAAGGTGGTGGGG + Intronic
1071310396 10:84337984-84338006 AAACAAAAGGAGAGGGGGCTGGG + Intronic
1071469457 10:85972145-85972167 AAAAAAAAAGAAAAATGGTCAGG - Intronic
1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG + Intronic
1071591120 10:86874398-86874420 AAAAAAGAGGAGAGGAGGGGAGG - Intronic
1071630493 10:87215209-87215231 AAAAAAAAAAAGAGGTTGGCTGG - Intergenic
1071638519 10:87280889-87280911 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071656723 10:87457063-87457085 GAGAAAAAGGAAAGGTGGTAAGG - Intergenic
1071857119 10:89636854-89636876 AAAAAAAAAGAGGGGTGCTCTGG - Intronic
1072112530 10:92336819-92336841 AAGAAAAACGAGAGATGTTCTGG + Intronic
1072129776 10:92483074-92483096 AAAGAAAAGGAGAGGTTGGCCGG - Intronic
1072145653 10:92634277-92634299 AAAGAAAAGGAGAGGCTGGCTGG - Intronic
1072161421 10:92770844-92770866 TAAAAAAGGGAGATGGGGTCAGG + Intergenic
1072421573 10:95294278-95294300 AAAAAAAAGGATAAATGATCAGG - Intergenic
1072650123 10:97288795-97288817 AAAAAAAAGGAGAGAAGTTTGGG - Intronic
1072653543 10:97314120-97314142 TAAAAAAAGAAAAGGGGGTCTGG - Intergenic
1072812426 10:98473187-98473209 AAGAAAATTGAAAGGTGGTCAGG + Intronic
1072847965 10:98853507-98853529 AAAAGAAAGGGGAGGTGATAAGG - Intronic
1072940452 10:99759205-99759227 AGGAAAAAGTATAGGTGGTCTGG + Intergenic
1072976061 10:100059599-100059621 AAAAAAAAAAAGAGTTGGTGAGG + Intronic
1072983745 10:100121764-100121786 AAAAAAAAGGAGAATTTGTCAGG + Intergenic
1073134712 10:101214119-101214141 AAAAAAAAGGGGGGGTTCTCTGG - Intergenic
1073188878 10:101635849-101635871 AAAAAAAAAGAGAGATGGAGGGG + Intronic
1073261548 10:102194477-102194499 AAAAAAATGGAAAGGTGGCTGGG - Intergenic
1073405249 10:103291880-103291902 AAAAAAAAAGGGAGGTGGGGTGG + Intergenic
1073434284 10:103506855-103506877 AAAAGAAAGCAGAAGTGGGCCGG - Intronic
1073560064 10:104488881-104488903 AAAAAAAAGGAGCACTGGACTGG - Intergenic
1073765191 10:106674350-106674372 AAAAAAAAGTAGTAGTGGTAGGG + Intronic
1074192059 10:111146651-111146673 AAAGAAAATGAAAGTTGGTCTGG - Intergenic
1074211967 10:111343486-111343508 AAACACAAGGAGAGGGAGTCTGG - Intergenic
1074340347 10:112622463-112622485 AAAAAAAAGAAGAGGTGTAATGG + Intronic
1074396454 10:113101849-113101871 AAAAAAAAAGAGAGGTGTGGTGG + Intronic
1074764499 10:116690788-116690810 AAAAAAAAAGAGAGGTGCAGTGG - Intronic
1074863196 10:117528729-117528751 AAAAAAAATGAGAGGAGGCCGGG - Intergenic
1075386807 10:122061012-122061034 AAAAAAAAGGGGGGGGGGCCAGG + Intronic
1075493318 10:122893804-122893826 AAAAAAAAGGAGTGGGGGGGTGG + Intergenic
1075495192 10:122913952-122913974 AAAAAAAGGCAAAGGTGATCAGG - Intergenic
1075568287 10:123520410-123520432 AAAAAAAAGGGGGGGGGGGCAGG - Intergenic
1076266407 10:129112722-129112744 AAAAAACAGGAGAGAAGGGCTGG + Intergenic
1076339123 10:129730698-129730720 AAAAAAAATCAGAGGAGGGCAGG - Intronic
1076901584 10:133341409-133341431 AAAAAAATCAAGAGGTGGTGAGG - Intronic
1077313633 11:1905420-1905442 AAAAAAAAAGAGAGAAGGCCGGG - Intergenic
1077547742 11:3183004-3183026 AAAAAAAAAAAGAGGGAGTCTGG - Intergenic
1077585848 11:3452346-3452368 AATGAAAAGGAGTGGAGGTCTGG + Intergenic
1077739665 11:4831490-4831512 AATAAAAAGCAGATGTGGTAGGG - Intronic
1077928824 11:6709294-6709316 AAAAAAAGGGGGGGGTGGTCAGG - Intergenic
1078220285 11:9346106-9346128 AAAAAAAAAAAGAGATGGCCAGG - Intergenic
1078471797 11:11593564-11593586 AAAAAAAATTAGATGTGGTCTGG - Intronic
1078500208 11:11866296-11866318 ATAACAAAGGGGTGGTGGTCAGG + Intronic
1078902208 11:15651941-15651963 AAAGAGAAAGAGAGGAGGTCCGG + Intergenic
1078986498 11:16604293-16604315 ATAAAAAAGGTCAAGTGGTCAGG - Intronic
1079006307 11:16793704-16793726 AAGAAATAGGAGATGTGGTCAGG - Intronic
1079059386 11:17234699-17234721 AAAAAAAAAAAGAGTTGGCCGGG - Intronic
1079066001 11:17293262-17293284 AAAAAAAAAAAGATGTTGTCAGG + Intronic
1079191224 11:18278256-18278278 AAAAAAAAAGAGAGATTGTCAGG - Intergenic
1079231908 11:18656319-18656341 AAAAAAAAAAAAAGGTGGTGGGG - Intergenic
1079399610 11:20095676-20095698 AATAAGAAAGAGATGTGGTCTGG - Exonic
1079676348 11:23231623-23231645 AGAAAAAAGGAGGGGAAGTCAGG + Intergenic
1079899871 11:26168927-26168949 AAAAAAAAGAAAAGGTGGGGGGG + Intergenic
1080436336 11:32248343-32248365 AAAAAAATGTAGATGTGGGCCGG - Intergenic
1080527763 11:33144117-33144139 AAAAAAAAGGGGGAGTGGTGGGG - Intronic
1080607196 11:33873056-33873078 AAAAACAAGCAGATGTGGCCAGG - Intronic
1082048936 11:47754216-47754238 AAAAAAAAGGAGAGACAGCCAGG + Intronic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1082929937 11:58592068-58592090 AAAAAAAAAAAGATGTGCTCAGG - Intronic
1083116816 11:60468296-60468318 AAATAAAAGAAGAAGTGGTTGGG + Exonic
1083247635 11:61441872-61441894 AAAAAAAGGGAGGAGTGGTGGGG - Intronic
1083381423 11:62272260-62272282 AAAAAAAAACAGTGGTTGTCAGG + Intronic
1083388360 11:62329553-62329575 AAAAATGAGGAGAGGTCTTCAGG + Intergenic
1083464007 11:62833315-62833337 AAAAAAAAAGAAAAGTAGTCAGG + Intronic
1083586527 11:63863767-63863789 AAAAAAAAGTGGTGGTGGTGTGG - Intronic
1083763065 11:64829246-64829268 AAACAAAAGGAGAGCGGCTCAGG + Intronic
1083909280 11:65696581-65696603 AAAAAAAAGGAGACGGGGGATGG + Intergenic
1083985127 11:66209398-66209420 AAAAAAAAGGAACAGTGGGCAGG + Intronic
1084040253 11:66538544-66538566 AGAAAAAAGAAAATGTGGTCAGG + Intronic
1084050199 11:66594376-66594398 AAATAAAAGGCCAGCTGGTCTGG + Intronic
1084969069 11:72759845-72759867 AAATAAGAGGACAGGTGGTATGG - Intronic
1085098035 11:73776658-73776680 AAAAAAAAAGAGAGGATGTCTGG - Intergenic
1085118157 11:73948706-73948728 AAAAAAAAAAAGAGTTGGTAAGG + Intergenic
1085503450 11:77041966-77041988 AAAAAAAAGGAGAGTTTGCAAGG + Exonic
1086072911 11:82819145-82819167 AAAAAAAAAGGGATGTGGTGGGG - Intergenic
1086446625 11:86877859-86877881 AAAAAAAAAAAGAGGTGGGGTGG + Intronic
1087176641 11:95102374-95102396 AAAAAAAAAAAAAGGTGGGCAGG + Intronic
1087356857 11:97104602-97104624 ACAATAAAGGAGAGGTGGCATGG - Intergenic
1087373401 11:97314167-97314189 AAAATGAAGGAGAGGAGGGCAGG + Intergenic
1087654382 11:100904640-100904662 AAAAAAAAGGTGGGGAGGTCAGG - Intronic
1088106308 11:106210480-106210502 AAAAAAAAGCAAAGAAGGTCAGG - Intergenic
1088266264 11:107990934-107990956 AAAAAAAAGAAGAAGAGGTTGGG - Intergenic
1088297927 11:108321250-108321272 AAAATAAAGAAGAGGTTTTCAGG - Intronic
1088348415 11:108856918-108856940 AAAATAAAGTTGAGCTGGTCTGG - Intronic
1088515954 11:110634068-110634090 AAGAAAAAGTAGTGGTGGTCAGG + Intronic
1088593999 11:111426278-111426300 AAAAAAATGGAAAGGAGGACTGG + Intronic
1088636159 11:111822422-111822444 AAAAAAAAGGCCAGGTGCTGTGG + Intronic
1089012196 11:115140391-115140413 AAAAAAGAGGAAGGGTGGGCTGG - Intergenic
1089096247 11:115922415-115922437 ATAAAAATGGAGAGGAAGTCAGG - Intergenic
1089212010 11:116810765-116810787 AAAAAAAAAGAGACGGGATCGGG + Intergenic
1089392625 11:118112365-118112387 AAAAAAAAGTGAAGGGGGTCTGG - Intronic
1089419489 11:118320403-118320425 GAAATAAGGGAGAGGTGGTAAGG - Intergenic
1089740744 11:120580560-120580582 AAAAAAAAAGAAAGGAGGCCAGG - Intronic
1089789006 11:120929124-120929146 GAAAGAAGGGAGAGGTGGTGGGG + Intronic
1089792511 11:120954987-120955009 AAATAAAAGTAGAGCTGGTCTGG - Intronic
1089841555 11:121423166-121423188 AAAAGAAAGGAAATCTGGTCAGG - Intergenic
1090010738 11:123043762-123043784 AAAAAAAAGAAAAGAGGGTCGGG + Intergenic
1090488087 11:127132631-127132653 AAAAAAAAAGATTTGTGGTCAGG + Intergenic
1090584460 11:128195457-128195479 AAAAAAAAACTGAGGTGGTGAGG + Intergenic
1090737068 11:129619222-129619244 TGAAAAAAGGAGGGGTGTTCTGG - Intergenic
1090890608 11:130919410-130919432 AAAAAAAAAGAGAGAAGGTGGGG + Intergenic
1091101427 11:132877333-132877355 AAAGAAAAGGTGAGGTCTTCAGG + Intronic
1091755050 12:3045847-3045869 AACAGCAGGGAGAGGTGGTCAGG + Intergenic
1091970212 12:4780374-4780396 AAAGAGAGGGAGAGGTGGTGGGG + Intronic
1091974405 12:4812960-4812982 AAACAAAAGGGGAGGTGGGCAGG - Exonic
1092199656 12:6572433-6572455 AAAAAAAAAAAGAGGTGGCCAGG + Intronic
1092209726 12:6638485-6638507 CAAAAGAACGAGAGGTGGGCAGG + Intronic
1092380208 12:7989921-7989943 AAAAGAATGCAGAGGTAGTCTGG - Intergenic
1092659352 12:10722493-10722515 AGAAGAAAGGAGAGGCAGTCTGG - Intronic
1092747988 12:11691376-11691398 AAAAGAAGGGAGAGGAGGTGTGG - Intronic
1092871247 12:12807659-12807681 AAAAAAAAGGAGGGGGGGCCAGG + Intronic
1092873296 12:12826437-12826459 AAAAAAAAGGAAAGGAGGGAGGG - Intronic
1093467714 12:19467200-19467222 AAAAAAAAGGTGTATTGGTCTGG - Intronic
1094157339 12:27350980-27351002 AAAAAAAAGGGGGGGTGGGTGGG - Intronic
1094349093 12:29503534-29503556 AAAAAAAAGGAGAGGTTAGATGG + Intronic
1094365001 12:29670945-29670967 AAAAAAAAGGATAGGAATTCAGG + Intronic
1094552809 12:31469038-31469060 AGAAAAAAATAGAGGTGGCCAGG + Intronic
1094799244 12:34012047-34012069 AGAAAAAAGGAGATGTGGGTAGG - Intergenic
1094821788 12:34231804-34231826 AAAAAAAAGTAGGGGGGGTGGGG + Intergenic
1094865891 12:34529668-34529690 AAAGAAAAGGAGAGATGTTGTGG + Intergenic
1095269501 12:40200362-40200384 AAAAAAAAAGAGAGAGGGTTAGG + Intronic
1095556103 12:43506771-43506793 AAAAAAAAAAAAAGGTGGCCAGG - Intronic
1096122999 12:49100721-49100743 AAAAAAAAAAAGAAGTGGGCTGG - Intronic
1096282390 12:50267513-50267535 AAAAAAAAGTAAATGTGGCCAGG - Intronic
1096296171 12:50386131-50386153 AAAAGAAATGTGAGGTGGCCAGG + Intronic
1096509247 12:52118446-52118468 TAAAAAAAGAAGAGGTGGGTAGG + Intergenic
1096733246 12:53631782-53631804 AAAAAATAGAAGAGGAGGTTGGG - Intergenic
1096859579 12:54515423-54515445 AGAAAAAAAGAGATGTGGTTAGG + Intronic
1096998437 12:55855432-55855454 AAAAAAAAGGAGACAGGGTCAGG - Intergenic
1097031716 12:56094568-56094590 GATAATAAGGAGAGGGGGTCAGG + Intronic
1097039777 12:56148889-56148911 AAAAAAAAAGAAAGGTGGAATGG - Intergenic
1097207514 12:57335483-57335505 AAAAAAAAAAAAAGGTGGCCGGG - Intronic
1097285913 12:57877149-57877171 AAAAAAAATTAGAGGTGATGTGG + Intergenic
1097502953 12:60429138-60429160 AAAGAGAAGGAGAGTAGGTCTGG - Intergenic
1097546952 12:61015212-61015234 AAAAAGAAAGAGAGGAGGACAGG + Intergenic
1097734800 12:63170133-63170155 AAAAGAAAGAAGAGCTGTTCTGG - Intergenic
1097923652 12:65104721-65104743 AACAAGAAGAAGAGGTGGTGGGG - Intronic
1098213489 12:68191351-68191373 AAAAAAAAAAAGGGCTGGTCAGG - Intergenic
1098390199 12:69961706-69961728 AAAAACAAGGAAAGTTGGGCTGG + Intergenic
1098432115 12:70431065-70431087 AAAAAAAAGGTGAGGACATCTGG + Exonic
1098503253 12:71219227-71219249 AAATAAAAGGAGAGATGTTAGGG - Intronic
1098893673 12:76033444-76033466 AAAAAAAATGAGATGTAATCTGG + Exonic
1098974742 12:76890762-76890784 AAAAAAAAGAGGAGGAGGTGGGG - Intergenic
1099020668 12:77400382-77400404 AATAAAAAGGAAAAATGGTCAGG - Intergenic
1099473411 12:83077867-83077889 AAAAAAAAAGACAGATTGTCTGG - Intronic
1100208622 12:92378224-92378246 AAGAGAAAGGAAAGGAGGTCTGG + Intergenic
1100237085 12:92672060-92672082 AAAAAAAAGAGGAGGTGGCCGGG - Intergenic
1100321044 12:93493239-93493261 AGAGAAAAAGAGAGGGGGTCGGG - Intronic
1100321630 12:93498759-93498781 AGAGAAAAAGAGAGGGGGTCGGG + Intronic
1100353382 12:93806156-93806178 AAAAAACAAGAGAGGTGGCCGGG + Intronic
1100395669 12:94184419-94184441 AAAAAAAATGAGAGAGGGCCAGG - Intronic
1100401220 12:94231825-94231847 AAATGGAAGGAGAAGTGGTCAGG - Intronic
1100439184 12:94600024-94600046 TAAAAAAAGGAGTGGTGGTGGGG + Intronic
1100512130 12:95285971-95285993 AAAAAAAAAAAGAAGGGGTCGGG - Intronic
1100523551 12:95399353-95399375 TCAGAAAAGGAGATGTGGTCGGG + Intergenic
1100646932 12:96541579-96541601 AAAAGAGAGGAGAGGTGGTTGGG - Intronic
1100801530 12:98236184-98236206 AAAAAAAAAAAAAGGTGGTGGGG + Intergenic
1101013723 12:100477516-100477538 AAAGAAAAGGAGAAATGGTATGG + Intronic
1101170104 12:102083021-102083043 AAAAGAAAGGAGATGGGGTAAGG + Intronic
1101289501 12:103353290-103353312 AAAAAAAAAAAGAGGGGGTGGGG + Intronic
1101319805 12:103663642-103663664 TAAAAAGAGGAGAGGTGGGTAGG - Intronic
1101399213 12:104373410-104373432 AAAAAAAAAAAGAGGTAGGCTGG - Intergenic
1101590586 12:106121754-106121776 AAAAAAAAGGTGGGGGGGTGTGG + Intronic
1102024924 12:109709083-109709105 AAAACAAAAGGGAGGTGTTCTGG + Intergenic
1102104279 12:110307213-110307235 AAAAAAAAAAAAAGGTGGTGGGG - Intronic
1102114909 12:110395583-110395605 AAAAAAAAGAAGATGAGGCCAGG - Intronic
1102188103 12:110965401-110965423 AAAAAAAAGGGGGGGGGGTGTGG - Intergenic
1102336263 12:112083118-112083140 AAAGAAAAGGTGAGGTGATGAGG + Intronic
1102346629 12:112164916-112164938 AAAAAAAAGAAAAAGCGGTCTGG - Intronic
1102843176 12:116148064-116148086 AAAAAAAAAAAGAGGGGGGCGGG + Intronic
1103100342 12:118169312-118169334 AAAAAAAAGGGGGGGGGGTGGGG - Intronic
1103226872 12:119295342-119295364 AGGAAAAAGGAGAGGTGAGCGGG + Intergenic
1103274022 12:119696815-119696837 AAAAAGGAGGGGAGGTGGTGCGG - Intronic
1103292508 12:119858523-119858545 AAAAAAAAGGCGTGGGGGCCAGG + Intronic
1103465605 12:121139724-121139746 AAAAAAAAAAAAAGATGGTCAGG - Intronic
1103559850 12:121787902-121787924 AAAAAAAAGGGGGGGGGGGCGGG + Intronic
1103829059 12:123763858-123763880 AAAAAAAAAAAGAAGTGGCCAGG - Intronic
1104299648 12:127552635-127552657 AAAAAAAAAGCAAAGTGGTCAGG - Intergenic
1104352559 12:128057538-128057560 AGAAAGAAAGAGAGATGGTCTGG - Intergenic
1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG + Intronic
1105059458 12:133135250-133135272 ACAAAAGATGAGAGGTAGTCTGG - Intronic
1105208283 13:18241587-18241609 AAAGAAAAGGCCAGGTGTTCTGG + Intergenic
1105421498 13:20256282-20256304 AAAAAAATGGATATGAGGTCTGG - Intergenic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1105774800 13:23647961-23647983 AAAAAAAAGGGGGGGTGGTGTGG - Intronic
1105788215 13:23770418-23770440 TAAAAAAAGGGGAGGGGGTCAGG + Intronic
1105845866 13:24293015-24293037 AAAAAAAAGGCGAGGGTGTGGGG + Intronic
1106046554 13:26147303-26147325 AAAAACAAAGAGAGGTGATGGGG + Intronic
1106238187 13:27883706-27883728 AAAAAGAAGGAGAGGAGTTGGGG + Intergenic
1106347602 13:28894261-28894283 AAGAAGAAGGAGAGTTGGTGGGG + Intronic
1106373270 13:29158345-29158367 AAAAAAAAAGCGGGGTGGACGGG - Intronic
1106381756 13:29246159-29246181 AAAAAATAGCAAAGGTGGTATGG + Intronic
1106436863 13:29730920-29730942 AGAGAAATGGAGAGGTGGTCAGG + Intergenic
1107152990 13:37133439-37133461 AAAATAAAGGAGAGCAGGGCGGG - Intergenic
1107283806 13:38766545-38766567 AAATAAAAGCAGAGGTTGTATGG - Intronic
1107402046 13:40078549-40078571 AAAGAAAAGGAGGGTTGGTACGG + Intergenic
1107410097 13:40150561-40150583 AAAAAAAGAGAGGGGAGGTCAGG - Intergenic
1107614331 13:42148930-42148952 AAAAAAAAGAAGGGGCGGGCGGG - Intronic
1107798417 13:44079449-44079471 AAAGAAAAGGAGAGCAGGTAAGG + Intergenic
1107828902 13:44356790-44356812 AAAAAAAAGGGCAGGGGGTGGGG + Intergenic
1107852617 13:44586475-44586497 AAAAATAAGTAGAGGGGGCCAGG + Intergenic
1107908251 13:45081992-45082014 AAAAAAAAGGAGAGACAGCCGGG + Intergenic
1108217165 13:48196618-48196640 AAAAAAAATCAGTGGTGGCCAGG - Intergenic
1108340011 13:49489904-49489926 AAAAAAAAGGGGGGGGGGGCGGG - Intronic
1108617567 13:52149193-52149215 AAAAAAAAGAAAAGGTGGGCTGG - Intronic
1109021621 13:57102311-57102333 AACAAAAAGGAGCTGTGGTAAGG + Intergenic
1109226572 13:59703492-59703514 AGAAAACAGGAGAGGTGAACAGG - Intronic
1109373055 13:61449432-61449454 AAAAAAAAGGATGGATAGTCAGG + Intergenic
1109574546 13:64236290-64236312 AAACAAAAGGAGAGCTACTCCGG - Intergenic
1109898961 13:68737480-68737502 AAAATAAAGGAGAAGTGATATGG - Intergenic
1110335302 13:74323289-74323311 AAAAAGAAGGAGAGAGGGTGGGG - Intergenic
1110665148 13:78108113-78108135 AGAATCAAAGAGAGGTGGTCTGG - Intergenic
1111250018 13:85590099-85590121 AAAAAAGAGGACAGGTCGGCCGG - Intergenic
1112220051 13:97479429-97479451 AAACAAAAGGAGAGGTGGGCAGG + Intergenic
1112456702 13:99569640-99569662 AAAAAAAAGCAGGGTTGGTGGGG + Intergenic
1112784032 13:102931913-102931935 AAAAAAAAGAAAATGTAGTCAGG - Intergenic
1112800355 13:103103319-103103341 AAAAAAAAGGAAATCTGGGCCGG + Intergenic
1113192483 13:107765658-107765680 AATAAAAAGGATGGGTGGGCAGG - Intronic
1113225930 13:108159520-108159542 AAAAAAGAGGAGATGAGGCCGGG + Intergenic
1113647861 13:112011640-112011662 AAAAAGAAGGAGAAGAGGCCGGG - Intergenic
1113955751 13:114099198-114099220 TGAGAAAAGGAGGGGTGGTCTGG - Intronic
1114424431 14:22610501-22610523 AGAAAAAAGGGGAGGAGGTGTGG - Intronic
1114593804 14:23893902-23893924 AAAAAAAAAATGAGGTGATCTGG + Intergenic
1114648394 14:24268329-24268351 CAAAACAAGGAGAGGGGCTCTGG - Intronic
1115213600 14:30992581-30992603 AAAAAAAAAAAGATGGGGTCGGG + Intronic
1115226681 14:31110296-31110318 AAAAAAAAGAAAATGTGGCCGGG - Intronic
1115425082 14:33249336-33249358 AAAAAAAAGGTGGGGGGGACGGG - Intronic
1115445188 14:33481793-33481815 AAAAAAAATAGGAGGTGGTTTGG + Intronic
1115564222 14:34611486-34611508 AAAAAAAAGGGGGGGAGGCCGGG + Intronic
1115772300 14:36677172-36677194 AAAAAAATAGAGAGGGGGTGGGG - Exonic
1115839367 14:37450106-37450128 AAAAAAAAAGAAAGGTGGCCAGG - Intronic
1116037236 14:39642006-39642028 AAAAAAAAGGGGGGGTGGGGTGG - Intergenic
1116555686 14:46303162-46303184 ACAAAAAAGGAGAGGAAATCAGG - Intergenic
1116716775 14:48437594-48437616 AAAAAAAAAGAGTTGTGATCAGG - Intergenic
1116977646 14:51133498-51133520 AAAAAAAAGCAGGGGTGGCCAGG + Intergenic
1117211832 14:53508908-53508930 AAAAAATATGAGAGTGGGTCAGG - Intergenic
1117383892 14:55192264-55192286 AAAAAAAAGGGGAGGGGGGCTGG - Intergenic
1118192193 14:63590944-63590966 AAAAAAATGGAGAGCTGGGTGGG + Intergenic
1118291205 14:64526111-64526133 AAAAAAAAATTGAGGTGGCCGGG - Intronic
1118338454 14:64875189-64875211 GAGAAAAATGAAAGGTGGTCTGG + Intronic
1118537561 14:66785069-66785091 AAAAAAAAGCAGGAGTGGGCTGG + Intronic
1118564940 14:67129107-67129129 AAAAAAAAGTAGAAGTGGCTGGG - Intronic
1118650903 14:67893320-67893342 TAAAAAAAGAAAAGGAGGTCAGG + Intronic
1118733117 14:68683329-68683351 TAAAAAGAGGAGGGGTGGTCGGG + Intronic
1119135299 14:72212943-72212965 TTAAAAAGGGATAGGTGGTCAGG - Intronic
1119153480 14:72387252-72387274 AAAAAAAGGGAGAGGGGGCTGGG + Intronic
1119446125 14:74664752-74664774 AGAAAAAAGTAGAGGAGGCCGGG - Intronic
1119458691 14:74779794-74779816 AAAAAAAAGGAGGGGAGGGGAGG - Intronic
1119892736 14:78195059-78195081 AAAAAAAAGGGTGGGGGGTCGGG - Intergenic
1120047374 14:79823159-79823181 AAAAAAGAGGAGAGGGGATGAGG - Intronic
1120410664 14:84150910-84150932 AAAAAAAGGGAGAGGAGGGGAGG + Intergenic
1121039768 14:90736282-90736304 TAAAAAAAGGGGAGGAGGTCGGG + Intronic
1121039817 14:90736574-90736596 AAAAAAAAGGGGGGGTGGGTAGG + Intronic
1121058395 14:90880092-90880114 AAAAATTAGGAGTGGTGGCCAGG - Intronic
1121156726 14:91692189-91692211 AAAAAAAAGAAGAAGTGTGCTGG + Intronic
1121543634 14:94747402-94747424 AAAAAAAAGGGGGGGGGGCCAGG + Intergenic
1121769336 14:96518759-96518781 AAAAAAAAGTAGCTGTGGTTGGG + Intronic
1122003744 14:98685276-98685298 AAAATAAAGGAAGGGTGTTCAGG - Intergenic
1122103797 14:99435730-99435752 AAAAAAAAGGTGGGGGGGTGGGG - Intronic
1123461193 15:20473292-20473314 AATAAAAAACAGAGGTTGTCAGG + Intergenic
1123462242 15:20483743-20483765 AAGAAAAATGACACGTGGTCGGG + Intergenic
1123470918 15:20551405-20551427 AAAAAAAAAAAGAGCTGGGCAGG - Intergenic
1123655817 15:22516628-22516650 AAGAAAAATGACACGTGGTCAGG - Intergenic
1123656866 15:22527089-22527111 AATAAAAAACAGAGGTTGTCAGG - Intergenic
1124082469 15:26514485-26514507 AAAAAAAAGGGGGGGGGGTGGGG + Intergenic
1124272929 15:28299754-28299776 AAGAAAAATGACACGTGGTCGGG + Intronic
1124310779 15:28622265-28622287 AATAAAAAACAGAGGTTGTCAGG - Intergenic
1124563783 15:30797484-30797506 AAATAAAAGGAGAGAGGGCCCGG + Intergenic
1125016641 15:34944391-34944413 AAAAAGAATGGGAAGTGGTCTGG + Exonic
1125323801 15:38515774-38515796 AAAAAAAAGGGGGGGGGGTGCGG - Intronic
1125616335 15:41016975-41016997 AAAAAAAAGGGTAGGGGGGCTGG - Intronic
1125665710 15:41428562-41428584 AAAAAAAAGGAGTAGGGGGCCGG - Intronic
1125682984 15:41544433-41544455 AAAAAAAAGGATGTGTGTTCTGG - Intergenic
1125843181 15:42824949-42824971 ATAAAAAAGCAGAGGAGGCCAGG + Intronic
1125933076 15:43613792-43613814 AAAAAAACAGAGAGGAGCTCCGG + Intronic
1125946174 15:43713254-43713276 AAAAAAACAGAGAGGAGCTCCGG + Intergenic
1125947828 15:43724344-43724366 AAAAAAAAAAAGAGCTGGACTGG - Intergenic
1126013501 15:44326946-44326968 AAAAAAAAGCAGATGTTGGCTGG - Intronic
1126554832 15:49974383-49974405 AAAAAAAAGGACAAGTGGCTGGG - Intronic
1126847223 15:52772097-52772119 AAAAAAAGCGAGATGTGGCCGGG + Intronic
1127112479 15:55689479-55689501 AAGAAAAAGGGGAGGGAGTCTGG + Intronic
1127217092 15:56834567-56834589 AAAAGACAAGAGAGGTGGTCAGG + Intronic
1127253637 15:57269346-57269368 AAAAAAAAGCAGGGGTTGTGCGG - Intronic
1127887888 15:63219439-63219461 AAAAAAAAAAAAAGTTGGTCTGG - Intronic
1127973606 15:63981095-63981117 AAAAAAAAAAAGAGGTGATTGGG + Intronic
1128012438 15:64310709-64310731 AAAAAAAAGGAAAAGAGGCCGGG + Intronic
1128048377 15:64640170-64640192 AAAAAAAGAGAGAGGAGGCCAGG - Intronic
1128066010 15:64764929-64764951 AAAAAAAAGAAGAACTGGCCAGG + Intronic
1128154175 15:65382419-65382441 AAAAAAAAGGAAAAATGGACTGG + Exonic
1128240689 15:66099184-66099206 AAGAAAAAGGAGGGGTGGGAGGG - Intronic
1128367495 15:67014829-67014851 AAAAAAAAGAAGAGGAGATTTGG - Intergenic
1128448728 15:67788236-67788258 AAAAAAAAGGGGAGAAGGCCTGG - Intronic
1128500478 15:68223747-68223769 AAAAAAAAAAAGAGGGGGGCTGG + Intronic
1128616174 15:69111727-69111749 CAAAAAAAAGAGAGGAGATCAGG + Intergenic
1129059950 15:72852907-72852929 AAAAAAAAGAAGAAGTAGTTGGG - Intergenic
1129083907 15:73068219-73068241 AAAAAAAAGGGGGGGGGGTAGGG - Intronic
1129481939 15:75833383-75833405 AAAAAAAAAGGGAGGGGGGCGGG + Intergenic
1129493914 15:75958305-75958327 AAAATAAGTGAGAGGTGGCCGGG - Intronic
1129627466 15:77217240-77217262 AAAAAAAAGGGCAGGTTGTGGGG + Intronic
1129715950 15:77850952-77850974 AAAAAAAAAGAGAGGTAGAGAGG + Intergenic
1129750091 15:78056675-78056697 AAAAAAAAAAAGAGGAGGACTGG - Intronic
1129761741 15:78132712-78132734 AAAAAACAGGAGATGAGGCCGGG - Intronic
1130803806 15:87296973-87296995 AAAAAAAAGAAGGGGTGGTATGG + Intergenic
1130830816 15:87596761-87596783 AAAAAAAAGGTGGGGTGGGGGGG + Intergenic
1130926038 15:88386578-88386600 AAGATAAAGAAGAGGTGGACTGG + Intergenic
1131197020 15:90363848-90363870 AAACAAAATGATAGGTGGCCAGG - Intronic
1131205830 15:90445822-90445844 AAAAAAAAAGAATGCTGGTCAGG - Intronic
1131235472 15:90693049-90693071 AAAAAAAAGAAGAAGAGGTCGGG - Intergenic
1131620784 15:94065905-94065927 AAAAAAAAGGTGGGGGGGTGGGG + Intergenic
1131707763 15:95016659-95016681 AAAGAAGAGGAGGGGTGGCCAGG + Intergenic
1131779897 15:95844765-95844787 AAAAAAAAGTAGTGGGGGTTTGG + Intergenic
1131934338 15:97486332-97486354 AAAAAAAAGAAGTGGTGATAAGG + Intergenic
1132015235 15:98309469-98309491 AAAAAAAAGAAGAGGAGGCCGGG - Intergenic
1132266586 15:100477987-100478009 ACAAAAAAGTATAGATGGTCAGG - Intronic
1132773407 16:1577938-1577960 AAAAAGACGGAGGGGTGGGCAGG + Intronic
1132831574 16:1930649-1930671 AAAAAAAAAAAGATGTGGTAGGG - Intergenic
1133009265 16:2901331-2901353 AAAGAACAGGAGAGGGGCTCCGG - Intergenic
1133139331 16:3732695-3732717 AAAAAAAATGATAGGTAGCCGGG - Intronic
1133236792 16:4391125-4391147 ATCAAAAATGAGAGGTGGGCTGG + Intronic
1133242603 16:4424253-4424275 AAAGAAAAGAAGTGGTGGCCGGG - Intronic
1133474475 16:6106964-6106986 TAAAAGAAGGAGGGGTGGCCAGG - Intronic
1133490391 16:6262440-6262462 GAAAAAAAGGAGAGATGGGGAGG + Intronic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1133723700 16:8518221-8518243 AAAATAAAGGAAAGTTGGGCCGG + Intergenic
1133750022 16:8717810-8717832 AAAAAAAAAAAGAGGTGATTTGG - Intronic
1134000426 16:10778668-10778690 AAAAAAAAAGATAGAGGGTCGGG + Intronic
1134101728 16:11457188-11457210 AAAAACAAGGAGCGTTGGTAAGG + Intronic
1134138210 16:11694442-11694464 AAAAAAAAGCATTGCTGGTCGGG - Intronic
1134415138 16:14036951-14036973 AAAAAAAAAGTGAGATGATCTGG - Intergenic
1134602164 16:15542051-15542073 AAAAAAAAAGACAGGTGGTCGGG - Intronic
1135021420 16:18966247-18966269 AAAAAAAAGAAAAAGTGGCCAGG - Intergenic
1135417715 16:22281220-22281242 AAAGAAAAGGAAAGGAGGCCAGG - Intronic
1135458319 16:22618265-22618287 AAAAAAAAGCATCGGTGGGCTGG + Intergenic
1135470052 16:22722085-22722107 AAAAAGAAGGAAAAGTGGACTGG + Intergenic
1135525931 16:23213545-23213567 AATGAAAAGGAGAGGGGGCCAGG - Intronic
1135685433 16:24494869-24494891 AGAAAAAAGGAGAGAAGGTGGGG + Intergenic
1135772874 16:25230537-25230559 AAAAAAAAGGCCAGGCGCTCTGG + Intergenic
1135968618 16:27055821-27055843 GAAAAAAAGGACAGCTGGTGAGG - Intergenic
1136001995 16:27301859-27301881 AAAATAAAGGAGTGGAGGTTGGG + Intergenic
1136133705 16:28241213-28241235 AAAAAAAAGAAGAGGAGATTAGG - Intergenic
1136162299 16:28428358-28428380 AAAAAAAAGGAGGCGGGGTGCGG - Intergenic
1136200667 16:28686631-28686653 AAAAAAAAGGAGGCGGGGTGCGG + Intergenic
1136217013 16:28800824-28800846 AAAAAAAAGGAGGCGGGGTGCGG + Intergenic
1136243321 16:28958152-28958174 AAAAATAAGAAGATGTGGCCAGG + Intronic
1136341761 16:29648595-29648617 AAAAAAAAAAAGAGCTGGGCGGG - Intergenic
1136463228 16:30424879-30424901 AAAAAATAGAAAAGATGGTCTGG - Intronic
1136484169 16:30560616-30560638 AAAAAAAAGAAGAAGAGGGCCGG + Intergenic
1136534295 16:30890402-30890424 AAAAAAAAGCAGAGCTGATGAGG + Intronic
1136549512 16:30975413-30975435 AAAAAAAGGGAGAGGTTGTGGGG - Intronic
1136864095 16:33727837-33727859 AAAAAAAATGTGAGGTGGGATGG - Intergenic
1137069409 16:35888254-35888276 TAAAAATACAAGAGGTGGTCAGG + Intergenic
1137404884 16:48181597-48181619 AAAAAAAAGAACATGTGGTTTGG - Intronic
1137418724 16:48311929-48311951 AAAAAAAAGAAGAAGCTGTCAGG - Intronic
1137649615 16:50108662-50108684 AAAAAAAAGGGGAGCTGGCCGGG + Intergenic
1138294971 16:55878336-55878358 AAAACAAAGGAGTGGTGCTCTGG + Intronic
1138375524 16:56561201-56561223 AAAAAAGGGCAGAGGTGGGCAGG + Intergenic
1138497715 16:57418306-57418328 AAAAAAAAGCAGGGGTGGGGTGG - Intergenic
1138605041 16:58083267-58083289 AAAAAAAAAGAGATGCGGTGGGG - Intergenic
1138767595 16:59623007-59623029 AAAAAAAGGGAGAGATGTTTTGG - Intergenic
1138830971 16:60374300-60374322 AAAAAAAAGGAGAAGAGGATGGG - Intergenic
1138950912 16:61911629-61911651 AAAAAGAGAGAGAGGTGGTGGGG - Intronic
1139423279 16:66862371-66862393 AAAATAAATGAGAGGGGGCCTGG + Intronic
1139448875 16:67014804-67014826 AAAAAAAAGGAGGGGGGCGCTGG + Intergenic
1139462713 16:67135439-67135461 AAAAAAGGGGAGAGCTGGCCAGG - Intronic
1139529553 16:67536434-67536456 AAAAAAAAAGAGAGGTACTGGGG + Intronic
1139585335 16:67899322-67899344 AAAAAAAAAAAAATGTGGTCTGG - Intronic
1139586470 16:67907256-67907278 AAAAAAAAAAAGAGTTGGCCAGG - Intronic
1139610847 16:68057435-68057457 TAAAAAAAAGAGAGGAGGCCGGG + Intronic
1139828088 16:69773472-69773494 AAAAAAAAGAAAAGGTGGCTGGG - Intronic
1139833009 16:69815492-69815514 AAAAAAAAGGAGAGGGGCAGGGG + Intronic
1140054665 16:71515662-71515684 AAAAAAAAAGAAAGGTGGGGCGG + Intronic
1140279815 16:73544196-73544218 AAAAAAAAGGTGGGGTGGAGGGG + Intergenic
1140284727 16:73591396-73591418 AAAATAAAGCAGAGGGGGCCGGG + Intergenic
1140309140 16:73832191-73832213 AAAAAAAAGCATATGAGGTCGGG - Intergenic
1140467204 16:75192074-75192096 AAAAAAAAAAAGATGTGATCTGG - Intergenic
1140823658 16:78685912-78685934 AAGAAAAAAGAGAGGTGGGTAGG + Intronic
1140850197 16:78928190-78928212 AAAAAAAAAGAAAAGTGGTAGGG - Intronic
1140904106 16:79395822-79395844 AACAGTAGGGAGAGGTGGTCTGG + Intergenic
1140985606 16:80155714-80155736 AAAAGAAAAGAGAGGCGGCCGGG + Intergenic
1141635006 16:85309946-85309968 ATAAAAAAGGAGAAGTGGCGGGG + Intergenic
1141660995 16:85441357-85441379 ACAAAACAGGGGACGTGGTCTGG + Intergenic
1142138041 16:88460517-88460539 AAGAAACAGGGGAGATGGTCTGG + Intronic
1142326033 16:89415247-89415269 AAAAAAAAGAATAGCTGGCCAGG - Intronic
1142350741 16:89578357-89578379 AAAAAAGAGGAAAAGTGGGCTGG - Intronic
1142391362 16:89802696-89802718 AAAAAAAAGAATAGCTGGCCGGG - Intronic
1203125583 16_KI270728v1_random:1575975-1575997 AAAAAAAATGTGAGGTGGGATGG - Intergenic
1142535047 17:608907-608929 AAAAAAAATGAGCAGTGGGCCGG - Intronic
1142619516 17:1155967-1155989 AAAAAAAAGGATAGGGTGGCAGG + Intronic
1142746694 17:1962873-1962895 AAAAAAAAAGAGATGTGGGAAGG + Intronic
1142886358 17:2914783-2914805 AAAAAAAAAAAGAAGTGGCCGGG - Intronic
1143124923 17:4635924-4635946 CAAGAAAAGGGGAGGTGGTGGGG + Exonic
1143177033 17:4961458-4961480 AAAAAAAAAAAGAGATGGCCGGG + Intronic
1143191620 17:5044163-5044185 GAAAGAAAGGAAAGGTGGCCAGG - Intronic
1143389663 17:6552743-6552765 AAAGAAAAAGAAAGGTGGCCAGG - Intronic
1143543934 17:7585543-7585565 AAAAAAAAAGTGTGGTGGTTTGG + Intronic
1143901616 17:10178693-10178715 AAAAAAAAAAAAAGGTGGTGGGG - Intronic
1144303557 17:13946665-13946687 AAAACAAAGAAAAGGGGGTCGGG - Intergenic
1144328606 17:14205130-14205152 AAAAAAAAAGGAAGGTGGTGTGG - Intronic
1144544990 17:16185988-16186010 AAAAGAAAGCAGAGATGGTAAGG + Intronic
1144822694 17:18086653-18086675 AAAAAAAAAAAAAGGTGGTATGG + Intergenic
1144957759 17:19027870-19027892 AAAAAAAGGGAGAAGTGGTTTGG - Intronic
1144977398 17:19146650-19146672 AAAAAAAGGGAGAAGTGGTTTGG + Intronic
1146096320 17:29933250-29933272 GAAACAAAGGAGAGAAGGTCTGG + Intronic
1146097919 17:29950349-29950371 AAAGAAAGAGAGAGGTGGTGGGG - Intronic
1146098618 17:29956846-29956868 AAAGAAAGAGAGAGGTGGGCTGG + Intronic
1146305495 17:31726937-31726959 AAAAAAAAGAAAATGTGATCAGG - Intergenic
1146362084 17:32185403-32185425 AAAAAAAAGGAGAGTAGGCCAGG - Intronic
1146382184 17:32339108-32339130 ACAAAAAAGGAGAGGTGTAATGG + Intronic
1146421806 17:32693862-32693884 AGAAAAAAGGAGAGTGGGGCCGG + Intronic
1146475343 17:33158090-33158112 ATAAAACAGGAGAGGAGGACAGG - Intronic
1146624219 17:34423813-34423835 AAAAAAAATCAGAGGTGCTGAGG + Intergenic
1146709438 17:35028037-35028059 AAAAAAAAGAAGCGTTGGCCAGG + Intronic
1147246123 17:39122104-39122126 AAAAAAAAGGGGGGGGGGACTGG + Intronic
1147289327 17:39429030-39429052 AAAAAAAAGGCCAGGTGAACTGG + Intronic
1147337186 17:39734225-39734247 AAAAAAAAAAAGAAGGGGTCAGG - Intergenic
1147402077 17:40186599-40186621 AAAAAAAAAAAGAGGTGGGCTGG + Intronic
1147411717 17:40257753-40257775 AAAAAAAAGGAAAGGAGGAAAGG + Intronic
1147465702 17:40609099-40609121 AAAAAAAGGAAGAGGAGATCAGG - Intergenic
1147606500 17:41776709-41776731 AACAAAAAGGTGAGGGGGCCAGG + Intronic
1147615771 17:41826516-41826538 AAAAAAAATGGGTCGTGGTCAGG - Intronic
1147622843 17:41879399-41879421 AAAAAAAAGGCGGGGGGGGCAGG - Intronic
1147665981 17:42148416-42148438 AAAAAAAAAAAGAAGTGGGCAGG + Intronic
1148179031 17:45590417-45590439 AAAGAAAAGACCAGGTGGTCTGG - Intergenic
1148237998 17:45982327-45982349 AAAAAAAAGGGGTGGGGGGCGGG + Intronic
1148270135 17:46256088-46256110 AAAGAAAAGACCAGGTGGTCTGG + Intergenic
1148396049 17:47309013-47309035 AAAGAAAAGGAGAGGAGGGGAGG - Intronic
1148397147 17:47318095-47318117 AAAAAAAAAGAGAGGGAGTTAGG + Intronic
1148544853 17:48509947-48509969 AAAAACAAGGCGAGGTGCTGTGG + Intergenic
1148602519 17:48905148-48905170 AAAAAAAAGGGGGGGGGGTGGGG + Intergenic
1148629602 17:49096936-49096958 AAAAAAAAAAAAAGGTGGCCGGG - Intergenic
1148716072 17:49717074-49717096 AAAAAAAATGAGTTTTGGTCTGG + Intronic
1148876613 17:50691064-50691086 CAAAAAAGAGAGAAGTGGTCAGG - Intronic
1148951126 17:51313549-51313571 AAAAAAAGAGAGAGATGTTCAGG + Intergenic
1149155327 17:53622311-53622333 AAAAAAAAGGCCAGGTGCTGTGG + Intergenic
1149184483 17:53981025-53981047 ACATAAAAGCAGAGGTGGTTAGG + Intergenic
1149556446 17:57576804-57576826 AAAAAAAAGGAAGGTTGGGCAGG + Intronic
1149704593 17:58683769-58683791 AAAAAAAGAGAGACTTGGTCAGG + Intronic
1149784917 17:59426478-59426500 AAGAAAAAGGATTGGAGGTCAGG + Intergenic
1150370229 17:64631200-64631222 AAAAAAAGGGAGAGAGGGACGGG + Intronic
1150513024 17:65776229-65776251 AAAAAAAAGGGGATGGGGGCGGG - Intronic
1150578213 17:66448987-66449009 AAAAAAAAAAAAAGGTGGCCAGG + Intronic
1150741526 17:67782532-67782554 AAAAAAAGGGAAAGGTCGTATGG + Intergenic
1150801007 17:68282793-68282815 AAAAAAAAGGCCAGGTGTGCTGG + Intronic
1150990818 17:70256719-70256741 AAAAAATATGAGAGGTGGACAGG - Intergenic
1151135448 17:71942160-71942182 AAACAAAGGGAGAGGAGGTGTGG - Intergenic
1151154806 17:72117020-72117042 AAAAGAAAGATGAGGTGGACGGG - Intergenic
1151337666 17:73449591-73449613 AAAAAAAAAAAGAGGTGGGGGGG - Intronic
1151486087 17:74401455-74401477 AAAAAGAAGGAAAGGTTGGCTGG - Intergenic
1151525540 17:74664001-74664023 AAAAAAAAGGAGCGGGGGCAGGG + Intergenic
1151536455 17:74741593-74741615 AAAAAAAAAAAGAGCTGGGCTGG + Intronic
1151562687 17:74879029-74879051 AAAAAAAAAAAAAGGTGGTGAGG - Intronic
1151999915 17:77638769-77638791 AAAAAAAAGGGGGGGGGGTGGGG + Intergenic
1152011016 17:77716923-77716945 AAAAAAAAAGAGAGAAGCTCAGG - Intergenic
1152022568 17:77788349-77788371 AAAAAAAAAAAGAGGGAGTCGGG + Intergenic
1152179537 17:78810113-78810135 AAAAAAAAGAAGAGGGGGGCCGG - Intronic
1152348371 17:79768783-79768805 AAAAAAAAGAAGAGGATGGCCGG + Intergenic
1152364360 17:79846598-79846620 AAGAAAAAGGATGGGTGGGCCGG - Intergenic
1152443165 17:80322146-80322168 AAAAAAAAGGGGGGGTGGGGGGG - Intronic
1152833414 17:82513293-82513315 AAAATTAAGGAAAGGTGGCCAGG - Intergenic
1153033955 18:741228-741250 AAAAAAAAGGAGAAAAGGACAGG - Intronic
1153091205 18:1345978-1346000 AAAGAATAGCAGAGGTGTTCTGG - Intergenic
1153227938 18:2912021-2912043 AAAAAAAAAAAGTGGTTGTCAGG - Intronic
1153268587 18:3296407-3296429 AAAAAAAAGGTGGGGAGGCCGGG - Intergenic
1153324854 18:3808058-3808080 AAAAACTAGGAGTGGTGATCTGG + Intronic
1153646596 18:7201623-7201645 AAAAAAAAGGAGCGTTGGTGTGG - Intergenic
1153748964 18:8210007-8210029 AAAAAAAAAAAAAGGTGCTCGGG + Intronic
1153864721 18:9254181-9254203 AAAAAAAAGAAAATGTGGTGTGG - Intronic
1154144042 18:11851414-11851436 AAAACAAAGGAGCGGCGGCCGGG + Exonic
1154210416 18:12375246-12375268 AAAAAAAAAGAGCGGGGGTGGGG - Intronic
1154211956 18:12387111-12387133 AAAAAAAAAGAAAAGAGGTCAGG + Intergenic
1154255881 18:12780467-12780489 AAAAAAAAATAGAGGTTGGCTGG - Intergenic
1154333269 18:13447122-13447144 AAAAAAAAGGGGGGGCGGGCGGG - Intronic
1154409938 18:14133412-14133434 ACAAAAAAAAAGAGGTGTTCAGG - Intergenic
1155004230 18:21713740-21713762 AAAAAAAAGGAGAGGGGTGCAGG - Intronic
1155146657 18:23089427-23089449 AAAAAAAAAAAGAGTTGGTGGGG + Intergenic
1155653597 18:28170931-28170953 AAAAAAAACTAGAGGAGGCCAGG + Intronic
1155866637 18:30973610-30973632 ATAAAAAAGAAAAGGTGGTCAGG - Intergenic
1155993486 18:32305242-32305264 AAATAAAAGGATATGTGGGCAGG - Intronic
1156049376 18:32913553-32913575 AAAAAAAAAGAAAGTTGGGCAGG + Intergenic
1156061374 18:33080427-33080449 AAAGAAAAGAAGAGGAGATCTGG + Intronic
1156360289 18:36378607-36378629 AAAAAAAAAGAGAGATGGGAAGG + Intronic
1156570740 18:38250041-38250063 AATAAAAAGGGGAGGTGATTGGG + Intergenic
1156831193 18:41493490-41493512 AAAAAAAAGTGGGGGTGGTGGGG - Intergenic
1156953859 18:42937568-42937590 AGAAAAAAGGAGATGTGCTCTGG + Intronic
1157209609 18:45730617-45730639 AAAAAAATGGAGAGGTTTGCAGG - Intronic
1157326097 18:46669700-46669722 AGAAAAAAGGGCAGGTGGTGGGG - Intronic
1157379380 18:47198283-47198305 AAAAAATTGAAGAGGAGGTCAGG + Intergenic
1157382765 18:47234867-47234889 AAAAAAAAAGAGAGGGGGTGGGG + Intronic
1157701837 18:49766059-49766081 AAAAAAAAGCAGATGGGGTGGGG - Intergenic
1157902290 18:51530919-51530941 AAAAAAAAGATGTGGTGGTTAGG - Intergenic
1157993224 18:52522454-52522476 AGAAAAAAGGAGAGATTTTCGGG - Intronic
1158302281 18:56065456-56065478 AAAAAAAAGGAGCTGGGGTCGGG - Intergenic
1158372246 18:56821635-56821657 AAAAAAAAGGAGGGGTATGCAGG - Intronic
1158538942 18:58335199-58335221 AGAAAAATGGAAAGCTGGTCTGG - Intronic
1159238180 18:65705253-65705275 GAAATAAAGAAGAGGAGGTCAGG - Intergenic
1159377717 18:67615297-67615319 AAAAAAAAGGAATAGTGGCCTGG - Intergenic
1159432518 18:68372505-68372527 ATAAAGAAGGAGAGGTGTGCAGG + Intergenic
1159457746 18:68683008-68683030 AAATAAAAGGAGAGGGGGTGGGG + Intronic
1159610133 18:70515603-70515625 AAAAAAAAGGATACCTGATCAGG - Intergenic
1159977877 18:74738441-74738463 AAAAAAAAGGAGAAGTTGGCCGG + Intronic
1159982932 18:74808003-74808025 AAAAAAAATGTGAGGTGCTGTGG - Intronic
1160173722 18:76576377-76576399 AAAACAAATGAGTGGTTGTCAGG + Intergenic
1160848328 19:1176929-1176951 AAAAAAAAGGAGATTTGGCCGGG - Intergenic
1161002142 19:1915946-1915968 AAAAAAAAAAAGAGATGGTCCGG + Intronic
1161020679 19:2009856-2009878 ACAAAAAAGGAGGGGAGGCCAGG + Intronic
1161142893 19:2659280-2659302 TAAATAAAGGAGAGGAGGGCCGG + Intronic
1161142945 19:2659603-2659625 AAAAAAAAAGAGAGGAGGGGAGG + Intronic
1161181910 19:2889327-2889349 AAAAAAAAAGAGAGATGCGCAGG - Intergenic
1161227377 19:3153265-3153287 AAAAAAAAGGAAAGATGGAAGGG + Intronic
1161437885 19:4274505-4274527 AAAAAAAGGCAGAGCTGGCCAGG + Intergenic
1161476572 19:4489246-4489268 AAAAAAAAAGAAAGGTGGCCAGG - Intronic
1161542068 19:4857977-4857999 AAAAAAAAAAAGAGGGGGCCGGG + Intronic
1161552428 19:4921449-4921471 ACGAAAAAGGAAAGTTGGTCAGG + Intronic
1161556033 19:4943246-4943268 AAAAAAAAGGGGGGGTGGTGAGG + Intronic
1161611056 19:5243112-5243134 AAAAAAAAAGAGAGCTAGCCAGG - Intronic
1161649668 19:5476703-5476725 AAAAAAAAGGAGAGGCGGCCGGG + Intergenic
1161702518 19:5803300-5803322 AAAAAAAAAGAGAGATGGCAGGG + Intergenic
1161825884 19:6564970-6564992 AAAAAAAATGAGAGTTGGCTAGG - Intergenic
1161850558 19:6735971-6735993 AAAAAAAAGGGGAGGGTGTGAGG + Intronic
1162085691 19:8247718-8247740 AAAAAAAAGATGCGGAGGTCAGG - Intronic
1162089945 19:8272788-8272810 AAAAAAAAAAAGAGGAGGCCAGG + Intronic
1162447780 19:10734351-10734373 AAAAAAAAGGAAGGGAGGCCAGG + Intronic
1162768841 19:12937239-12937261 AAAAAAAAGAAATGGTGGCCGGG - Intergenic
1162777494 19:12988761-12988783 AAAATGAAGGAGAGATGGCCGGG + Intergenic
1162836740 19:13324455-13324477 CAAAAAACGGTGAGGTGGTGAGG + Intronic
1162838332 19:13336537-13336559 AAAATCAAGGAGAGGAGGTTGGG + Intronic
1162923023 19:13914627-13914649 AAAAAAAAGGCGATGAGGCCTGG - Intronic
1162934534 19:13975052-13975074 AAAAAAAAAGGGAGGGGGGCAGG + Intronic
1163087104 19:14989574-14989596 AAGAAAAAAGATAAGTGGTCAGG + Intronic
1163110235 19:15156027-15156049 AAAAAAAAAGAGAAGAGGCCGGG + Intergenic
1163269093 19:16239226-16239248 AAAAAAAAAGAGAACTGGCCGGG - Intronic
1163278960 19:16303446-16303468 AAAAAAAAAAAAAGGTGGTAGGG - Intergenic
1163550386 19:17963306-17963328 AAAAAAAAAAAAAGGTGGCCGGG - Intronic
1163574444 19:18102472-18102494 AAAAAAAAAAAAAGGTGGCCGGG - Intronic
1163682726 19:18692607-18692629 AAAAAAAAAAAGAAGTGGTTAGG + Intronic
1163859473 19:19733891-19733913 AAAAAAAAGAAGAAGAGGCCGGG - Intergenic
1163918607 19:20266029-20266051 AAAAAAAAAAAAAGGTGGCCAGG - Intergenic
1164150297 19:22544709-22544731 AAAGAAAAGGAAAGATGGTCTGG + Intergenic
1164292342 19:23879775-23879797 AAAAAGGAGGAGAGGAGGTGGGG + Intergenic
1164936234 19:32216693-32216715 AAAAAAAAAAAGACATGGTCTGG + Intergenic
1165043844 19:33088644-33088666 AAAAAAAAGCAAAGGTGGCCGGG - Intronic
1165050508 19:33138640-33138662 AAAAAAAAGGTGTGGGGGCCAGG - Intronic
1165163032 19:33829312-33829334 AAAAAAAAGAAGAGGTTTCCAGG + Intergenic
1165245736 19:34497518-34497540 GAAAAGAAGGAGTGGGGGTCAGG + Intronic
1165360690 19:35335089-35335111 AAAAAAAAAAAGAGGTGGTGAGG + Intronic
1165459056 19:35933553-35933575 AAAAAAAAAGAGATGGGGGCTGG + Intergenic
1165459132 19:35934011-35934033 AAAAAAAAAGAGATGGGGGCTGG + Intergenic
1165548167 19:36559961-36559983 AAAAACAAAGAGAAGTGGCCTGG + Intronic
1165564389 19:36712032-36712054 AAGAAAAAGAACAGGTGGACTGG - Exonic
1165573748 19:36796753-36796775 AAAATAAAGGAAATGTAGTCGGG - Intergenic
1165696403 19:37904287-37904309 AAACAGAAGGACAGCTGGTCAGG - Intronic
1165933354 19:39374403-39374425 AAAAAAAATGGGAGGTAGTGAGG + Intronic
1165988934 19:39794864-39794886 AAAAAAAAAGAGAGCAGGTGGGG - Intergenic
1166050172 19:40254530-40254552 AAAAAAAAAAAAAGGGGGTCAGG + Intronic
1166063988 19:40345860-40345882 AAAAAAAAGGAAAGGTGGCTGGG + Intronic
1166073742 19:40401758-40401780 AAAAAAAAAAAGGGGTGGGCTGG - Intronic
1166307591 19:41943595-41943617 AAAAAAAAGGTGGGGGGGCCGGG + Intergenic
1166363250 19:42265001-42265023 AAAAAAAAGAAGAAATGGCCGGG - Intergenic
1166572129 19:43803831-43803853 AAAGAAAAAGAGAGGGGGTGCGG - Intronic
1166693877 19:44841300-44841322 AAAAGAAAGGAAAGGTTGCCAGG + Intergenic
1166834381 19:45658264-45658286 AAAAAAAAGGAGAGAGAGACAGG - Intergenic
1166881155 19:45930891-45930913 AAAGGAAAGGAGATGAGGTCAGG - Intergenic
1167003024 19:46756942-46756964 AAAACAAAGGCGAGGTTATCAGG - Exonic
1167004279 19:46765535-46765557 AAAAAAAAGTAGAGCAGGCCTGG + Intronic
1167243092 19:48356879-48356901 AAAAAAAAGGCCAGGTGCTGTGG - Intronic
1167346986 19:48952496-48952518 AAAAGAAAGGAGGGGGGGCCGGG - Intergenic
1167385646 19:49161624-49161646 AAAAAAAAAAAGAGGTAGCCGGG - Intronic
1167465443 19:49648556-49648578 AAAAAAAAGGGGGGGGGGTGTGG - Intronic
1167575892 19:50317214-50317236 TACAAAAAGGAGAGGTGGGGGGG + Intronic
1167657074 19:50771850-50771872 AAAAAAAAGGGGGGGGGGGCGGG - Intergenic
1168030943 19:53679267-53679289 AAAAAAAGGGGGAGGGGGTGGGG - Intergenic
1168226314 19:54997748-54997770 AAAAAAAAAAAAAGGTGGCCGGG - Intronic
1168442832 19:56385677-56385699 AAAAAAAAAAAGAGTTGGTGTGG + Intronic
1168688869 19:58364986-58365008 AAAAAAAAGGGGGGGAGGCCTGG + Intergenic
1202646688 1_KI270706v1_random:148347-148369 AAAAAAAAGGAGGGGAGGAAAGG + Intergenic
925207936 2:2023162-2023184 AAAAAAGAGTAGAGGTGGAAGGG + Intronic
925706118 2:6685887-6685909 AAAAAAAAGGAGTGGGGTCCTGG + Intergenic
925970676 2:9104633-9104655 AAATAAAAGGAAAGGGGGCCGGG + Intergenic
926110295 2:10178516-10178538 AACAAACAGGAGGGGTGGCCAGG - Intronic
926408757 2:12580298-12580320 AGAGAAAAGAAGAGGTGTTCTGG + Intergenic
926509087 2:13750776-13750798 AATAAAAAGGACAGATGTTCAGG + Intergenic
926728237 2:16015040-16015062 AGAAAAAAGGAAAGGTAGGCAGG - Intergenic
926948583 2:18216492-18216514 AAAAAAAAGGAGTGGGAGGCGGG + Intronic
927231706 2:20830412-20830434 AAAAAAAAGGAGAGGTGGGGTGG - Intergenic
927268887 2:21184322-21184344 AAAAAATTGGAGAGGATGTCTGG - Intergenic
927356151 2:22175837-22175859 AAAGAAAAGGAGATGTGGTGAGG - Intergenic
927506115 2:23615925-23615947 AAAGAGAAGCAGAGGGGGTCTGG - Intronic
927651189 2:24914685-24914707 AAAAAAAAGGAATGGGGGACAGG + Intronic
927868466 2:26608250-26608272 AAAAAAAAGGAGAGTGGGTCTGG + Intronic
928285241 2:29984747-29984769 AAAAAAAAAAAGAGGGGGGCGGG - Intergenic
928338841 2:30423879-30423901 AAAAAAAAGGATAGATACTCAGG - Intergenic
928448316 2:31353014-31353036 AAAAAAAAAAAGAGGTGGCTGGG - Intronic
928520024 2:32079551-32079573 AAAAAAAAGCAGGGGTGGGGTGG - Intronic
928571091 2:32609177-32609199 AAAGAAAAGGAAACGTGGCCAGG - Intronic
928628769 2:33169040-33169062 AATAAAAAGGAGTTGTAGTCGGG + Intronic
928716184 2:34063468-34063490 AAAAAAAATCAGAGTTGGCCGGG + Intergenic
929215610 2:39408641-39408663 AAAAAAAAAAAAAGGTGGTGGGG + Intronic
929473085 2:42216219-42216241 AAAAAAAAAAAGAAGTGGGCCGG - Intronic
929534899 2:42775257-42775279 AAAAAAAAAAAAAGGTTGTCTGG + Intronic
929656155 2:43733710-43733732 AGAAAAAAGTAGAGGTGGGGAGG + Intronic
929719633 2:44354565-44354587 AAAAAAAAAGAGAGGAGGAAAGG - Intronic
929745766 2:44656696-44656718 AAAAAAAAGGTGGGGTGGGGGGG - Intronic
929795849 2:45058011-45058033 AAAAAAGAAGAGAGGAGGTGGGG - Intergenic
929833471 2:45371375-45371397 AAAAAAATGCAAAGGTGGGCTGG + Intergenic
929844893 2:45513910-45513932 AAAACAATGGAGAGGTGGAAAGG + Intronic
930068723 2:47348090-47348112 AAAAAAAAAGAGAGAGAGTCCGG + Intronic
930128754 2:47826752-47826774 AATAAAAAGAAGAGGTGATTTGG - Intronic
930563211 2:52986831-52986853 AAAATAAAGAAGAGTTGATCAGG - Intergenic
930764246 2:55068671-55068693 AAAAAAAAGGGGGGGGGGTGGGG + Intronic
930815308 2:55590771-55590793 AAGAAAAAGGACAGGTAGTTGGG - Intronic
930816275 2:55601365-55601387 AAAGAAAAAGACAGTTGGTCTGG - Intronic
930870732 2:56168229-56168251 CAAAAAAAGGAGAGGTGGAAGGG - Intergenic
930976182 2:57464478-57464500 AAAAAAAAGGAGCATTGGCCGGG + Intergenic
931339684 2:61387977-61387999 AAAAAAAAGGCCAGGTGGAGTGG + Intronic
931373212 2:61683400-61683422 AAAAAAAAGGAGGGGTATTAGGG + Intergenic
931379210 2:61736442-61736464 AAAAAAAACTAGAGTTGGTGGGG - Intergenic
931539462 2:63314170-63314192 AAAAAAAAGAAGATGGGGCCAGG - Intronic
931777226 2:65551038-65551060 AAAAAAAAGGAAATTTGGGCTGG + Intergenic
931784491 2:65607209-65607231 AAAAAAAAAAAGAGCTGGTGGGG + Intergenic
931833857 2:66079033-66079055 AAAAACATGGAGCGGGGGTCGGG + Intergenic
932030416 2:68177909-68177931 AAAAAAAAGAAAAGGAGCTCTGG + Intronic
932199356 2:69812107-69812129 AAAAAAAAGGTGGGGAGGTTGGG - Intronic
932230543 2:70080520-70080542 AAAAAAAAGAAGGGGTGGCCGGG - Intergenic
932387714 2:71352503-71352525 AAAAAAAAGAAGAGGAGGGTTGG + Intronic
932754590 2:74398063-74398085 AAAAAAAAGGTGGGGTGGTCAGG + Intergenic
933217649 2:79648730-79648752 GAACAAAAGGAGTGGTGGTGGGG - Intronic
933348421 2:81121052-81121074 AAAAGAAATGAGTGGTTGTCAGG - Intergenic
933377699 2:81501135-81501157 AAAAAAAATTAAATGTGGTCAGG + Intergenic
934076319 2:88431638-88431660 AAAAAAAAAAAAAGGTGGTGGGG - Intergenic
934285614 2:91648115-91648137 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
934750770 2:96792804-96792826 AAAAAAAAAGAGAGGAGGTCAGG + Intronic
935207652 2:100910509-100910531 AAAAAAAAGAAGATGTCATCTGG - Intronic
935226115 2:101054533-101054555 AAAAAAAAGGAATGGCAGTCGGG + Intronic
935375214 2:102388558-102388580 CTAAGAAAGGAGAGGTGATCCGG - Intronic
935503471 2:103870016-103870038 AAAAAAAACCAGAGGCGGGCCGG - Intergenic
936323341 2:111484934-111484956 AAAAAAAAGAAGAAGTGGTGAGG + Intergenic
936720091 2:115240973-115240995 TAAAAAAAGTAGTGTTGGTCGGG + Intronic
937143394 2:119620926-119620948 AAAAAAAAGCAGGGGTTGGCTGG + Intronic
938017121 2:127876356-127876378 AAAAAAAAAAAAAGGTGGTAGGG + Intronic
938024285 2:127932139-127932161 AAAAAAAAGGCCAGGTGCACTGG + Intergenic
938033802 2:128018800-128018822 AAAAAAAAAAAAAGGTGGTTGGG + Intronic
938300143 2:130204697-130204719 AAAAAAAAGGGGGGGTGGGGAGG + Intergenic
938301513 2:130217536-130217558 AAAAAAAAAGAGCGGGGGACGGG - Intergenic
938419381 2:131132124-131132146 AAAAAAAAGAAAAAGTGGCCAGG - Intronic
938807183 2:134817263-134817285 AAAAAAAAGGAGTTGGGGCCGGG + Intergenic
938863300 2:135392348-135392370 AAAAAAAAGGGGGGGGGGGCAGG + Intronic
938970600 2:136427915-136427937 AAAAAAAAAGTGAGGAGTTCTGG - Intergenic
939070967 2:137542005-137542027 AAAAAAGAGGAGAGATGGAAAGG + Intronic
939531103 2:143362833-143362855 AGAAAAAAGCAGATGTGTTCAGG - Intronic
939833143 2:147096649-147096671 AAAAAAAAGGAGAGGACATGAGG - Intergenic
940331121 2:152475827-152475849 AAAAAAAAGGCAAGTTGGTGAGG + Intronic
940533441 2:154908287-154908309 AATGATAGGGAGAGGTGGTCAGG + Intergenic
940865512 2:158813848-158813870 AAGAAAAAGGAAAGGAGGCCGGG - Intronic
940952663 2:159693701-159693723 AAAAAAAAAAAAAGATGGTCAGG - Intergenic
941297903 2:163763176-163763198 TAAAAAAGGGAGAGGTGGAGGGG + Intergenic
941365180 2:164602139-164602161 AAAAAAAAGGAAAGGAGGGAAGG + Intronic
941638800 2:167965100-167965122 AACAAAGAGGAGAGGTAGTGGGG + Intronic
941919507 2:170835297-170835319 AAAAAAAAGAAGAGTTGGAGGGG - Intronic
942013501 2:171788540-171788562 AAACAACAGGGGAGCTGGTCAGG + Intronic
942035251 2:172004311-172004333 AAAAAAAAGAAAAGTTGGTTTGG - Intronic
943039753 2:182789821-182789843 AAAAAAAATGAGTGTTGGTGAGG - Exonic
943213430 2:184999150-184999172 AAAAAAAGGGAGAGGAGATAAGG + Intergenic
943659889 2:190547948-190547970 ATAAAAAAGGAGAGGTGGGGTGG + Intergenic
944142887 2:196476145-196476167 AAAAAAAAAGGCAGGTGGGCTGG + Intronic
944186714 2:196956847-196956869 AAAAAAAAAAAAAAGTGGTCAGG - Intergenic
944675454 2:202032002-202032024 AAAAAAAGGGTGGGGGGGTCCGG + Intergenic
945172503 2:207011640-207011662 TAAAAATAGGAGTGATGGTCGGG - Intergenic
945434387 2:209801675-209801697 AAAAAAAAGCAGGGGTTGGCCGG - Intronic
945735448 2:213593735-213593757 AAAAAAAAAAAGATGTGGTGGGG - Intronic
945821348 2:214669554-214669576 TAAAAAAAGGAGAGGTCCTTGGG + Intergenic
946109600 2:217403022-217403044 AAGAAAAAGGAGGGGTGGAAGGG - Intronic
946199302 2:218062415-218062437 AAAAAAAATGATAAGTGGCCGGG + Intronic
946231547 2:218294488-218294510 AAAAAAAAGGAAGGCTGGTGGGG - Intronic
946232897 2:218303560-218303582 AAAAAAAAGAAGTGCAGGTCTGG - Intronic
946266714 2:218549757-218549779 AAAAAAAATGATAGTTGGCCAGG - Intronic
946305472 2:218854659-218854681 AAAAATCAGGAGAGTTGGCCTGG - Intergenic
946357286 2:219195954-219195976 AAAAAAATGGAGAGGCTGTCTGG - Intronic
946689915 2:222302068-222302090 AAAAAAAAAAAAAGGTGGGCGGG + Intronic
946745294 2:222839406-222839428 AAAAAAAAGGGGGGGTGGAGGGG - Intergenic
946920226 2:224572645-224572667 AAAAAAAAGGTGGGGTCTTCAGG + Intronic
947154749 2:227150890-227150912 AAAAAAAAGGAGGGCTGATATGG - Intronic
947211566 2:227713413-227713435 AAAAAAAAAAAGAGGGGGTGGGG + Intronic
947411553 2:229846024-229846046 AAAAAAAAGGTGGGGGGGGCAGG + Intronic
947698943 2:232216571-232216593 AAAAAAATGGAAAGGTGGCTAGG - Intronic
947769745 2:232661554-232661576 AAAAAAAAGGGGTGGTGGTGGGG - Intronic
947867038 2:233405535-233405557 AGAAAAAAAAAGAGGTGATCAGG + Intronic
948161208 2:235826442-235826464 CAAAAAAAGGAGTGGGGGTGGGG - Intronic
948199336 2:236118821-236118843 AAAAAAAAGGTAGGGTGGTGGGG - Intronic
948330270 2:237159280-237159302 AAAAAAAAGGGGGGGGGGACAGG - Intergenic
948665326 2:239531044-239531066 AAATAAAAGGACAGCTGGTAAGG + Intergenic
948678433 2:239612619-239612641 GCAAAAACGCAGAGGTGGTCAGG - Intergenic
1168848525 20:961077-961099 AAAAGAAAGGAAAGGTAGCCTGG - Intronic
1168944590 20:1742055-1742077 AAAAAAAAAGAGAGCGGGTGGGG + Intergenic
1168974644 20:1954943-1954965 AAAAAAAAGAAGAAGGGGCCAGG - Intergenic
1169087573 20:2836861-2836883 AAACAAAAGGAGATGAGGGCAGG - Intronic
1169094099 20:2881010-2881032 AAAAAAAAAAAGAGGAGGACCGG + Intronic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169370618 20:5026454-5026476 AAAAAAAAAGAGAGAGGGTGAGG - Intergenic
1169376112 20:5067748-5067770 AAAAAAAAGCAGAGGGGGGCTGG - Intergenic
1169449288 20:5697504-5697526 AAAAAAAAAAAAAGGTGGGCGGG + Intergenic
1169604545 20:7302143-7302165 AAAAAAAAAGGGAGGTGGCGGGG - Intergenic
1169737659 20:8854454-8854476 GAGAAAAAGGAGAGGTGTTGGGG - Intronic
1170022974 20:11856188-11856210 AAAAAAAAAAAAAGGTGGCCAGG + Intergenic
1170428274 20:16256847-16256869 AATAGAAAGGAGAGAGGGTCTGG + Intergenic
1170504968 20:17015750-17015772 AAAAAAAAGGTGAGGGGATAAGG - Intergenic
1170988620 20:21281733-21281755 AAAAAAAAGGAGGAATGGTCAGG - Intergenic
1171182571 20:23101732-23101754 AAAAAACAGGAGAGATTCTCAGG + Intergenic
1171225823 20:23441314-23441336 AAACAGAAGGTGAGGTGATCTGG - Intronic
1171306411 20:24110518-24110540 CAATACAAGGAGAGCTGGTCTGG - Intergenic
1171966522 20:31534787-31534809 AAAAAAAAGAAGAAATGGGCCGG + Intronic
1172291819 20:33782304-33782326 GAAAAAAGGGAGCAGTGGTCAGG - Intronic
1172423167 20:34834974-34834996 AAAAAAAAAAAGCGGTGGTGGGG + Intergenic
1172465126 20:35150725-35150747 AAAAAAAAGAAGAGTTGGGGAGG - Intergenic
1172546725 20:35767674-35767696 AAAAAAAAGGAGGGGGGGCCAGG - Intergenic
1172595267 20:36146849-36146871 AAAAAAAAAAAAAGGAGGTCAGG + Intronic
1172721987 20:37006193-37006215 AAAAAAAACAAAAGGAGGTCAGG - Intronic
1172815676 20:37684010-37684032 AAGAAAAAGAAAAGCTGGTCAGG - Intergenic
1172877859 20:38177020-38177042 AAAAAAAAAGAGTAGGGGTCAGG + Intergenic
1173005219 20:39135051-39135073 AAAAAAAAGAAGAAGTAGTATGG - Intergenic
1173644909 20:44627169-44627191 AAAAAAAAGATAAGGTGGTCAGG - Intronic
1173780618 20:45753723-45753745 AAAAAAAAAAAAAGGTGGTGGGG + Intronic
1174008015 20:47426038-47426060 AAAAAAAACAAGATGGGGTCAGG - Intergenic
1174466443 20:50721254-50721276 AAAAAAAAGAAGAGCAGGCCGGG - Intergenic
1174749995 20:53102428-53102450 AAAGAAAAGGAGAGGAGGTGGGG + Intronic
1175057884 20:56214622-56214644 AAAAAAAAAAAAAGGTGGTGGGG + Intergenic
1175066078 20:56290007-56290029 AAAAAAAAGAAGAGGTGGGCAGG - Intergenic
1175102102 20:56586597-56586619 AAAAAAAAGGAGTGGGGGGCGGG + Intergenic
1175192619 20:57221826-57221848 AAAAAAAAAGAGGGGTGGGCAGG + Intronic
1175235094 20:57504270-57504292 AAAAAAAAGGAGACGGGGGGCGG - Intronic
1176112554 20:63417202-63417224 CAACAAAAGCACAGGTGGTCGGG + Intronic
1176164726 20:63666823-63666845 AAAAAAAAAAAGAGCTGGCCAGG - Intronic
1176164776 20:63667133-63667155 AAGAAAAAGCAGAGCTGGGCCGG - Intronic
1176202432 20:63867931-63867953 AAAAAAAAGAAAAACTGGTCGGG - Intronic
1176302072 21:5103159-5103181 TAAAAAAAGGAAATGTGGGCCGG + Intergenic
1176605181 21:8824417-8824439 AAAAAAAAGGAGGGGAGGAAAGG - Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177165917 21:17603608-17603630 AATAAAGAGGCCAGGTGGTCAGG + Intronic
1177325792 21:19586786-19586808 AAAAAAAAGGAGGGGTGAGAGGG + Intergenic
1177952565 21:27556879-27556901 AAAAAAAAAGTGAGGTTGGCCGG - Intergenic
1177953373 21:27566751-27566773 AAATAAAAGGAGAGGTGTCTAGG + Intergenic
1178122271 21:29481470-29481492 AAAAAAAAGGGGGGGGGGTGGGG - Intronic
1178142494 21:29699943-29699965 AAAAAAAAGAAGATGTTGGCTGG - Intronic
1178285277 21:31320695-31320717 GAAAAAAAGGAGAGTTGGGCTGG + Intronic
1178286998 21:31334275-31334297 AAAAAAAAGGCGGGGAGGTGGGG - Intronic
1178294210 21:31395239-31395261 AAAAAAAAAAAGAGGAGGTGGGG + Intronic
1178318368 21:31585945-31585967 AAAAAAAAGGAGAGGTGGGGAGG + Intergenic
1178473779 21:32918448-32918470 AAAAAAAAGGGGGGGGGGTGGGG + Intergenic
1178534783 21:33402966-33402988 AAAAAAAAGGGGAGGGGGGCGGG + Exonic
1178603082 21:34011987-34012009 AAAAAAAAGGGGGGGGGGCCAGG - Intergenic
1178610693 21:34076186-34076208 AAAAAACAGGAGAGCAGCTCTGG - Intronic
1178786798 21:35661224-35661246 AAAAAAAAAGAGGGGGGGGCAGG + Intronic
1178899335 21:36586566-36586588 AAAAAAAAAGAGAGATGGGGGGG + Intergenic
1179538971 21:42071834-42071856 AAAAAAAAGGAGACCTAGCCTGG + Intronic
1179854957 21:44158741-44158763 TAAAAAAAGGAAATGTGGGCCGG - Intergenic
1179892539 21:44344085-44344107 AAAAAAAATCAGAGCTGGCCAGG + Intergenic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1180347474 22:11716022-11716044 AAAAAAAAGGAGGGGAGGAAAGG - Intergenic
1180355237 22:11834130-11834152 AAAAAAAAGGAGGGGAGGAAAGG - Intergenic
1180383014 22:12158197-12158219 AAAAAAAAGGAGGGGAGGAAAGG + Intergenic
1180392424 22:12297216-12297238 AAAAAAAAGGGGGGGTGGGATGG - Intergenic
1180642651 22:17311446-17311468 AAAAAAAAAGAAAGAGGGTCAGG + Intergenic
1180758851 22:18183484-18183506 AAAGAAAAGGCCAGGTGTTCTGG + Intergenic
1180769138 22:18367275-18367297 AAAGAAAAGGCCAGGTGTTCTGG + Intergenic
1180777174 22:18495120-18495142 AAAGAAAAGGCCAGGTGTTCTGG - Intergenic
1180809893 22:18752429-18752451 AAAGAAAAGGCCAGGTGTTCTGG - Intergenic
1180827012 22:18870504-18870526 AAAGAAAAGGCCAGGTGTTCTGG + Intergenic
1180861872 22:19088018-19088040 AATAAGAAGCAGAGATGGTCTGG - Intronic
1180872193 22:19152568-19152590 AAAAAAAAAGGGAGGGGGGCAGG - Intergenic
1180935156 22:19620619-19620641 AAGAAAAAGGAGAGGAGATTAGG + Intergenic
1181196036 22:21186681-21186703 AAAGAAAAGGCCAGGTGTTCTGG - Intergenic
1181213491 22:21306443-21306465 AAAGAAAAGGCCAGGTGTTCTGG + Intergenic
1181261824 22:21603545-21603567 AAAAAAAAAGACAAGTGGGCTGG + Intronic
1181524184 22:23469753-23469775 AAAGAAAAGGCCAGGTGTTCCGG + Intergenic
1181628339 22:24136333-24136355 AAAAAAAAGGAGGGATGGCTAGG - Intronic
1181649478 22:24250879-24250901 AAAAAAAAAGAGAGAGAGTCTGG + Intergenic
1181748800 22:24974674-24974696 AAAAAAAAAAAGAGGTGAGCTGG - Intronic
1181759361 22:25047453-25047475 AAAAAAAAGGAAAAGAGGCCAGG - Intronic
1181825075 22:25508436-25508458 AAAAAAAAGAAGATGGGCTCTGG - Intergenic
1181963824 22:26642714-26642736 AGAAAGAAGGAGAGGAGGTGGGG + Intergenic
1182023887 22:27102329-27102351 AAAAAAAAGTGGAGCTGATCTGG + Intergenic
1182305380 22:29364404-29364426 AAAATAAAAGAGAAGGGGTCAGG - Intronic
1182572218 22:31248034-31248056 AAAAAAAAGCAGAGGATGCCAGG - Intronic
1182596468 22:31424797-31424819 AAAAAAAAGGGGGGGGGGGCGGG - Intronic
1182644765 22:31799328-31799350 AAAAAAAAGGCCAGGTGCTGTGG - Intronic
1182659659 22:31916243-31916265 AAAAAAAGGGGGGGGTGGTGGGG + Intergenic
1182679365 22:32066814-32066836 AAGAAAGAGCAGAGGTGGGCTGG - Intronic
1182773927 22:32817069-32817091 AAAAAAAAGAAAAGGTGGTTGGG + Intronic
1182935238 22:34216001-34216023 AAAAAGATGAAGAGGTGATCAGG - Intergenic
1183060081 22:35331084-35331106 AAAAAAAAAAAAAGGTGGACAGG - Intronic
1183173820 22:36207555-36207577 AAAAAAAAGCTGATGTGTTCAGG - Intergenic
1183200177 22:36380443-36380465 AAAAAGAAGGCCAGGTGGCCGGG + Intronic
1183470311 22:38002135-38002157 AAAAAAAAGGCCAGGTGTGCTGG - Intronic
1183494906 22:38137536-38137558 GAAAAACAGCAGAGGTGGCCAGG + Intronic
1183558598 22:38551843-38551865 AAAAAAAAAGAAAGGAGTTCTGG - Intronic
1183578416 22:38706739-38706761 AACAAAATGGAAAGATGGTCAGG + Intronic
1183819373 22:40332953-40332975 AAGAAAGAGCAGAGGAGGTCGGG + Exonic
1183824203 22:40372108-40372130 AAAAAAAAGGGGGGGGGGACAGG - Intronic
1183834783 22:40443466-40443488 AAAAAAAAAGGGAGGGGGTGGGG - Intronic
1183910560 22:41075807-41075829 AAAAAAAAAAAGAGGTGGGGTGG + Intergenic
1183914927 22:41110114-41110136 AAAAAAAAGGGGGGGGGGGCAGG - Intronic
1183985213 22:41566007-41566029 ACAAAAAGGGAGAGTTGGCCGGG + Intronic
1184137885 22:42560109-42560131 GATAAAAAGGAGAGGAGGGCCGG - Intronic
1184210336 22:43031623-43031645 AAAAAAAAGGAGAGCCTCTCTGG + Intergenic
1184261470 22:43319573-43319595 AAAAAAAAGAAGAGGAGATTAGG + Intronic
1184268538 22:43364001-43364023 AAAAAAAGGGGGAGGGGGTGGGG + Intergenic
1184726726 22:46351529-46351551 AAACAAGAGGAGAGGAGGACGGG - Intronic
1184772115 22:46603502-46603524 AAAAAAAAAGAGAAGAGGCCGGG - Intronic
1203230762 22_KI270731v1_random:108160-108182 AAAGAAAAGGCCAGGTGTTCTGG + Intergenic
1203277155 22_KI270734v1_random:96409-96431 AAAGAAAAGGCCAGGTGTTCTGG + Intergenic
949394658 3:3602103-3602125 AATAAAAAGGAGAGATGGTAGGG + Intergenic
949561309 3:5205354-5205376 ACAAACTAGGAGAGGTGGTAAGG - Intronic
949617621 3:5771408-5771430 TACAACAAGGAGAGATGGTCTGG - Intergenic
950014122 3:9744188-9744210 AGAAAGAAGGAGAGTTGGTGAGG - Intronic
950035685 3:9883542-9883564 AAAAAAAAGGAAACCTGGCCGGG - Intergenic
950071778 3:10158443-10158465 AAAAAAAAGAAAAGGAGGCCGGG - Intergenic
950404109 3:12793983-12794005 AAAAAAAAGGAGGGGAGGAAGGG - Intergenic
950987872 3:17395084-17395106 AACAAAAAGGAGGGGCGGTTTGG + Intronic
951103047 3:18711417-18711439 AAAAGAAAGGAGAGGAGGAGGGG - Intergenic
951132721 3:19067739-19067761 AATCAAGAGCAGAGGTGGTCCGG + Intergenic
951297890 3:20961555-20961577 AGAAAAAAGGAGATCTGGTGGGG + Intergenic
951695667 3:25443407-25443429 AAAAAAAAGGGGTGGTGGGGGGG - Intronic
952002768 3:28806005-28806027 AAAAAAAAGGTGGGGTGGTCGGG - Intergenic
952158541 3:30670065-30670087 AAAAAAATGGGTAGGTGGTATGG - Intronic
952386660 3:32846368-32846390 AAAAATAAGAAGTGGTGGCCAGG - Intronic
952409389 3:33033785-33033807 AAAAAAAAAAAAAGGTGGTAAGG + Intronic
952430624 3:33219323-33219345 AAAAAAAAAGAGTGTTGGTGGGG - Intergenic
952731677 3:36643457-36643479 AAAACAAAGGGGAGTTGGTATGG + Intergenic
952897384 3:38086777-38086799 AAAAATAAGGAGATTTGGCCAGG + Intronic
953534557 3:43767723-43767745 AAAAGAAAGGATATGTGGTTAGG + Intergenic
954045104 3:47923059-47923081 AAAAAAAAGCAAAGCTGTTCAGG + Intronic
954094686 3:48316470-48316492 AAAGAAAATGAGAGGTGGCCAGG + Intronic
954165685 3:48755766-48755788 AAAAAAAAGGAAATGGGGGCTGG - Intronic
954208458 3:49078680-49078702 AAAAAAAAGGACAGGTGTGGTGG - Intronic
954308555 3:49746045-49746067 AAAGAAAAGGAGTGTTGGTAAGG + Intronic
954319642 3:49822990-49823012 AAAAAAAAGGAGGGGGAGCCAGG + Intergenic
954605958 3:51909818-51909840 AAAAGAAACCAGAGATGGTCGGG + Intergenic
954694754 3:52416537-52416559 AAAAACACTGAGTGGTGGTCGGG + Intronic
954918630 3:54170200-54170222 AAAAAAAAAGTGAGGGGGTAAGG + Intronic
955151980 3:56376467-56376489 AAAAAAGAGGTGAGTTGGCCGGG + Intronic
955455473 3:59116533-59116555 AAAAAAAAAAAGAAGTGGACTGG - Intergenic
955557460 3:60153376-60153398 AAAAAAAAAAAGAGGAGGTGGGG + Intronic
955641658 3:61092091-61092113 AAAAAAAAAGAGTGGTGGGGTGG + Intronic
955806023 3:62735760-62735782 AAAGAAAAGAAAAGGTGGTAGGG - Intronic
956170979 3:66433010-66433032 AAATATAAATAGAGGTGGTCTGG - Intronic
956479911 3:69662945-69662967 AAAAGAAAAAAGAGATGGTCTGG + Intergenic
956599754 3:71008206-71008228 AAAAACAGGGAAATGTGGTCAGG + Intronic
957053069 3:75425161-75425183 AAAAAAAAAAAAAGGTGGGCGGG + Intergenic
957187988 3:76967500-76967522 AAAAAAAAAAAGAGCTGGCCAGG - Intronic
957458628 3:80487807-80487829 AAAATACAGGAAAGGTGGCCAGG + Intergenic
957755978 3:84488273-84488295 AAAAAAAAAAAAAGGGGGTCGGG - Intergenic
957788903 3:84915554-84915576 AAAAAAAAGAAGAAGTGATGAGG + Intergenic
957910061 3:86608655-86608677 AAAAAAAAGGAGTGATGACCTGG - Intergenic
958429871 3:94026008-94026030 AAAAAAAAAGAGAAGTTTTCAGG - Intronic
958467252 3:94473144-94473166 AAAAAAAAAGAGAGGTGGCAGGG + Intergenic
958476826 3:94594737-94594759 AAAAAAAAAGAGCTGTGGCCTGG - Intergenic
958490888 3:94771142-94771164 ATTAAAAAAGAGAGGTTGTCAGG + Intergenic
958732382 3:97972789-97972811 AAAAAAAAGGAGAGCCGGGTGGG - Intergenic
958795273 3:98700509-98700531 AAAAAAAAGGAAAGAAGGCCAGG - Intergenic
959056858 3:101575465-101575487 AAAAAAAAAGACAGGGGGTGGGG - Intronic
959150586 3:102602527-102602549 GGAAAACAGGAGAGGTGGTTTGG + Intergenic
959152640 3:102625744-102625766 AAAAAAAAGGGCAGGTGGGAAGG - Intergenic
959356769 3:105341549-105341571 ACAAAAAAGGAGTTGTGGTTTGG - Intergenic
959393909 3:105811996-105812018 AAAAAAAAGGAAATGGGGCCAGG - Intronic
959506882 3:107166061-107166083 AAAAAAAAGCAGGGGTGGCTGGG + Intergenic
959713955 3:109412745-109412767 AGAAAAAGGGGGAGTTGGTCTGG + Intergenic
959747290 3:109791524-109791546 ATTAAAAAGGAGAGCTGCTCTGG - Intergenic
959912761 3:111782384-111782406 GTAAAAAAGGAGAGATGCTCTGG + Intronic
960134653 3:114093009-114093031 AATCAAAAGGAGAGGAGGTGAGG + Intergenic
960244722 3:115387479-115387501 TAAAAAAGGGAGAGTTGGCCGGG - Intergenic
960319989 3:116222706-116222728 AAAAAAAAGGAGAGGATGAAAGG - Intronic
960540390 3:118855127-118855149 AAAAAAAAAAAGAGGTGTACTGG + Intergenic
960588293 3:119341807-119341829 AAAAAAAGTGAGAGGATGTCTGG - Intronic
960589473 3:119351613-119351635 AAAAAAAAAGAGAGGTGGCCTGG + Intronic
960662263 3:120073395-120073417 AAAGAAAAGGATAGGAGCTCAGG + Intronic
961264963 3:125634417-125634439 AAAAAAAAAGGGAGGTGGGGAGG + Intergenic
961475822 3:127145657-127145679 AAAAAAAAGGAGAGATTGAAAGG - Intergenic
961732298 3:128974824-128974846 AAAAAAAAGAAGAGAAGGCCAGG + Intronic
961771245 3:129251679-129251701 AAAAAAAAAGAGAAGTGGCCGGG - Intronic
961802134 3:129459516-129459538 AAAAAAAAATAGATGTAGTCAGG - Intronic
962145035 3:132831897-132831919 AAAAAAAAAAAGAGTTTGTCTGG + Intergenic
962224649 3:133595846-133595868 TAAAAAAAGAAGAGGATGTCAGG - Intergenic
962388856 3:134955058-134955080 AAAAAAAAAGAAAGGATGTCAGG - Intronic
962709608 3:138074737-138074759 AAAAAAAAGGCAAGGTATTCAGG + Intronic
962856200 3:139347297-139347319 AGAAAAAAGGAGGGGTGCTCAGG - Intronic
962863089 3:139422810-139422832 AAATAAAAGGAGAGGGGGAGGGG - Intergenic
962947511 3:140185347-140185369 AGAAAAAAAGAAAGGTGGTTGGG - Intronic
963074347 3:141332512-141332534 AACATAAAGGAGAGGTGGCCGGG - Intronic
963244083 3:143044275-143044297 AAAAAAAAGGAGAGGGGAGAGGG - Intronic
963325752 3:143861189-143861211 AAAAAAGAGGAGAGGAATTCTGG - Intergenic
963367359 3:144353468-144353490 AAAGAAAAGGACAGGAGGGCAGG - Intergenic
963677185 3:148327204-148327226 AAGAAAAACTAGAGGAGGTCAGG - Intergenic
963718918 3:148837490-148837512 AAAAAAAAGGAGAAGTTGGATGG + Intronic
964029328 3:152118380-152118402 AAAAAAAAGGAAAATTGGCCAGG - Intergenic
964881241 3:161425834-161425856 AAAAAGAAGAAGAGGAGGTGAGG + Intergenic
964974626 3:162603934-162603956 AAAAAAAAAGAATAGTGGTCGGG - Intergenic
965448815 3:168810972-168810994 AAAAAAAAGAAGCAGTGGACTGG - Intergenic
965508323 3:169540569-169540591 AAAAAAGAGGAGAGATAGGCAGG - Intronic
965661294 3:171044868-171044890 AAAAAATAGTAGAGGTCGCCTGG - Intergenic
965730583 3:171767943-171767965 AAAAAAAAAGAGAGGGGGGCTGG + Intronic
966830858 3:184007314-184007336 AAAAATAAGCAGAAGTGGGCCGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966926519 3:184647981-184648003 AAAAAAAAAAAAAGGTGGTGAGG - Intronic
966963833 3:184969414-184969436 AAAAAAAAGGGGGGGGGGTGGGG - Intronic
966982091 3:185146630-185146652 AAAAATAAGGAGTGGTAGTTTGG - Intronic
967104575 3:186245013-186245035 AAAAAAAAGTGGAGGGGGGCGGG + Intronic
967815598 3:193795847-193795869 AAAAAAAAAAAGAGGGGGTCAGG - Intergenic
967938901 3:194750978-194751000 AAAAAAAAGGGAAGGAGGCCAGG + Intergenic
967987625 3:195107176-195107198 CAAAAAGAAGAGAGGTGGCCGGG + Intronic
968006005 3:195243360-195243382 AAAAAAAAAAAGAGATGGTTCGG + Intronic
968171446 3:196513333-196513355 AAAAAAAAAGAAAGTTGGCCGGG + Intronic
968207927 3:196821134-196821156 TAAAAAAAAGAGAAGTGGCCAGG - Intronic
968219595 3:196926630-196926652 AAAAAAAAAAAAAGGTGGACTGG - Intronic
968255650 3:197268097-197268119 AAAAAACAGGAGAGGTGAGGAGG + Intronic
969294192 4:6259799-6259821 AAAAAAAAAAAGAGTGGGTCAGG + Intergenic
969416785 4:7065845-7065867 AAAAAAAAAAAGAGGTCCTCTGG - Intronic
970023832 4:11599302-11599324 AAAAAAAATGAGAGGAGAGCTGG + Intergenic
970158478 4:13165516-13165538 AAAAGAAAGGAGAGGAGGAAAGG + Intergenic
970652887 4:18197947-18197969 AAGAGAATGGAGAGGGGGTCAGG - Intergenic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
971018642 4:22513127-22513149 AAAAAAGAGGAAAGTTGTTCTGG - Intronic
971120532 4:23699550-23699572 AAAAAAAAGGAGATTAGGTAGGG + Intergenic
971403547 4:26299112-26299134 AAAATAAAGGAGTTGGGGTCAGG + Intronic
971875610 4:32304425-32304447 AAAAAAAAACAGTGGTTGTCAGG - Intergenic
971935651 4:33143895-33143917 AAAAAAAAAGAGGGGCGGTTTGG - Intergenic
972023930 4:34352690-34352712 AAAAAAAAAAAAAGATGGTCTGG - Intergenic
972153668 4:36129237-36129259 AAATAAAAGGAGCAGTGGTTAGG + Intronic
972634214 4:40869014-40869036 AAAAAAATAGAAAGGTGGTGTGG - Intronic
972764443 4:42139437-42139459 AAAAAAAAGAAGTTGTGGGCAGG - Intronic
973070514 4:45852346-45852368 GAAAAAAATCAGAGATGGTCTGG - Intergenic
973307309 4:48667422-48667444 AAAAAAAAAGCGAGGGGGTGGGG - Intronic
973334024 4:48937771-48937793 AAAAAAACTAAGAGGTGGCCGGG - Intergenic
973388073 4:49528572-49528594 AAAAAAAAGGAGGGGAGGAAAGG - Intergenic
973808335 4:54546757-54546779 AAAAAAAGGGAGAGTTGTCCAGG + Intergenic
973844045 4:54892786-54892808 TAAGACAAGGAGATGTGGTCAGG - Intergenic
974059863 4:57022342-57022364 AAAAAAAGGGAGAGGAGGACAGG - Intronic
974232293 4:59132579-59132601 AAAAAGAGGGTGAGGTGGCCGGG - Intergenic
974332918 4:60503773-60503795 AAAAAAAAAGAGATTGGGTCTGG - Intergenic
974455196 4:62121578-62121600 AAAAGCAAGGATTGGTGGTCAGG + Intergenic
974463432 4:62220873-62220895 AAAAAAGTGGAGGGGGGGTCGGG - Intergenic
974763683 4:66311917-66311939 AAAAAATAAGAGAGCTGGCCAGG + Intergenic
974873335 4:67671978-67672000 AAAAAAAAGGTGGGGTGGGGTGG - Intronic
975371990 4:73599753-73599775 AGCAAAGAGGAGAGATGGTCAGG - Intronic
975559011 4:75692300-75692322 AAAAGAACTGACAGGTGGTCTGG - Intronic
975704832 4:77101407-77101429 AAAAAAAAAGAGAGAGGGCCAGG - Intergenic
975940277 4:79635659-79635681 AAAAAAAAAAAGAGGGGGTGGGG - Intergenic
976048033 4:80976328-80976350 AACATAAAGGAGAGCTGTTCCGG - Intergenic
976156031 4:82145512-82145534 AAAAAAAAACAGATGTGGGCCGG - Intergenic
976294125 4:83452660-83452682 AAAAAACAGGAGTGGTTGTAAGG + Intronic
976619756 4:87115598-87115620 AAAAAAAAAAAGAGGTGGGTTGG - Intronic
976944466 4:90747485-90747507 AAAAAAAAAGAGAGGTGGAGGGG + Intronic
976990350 4:91357873-91357895 AAAAAAAAGGGGGGGGGGGCAGG - Intronic
977221304 4:94340637-94340659 AAAAAAAAAGGGAGGGGGGCGGG - Intronic
977489416 4:97693142-97693164 AAAAAAAAAGAAAGGTATTCAGG + Intronic
977590579 4:98821930-98821952 AAAATAAAGCAGAGGTGATTTGG + Intergenic
978237937 4:106482617-106482639 AAAAAAAAGGAGAGAGGAGCGGG - Intergenic
978361414 4:107934159-107934181 AAAAAAAAGAAGTGTTGGTGAGG - Intronic
978485357 4:109247345-109247367 AAAAAAAAGGAAAGGAGGGAGGG + Intronic
978766540 4:112411092-112411114 AAATAAAAGGATAGGCGTTCTGG + Intronic
978774973 4:112496670-112496692 AAAAAGAAGAAGAGCTGGTTGGG - Intergenic
978805887 4:112799812-112799834 AAAAAAAAAAAGAGGTGGGCTGG - Intergenic
979216388 4:118169801-118169823 AAAAAAAAAGAGAGCTGAACTGG + Intronic
979831557 4:125311673-125311695 AAAAAAAAGGAGAGGGAGAGAGG + Intergenic
979933023 4:126655931-126655953 AAAAAAAAGAACAGGAGGCCAGG - Intergenic
979986514 4:127322759-127322781 AAAAGAAAGGAGAGGAGGAAGGG - Intergenic
981269302 4:142825790-142825812 AAAAAATAGGAGATGTGTTTGGG + Intronic
981642452 4:146960258-146960280 TAAAAAAAGGAGAAGTGATTTGG - Intergenic
981706543 4:147665133-147665155 AAAAAAAAAAAGATGTTGTCTGG + Intronic
981736925 4:147962954-147962976 AAATGAAAGGAGTGGTGGCCAGG - Intronic
981922788 4:150104225-150104247 AAATAAAAGAAGTTGTGGTCAGG + Intronic
982508475 4:156250658-156250680 AAAAAAAAAAAAAGGTGGTCAGG - Intergenic
982561810 4:156937404-156937426 TAAAAATAAGAAAGGTGGTCAGG + Intronic
982634652 4:157879109-157879131 AAAAAAAAAGAGGGGGGGCCAGG - Intergenic
983306102 4:165989277-165989299 AAAAATATGGAAACGTGGTCTGG - Intronic
983513391 4:168632172-168632194 AAAAAAAGGGTGAGGTGGGTAGG - Intronic
983575286 4:169254909-169254931 AGATAAAAAGAGAGGAGGTCAGG + Intronic
983926383 4:173407214-173407236 AAAAAAAAATAGAGGTGCTGGGG + Intergenic
984249254 4:177311688-177311710 AAAAAAAAGCTGAGGTGTGCAGG + Intronic
985011724 4:185589126-185589148 AAAAAAGACGAGAGGTCTTCTGG - Intronic
985179336 4:187239571-187239593 AAAAAAAAGGAAAGGAAGGCAGG - Intergenic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985513764 5:326762-326784 AAAAAAAATGATAGCTGGCCCGG + Intronic
985626335 5:990567-990589 AAAAAAAAGATGACTTGGTCTGG + Intergenic
986963902 5:13247084-13247106 GAAAAAAAGGAGAGTTGGCTAGG + Intergenic
987052465 5:14159160-14159182 AAAAAAAGGGAGAGGGGGAGTGG - Intronic
987129046 5:14843469-14843491 ATAAAAAATGAGAGCTGGCCAGG - Intronic
987537128 5:19203965-19203987 AAATAAAAGGAGAGATGATGTGG + Intergenic
987679929 5:21122000-21122022 AGATAAAAGGAGTGATGGTCTGG + Intergenic
987683897 5:21171802-21171824 AAAAACAGGGAGAGGAGGGCAGG + Intergenic
987941822 5:24548469-24548491 AAAAAAAAAAAGAGGAGGACTGG - Intronic
988279638 5:29128195-29128217 AAAAAAAAAGAAAGGAGGCCGGG + Intergenic
988626403 5:32879881-32879903 AAAAAAAAAGAGACGGAGTCTGG + Intergenic
988673756 5:33409905-33409927 GAAAAAAAGGAGGGGTGTTGGGG + Intergenic
989047684 5:37288761-37288783 AAAAAAAAGTAGGGGGGGTGGGG + Exonic
989053502 5:37344497-37344519 AAAAAAAAAAAAAGGTGGCCAGG + Intronic
989099610 5:37811733-37811755 AAAAAAAAAGGGAGGAGGACAGG - Intergenic
989280170 5:39632010-39632032 AAAAAAAAGTACAGGTGCTTTGG + Intergenic
989642553 5:43597223-43597245 AAAAAAAAGGCCAGGTGCTGTGG - Intergenic
989722652 5:44547959-44547981 AAAAAAAAAGAAAGGTGGCTGGG - Intergenic
990355068 5:54959008-54959030 AAAAAAAAGTAGGGTTGATCAGG + Intergenic
990769683 5:59228982-59229004 AAAAAAAAGGTTAGGAGGTTAGG - Intronic
990871384 5:60434424-60434446 AAAAAAAAAGAGACATGTTCTGG - Intronic
990981483 5:61606147-61606169 AAAAAAAAGGATAAGTGCTAAGG - Intergenic
991052204 5:62285291-62285313 GAAAAAAAGGAGAGATGACCAGG - Intergenic
991087628 5:62662663-62662685 AAAAAAAAAGAGAAGTTGCCAGG + Intergenic
991276414 5:64852766-64852788 AAAAAAAAAAAAAGGTGGCCGGG - Intronic
991457364 5:66818750-66818772 AGGAAAAAGGGGAGGTGTTCAGG + Intronic
991902768 5:71476997-71477019 AAAAAAAAGGTGGGGGGGCCGGG - Intronic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
991972967 5:72158451-72158473 AAGAAAGAGGAGAGGTGTTTGGG + Intronic
992005977 5:72477874-72477896 AAAAAAAAAAAGTGGTGGGCTGG + Intronic
992408247 5:76479979-76480001 AGAACAAAGGAGAAGTTGTCAGG + Intronic
992468708 5:77032270-77032292 AAAAACAGGGAGAGGTGGCTGGG + Intronic
992576311 5:78117163-78117185 AAAAAAAAAAAAAGGTGGTGGGG - Intronic
992743753 5:79798827-79798849 AATGAAAAGGAGAGTTGGTTTGG + Intronic
993572414 5:89557829-89557851 AAATAAAAGTAGAGGTGGTTTGG - Intergenic
993903504 5:93599701-93599723 AGACAAAAGGAGAGGAGGCCTGG - Intergenic
993923229 5:93832744-93832766 AAAAAAAAGTAGAATTGGACAGG - Intronic
994017349 5:94982901-94982923 AAAAAAAAAAAAAGATGGTCAGG + Intronic
994364753 5:98900296-98900318 AAGAAAAAAGAAATGTGGTCAGG + Intronic
994748836 5:103713115-103713137 AAAAAAAAAAAAAGGTGCTCTGG - Intergenic
995391345 5:111643299-111643321 ATAAAAAAGGAGAAGTGGATTGG + Intergenic
995933882 5:117485133-117485155 AAAAAAAATCAGAGTTGGTTGGG + Intergenic
996305399 5:122040682-122040704 ATGATAAAGGAGAGGTTGTCAGG + Intronic
996578640 5:125005221-125005243 AAAAAAAAGGCGGGGTGGGGGGG + Intergenic
996703949 5:126478147-126478169 AAAAAAAAAAAAAGGAGGTCAGG + Intronic
996997023 5:129709939-129709961 AAAATAGAGGACAGATGGTCAGG - Intronic
997009751 5:129862233-129862255 AAAAGAAAATAGAGGTAGTCAGG + Intergenic
997290264 5:132727405-132727427 GGGAAAAAGGAGAGGGGGTCAGG + Intronic
997547265 5:134719393-134719415 AAAAAAAAGAAGAAGTTGGCTGG + Intronic
997823991 5:137090333-137090355 ACAACAAAAGAGAGGTGTTCTGG - Intronic
998002259 5:138634563-138634585 AAAAAAAAGGAAAGGGGGTGGGG + Intronic
998126387 5:139625426-139625448 AAAAAAAAGGGGGGGGGGTGGGG - Intronic
998215462 5:140235394-140235416 AAAAAAAAGGAAAGTTTTTCTGG - Intronic
998364176 5:141618445-141618467 AAAAAAGAGGAGGCGTGTTCGGG + Intronic
998521882 5:142808426-142808448 AAAAAAGAGGAGAGGAGGAAAGG - Intronic
998791652 5:145772181-145772203 AAAAAAAAGGGGAGATGGGAGGG - Intronic
998961015 5:147487091-147487113 AGAAAAAAGGAGAGGTGGCAAGG - Intronic
998984869 5:147745068-147745090 AAAAAAAAGGAAATAAGGTCTGG + Intronic
999159482 5:149483559-149483581 AGAAAAAAGGAAAGTTGGGCTGG + Intergenic
999161042 5:149499298-149499320 AAAAAAAAGGGGAGGGGGAGGGG + Intronic
999299464 5:150482201-150482223 AGAAAACTGGAGAGCTGGTCAGG - Intergenic
999387904 5:151168288-151168310 AAAAAAAAAGGCAGGTGATCGGG + Intergenic
999577704 5:152998130-152998152 AAAAAAAAAGAGAGGAGGGGAGG - Intergenic
999602486 5:153282540-153282562 TAAAAAAAGGGGAGGGGATCTGG + Intergenic
999726847 5:154445319-154445341 AAAGAAAAGGAGAGGGGGAAAGG - Intergenic
999769335 5:154763470-154763492 AAAAAAAAACAGAGGTGGCAAGG - Intronic
999775820 5:154812511-154812533 AAAAAAAAGGGGGGGTGGGGGGG - Intronic
999985087 5:156995903-156995925 AAAAAAAAGAAGAAGAGGCCAGG + Intergenic
1000080395 5:157839927-157839949 AAAAGAAAAAAGAGGAGGTCGGG + Intronic
1000795383 5:165658086-165658108 AAAAAAAAGAAGAGATAGGCTGG + Intergenic
1000828331 5:166073772-166073794 AAAAAAAAATAGAGGTGATAAGG + Intergenic
1000869097 5:166553013-166553035 AAAAAAAAGAAGTTGTGGCCAGG - Intergenic
1000932190 5:167265030-167265052 AAAGGAAAGGAAAGGTGGCCGGG + Intergenic
1000964159 5:167635366-167635388 AAGAAAAAAGAAAGGTGGGCAGG - Intronic
1000994453 5:167944854-167944876 AAAAAGCAGAAGAGGTGATCAGG + Intronic
1001059966 5:168479812-168479834 AAAAAAAAGGAGGGGGGGATTGG - Intergenic
1001165427 5:169361337-169361359 GAAAAAAAGGGGAGGGGGGCAGG + Intergenic
1001319774 5:170670917-170670939 AAAAAAAAGAAGAGGACATCTGG + Intronic
1001426237 5:171624437-171624459 AAAAAAAAGCAGACGTTGACAGG + Intergenic
1001507471 5:172291263-172291285 AAAAAAAAAAAAAGGTGGGCGGG - Intergenic
1001592495 5:172875110-172875132 AAGAAAAAGCAGAGGAGGTATGG - Intronic
1001597798 5:172909155-172909177 AAAAAAAAAGAGGGGAGGGCTGG - Intronic
1001727687 5:173920554-173920576 AAATAAAAGGAGAAGTGTTCAGG + Intronic
1001739224 5:174035950-174035972 AAAAAAAAGGAAGGGTAGGCAGG - Intergenic
1001825795 5:174743931-174743953 AAAAAAAAAAAAAGGAGGTCAGG + Intergenic
1002095780 5:176829867-176829889 AAAAAAAAGGAGCAGTGATGTGG - Intronic
1002208002 5:177577453-177577475 AAAAAAAAGTACATGTGGCCAGG - Intergenic
1002387645 5:178880491-178880513 AAAAAAAAAAAGAGGAGGCCGGG - Intronic
1002517563 5:179770910-179770932 TAAAAAATGGAGAGCTGGTTAGG - Intronic
1002638582 5:180619904-180619926 GAAGACAAGGAGAGGTGGACAGG + Intronic
1003136864 6:3440716-3440738 AAAAAAAAGAAGAGGAGATGAGG + Intronic
1003222713 6:4175801-4175823 AAAAAAAAGGAAAACTGGCCAGG + Intergenic
1003361657 6:5432559-5432581 AAAAAAAGGGAAAGTTGGTTTGG + Intronic
1003364139 6:5456738-5456760 AAAAAAAAAAAGAGATGGGCAGG + Intronic
1003534344 6:6963138-6963160 AAAAAAAAGCAGAAATGGTGGGG - Intergenic
1003537218 6:6985791-6985813 AAAAAAAAAAAAAGGTGGCCAGG + Intergenic
1003944742 6:11064364-11064386 AAAAAAAAGGAGTGGGGGCTGGG + Intergenic
1004040233 6:11967940-11967962 AAAGAAAGGAAGAGGTGGCCAGG - Intergenic
1004168856 6:13280255-13280277 AGAAGAAAGGAGAGGTGAGCAGG - Intronic
1004626648 6:17383560-17383582 AAAAAAAAAGAGTGATGGGCAGG - Intergenic
1004631123 6:17422332-17422354 AAAAAAAAGCATAGTTGGTTAGG - Intronic
1005150597 6:22745088-22745110 AAAAAAAATGAGTGTTGGTTAGG + Intergenic
1005264808 6:24100689-24100711 ACATAAAAGGAGAGGGGGTAGGG - Intergenic
1005352962 6:24954442-24954464 AAAAAAAAGGAGAGAGAGACTGG - Intronic
1005487836 6:26318218-26318240 AAAAAAAATGACAAGTGGGCAGG + Intergenic
1005732662 6:28713689-28713711 AAAAAAAAAAAGAGGGGGGCCGG - Intergenic
1005801417 6:29428775-29428797 AAAAAAAAAAAGAGTTGGCCAGG + Intronic
1005876621 6:30015417-30015439 AAAAATAAGGAATGCTGGTCAGG + Intergenic
1006070770 6:31496660-31496682 AAAAAAAAGGAAAAAGGGTCCGG - Intronic
1006138172 6:31909592-31909614 AAAAAAAAAAAGAGGTGGGCGGG - Intronic
1006142975 6:31942110-31942132 AAAAAAAAGAAGAGGTGAGCCGG - Intronic
1006177403 6:32130725-32130747 AAAAAAAAAAAAAGGTGGGCCGG + Intergenic
1006549988 6:34814309-34814331 AAAAAAAATAAAAGATGGTCGGG - Intronic
1006577044 6:35054060-35054082 AACAAAGAGGAGAGGCAGTCAGG - Intronic
1007000931 6:38311845-38311867 ATAAAAAAGAAAAGGTGCTCAGG - Intronic
1007026166 6:38576994-38577016 AAATAAAAGCAGAGGTGCTCTGG + Intronic
1007125669 6:39423647-39423669 GAAAAACAGGGGAGGTGTTCAGG - Intronic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007388312 6:41534409-41534431 AAAGAAAAAGAGAAGGGGTCTGG + Intergenic
1007410688 6:41659531-41659553 AACAAAAAGGGCAGGTGGGCTGG + Intergenic
1007415017 6:41686495-41686517 AAAAAAAAAGAAAGGTAGGCTGG - Intronic
1007478701 6:42136167-42136189 AAAAAAAAAGAAAGTTGGTAAGG + Intronic
1007956152 6:45919491-45919513 AGAAGAAAGGAGAGGTGGTGGGG - Intronic
1008169011 6:48179532-48179554 AAAAAAAATCAGTGGTTGTCAGG + Intergenic
1008497977 6:52152238-52152260 AAAGAAAAGGAGAGGAGGGGAGG + Intergenic
1008550510 6:52625102-52625124 AAAAAAAAGGGGGGGTGGGTGGG + Intergenic
1008698312 6:54068133-54068155 AAAAGAAAGGAGAGGAGGGGAGG - Intronic
1009712600 6:67345271-67345293 TAAAAAAAGGAGGGCTGGTCTGG + Intergenic
1010050799 6:71501959-71501981 CAAAAAATGGAGAGTTAGTCAGG - Intergenic
1010385342 6:75273492-75273514 AAAAAAAAGTATAGGTGGTATGG + Intronic
1010509139 6:76696198-76696220 AACAAGGAGGAGAGGTGTTCTGG + Intergenic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1010797279 6:80131973-80131995 AAATAAAAGCAGATGAGGTCAGG - Intronic
1010928599 6:81773258-81773280 AAAAAACAGGCTGGGTGGTCTGG - Intergenic
1011136110 6:84102812-84102834 AAAAATAATGTGAGGTGGGCAGG + Intergenic
1011270347 6:85572381-85572403 AAGGAAAATGAGAGGTGGTGGGG + Intronic
1011321021 6:86093779-86093801 AAAAAAAAAGAAAGGTATTCAGG - Intergenic
1011486170 6:87844343-87844365 AAAAAAAAGAAAAGCTGGACGGG - Intergenic
1011632284 6:89339442-89339464 AAAAAAGAGGAGAGGAGGGGAGG + Intronic
1011772852 6:90694111-90694133 AAAAAAAAAGACAGGGGTTCTGG + Intergenic
1011813348 6:91158766-91158788 AAAAACAAGGGGAGGAGGTCAGG - Intergenic
1011918716 6:92544194-92544216 AAAAAAAAAAAGAAGTGATCAGG - Intergenic
1011960456 6:93082354-93082376 AAAAGAATGGAAAGGTGGACAGG - Intergenic
1012026316 6:93997030-93997052 AAAGAAAAGTAGAGGTCATCAGG - Intergenic
1012250408 6:96974015-96974037 AAAAAAAAAGAGAAGAAGTCAGG - Intronic
1012296231 6:97528103-97528125 GAAAAAAAGGTGGGGTGGGCAGG - Intergenic
1012769364 6:103409655-103409677 AAAAGAAAGGAGAGGAGATATGG + Intergenic
1013036650 6:106391556-106391578 AAAAAAAAAGACTGATGGTCTGG - Intergenic
1013264636 6:108483663-108483685 AAAAATAATGACAGGTGGCCAGG + Intronic
1013345785 6:109259399-109259421 AAAAAAAAAAAAAGGTGGTGGGG - Intergenic
1013486323 6:110599665-110599687 AAAAAAAAAAAGAGGTGATTAGG + Intergenic
1013489886 6:110635831-110635853 AAAGAAAAGGATAGTTGGGCTGG - Intronic
1013528128 6:110994282-110994304 AAAAAAAAAAAGAGTTGGTTAGG + Intronic
1013603783 6:111729475-111729497 AAAAAAAAAAAAAGGGGGTCGGG + Intronic
1013767735 6:113594276-113594298 AAAAAAAACGAGAGAGGGACTGG - Intergenic
1013896592 6:115096226-115096248 AGAGAAAAGGAGATGTGGGCTGG + Intergenic
1014110334 6:117613488-117613510 AAAAAAATGGTGGTGTGGTCGGG + Intergenic
1014571214 6:123010480-123010502 AAAGAAAAGGAAAGGTGGTAGGG - Intronic
1014585635 6:123194572-123194594 AAAAACAAGGAGATGTGGAAAGG - Intergenic
1014767116 6:125419457-125419479 AAAAAATAAAAGAGGTGGTAAGG + Intergenic
1014867265 6:126547922-126547944 AAAGAAAAGGTGTGGTGGTCAGG + Intergenic
1015161382 6:130156041-130156063 AAGAAAAAGGAAAGGAGGCCAGG + Intronic
1015210315 6:130689671-130689693 ACAAAAAATGAGAGGTAGTAGGG - Intergenic
1015304896 6:131696760-131696782 AAAAAAAAAAAAAGGTGCTCTGG - Intronic
1015401886 6:132796547-132796569 AAAAAAAAGGAAGGGGGGTCGGG + Intronic
1015589361 6:134807947-134807969 AAAAAAAAAAAAAGGTGGTATGG - Intergenic
1015652888 6:135482456-135482478 AAAAAAAAACAGTGGTGGGCTGG - Intronic
1015845866 6:137520080-137520102 CAAAAAAAGGAGAGTTGGGTGGG - Intergenic
1015889986 6:137960794-137960816 AAGAAAAAAGGGAGGTGGTGGGG + Intergenic
1016041184 6:139433211-139433233 AAAAAAAAAAAAAGGTGGCCAGG - Intergenic
1016072621 6:139758116-139758138 AAAAAAAAGCAAAGGTAGTTTGG - Intergenic
1016262288 6:142186639-142186661 AGAGGAAAGGAGAGGTGGTAGGG + Intronic
1016381880 6:143492416-143492438 AAAAAAAAGTAGTGGTGGAGAGG + Intergenic
1016460174 6:144273637-144273659 AAAAAAAAAAAGTGGGGGTCGGG + Intergenic
1016563334 6:145423100-145423122 AAGAAAAAGGAAAGGTGTTGAGG - Intergenic
1016806402 6:148216712-148216734 AAGAAAAAAGAGATGAGGTCAGG - Intergenic
1017136844 6:151154598-151154620 AAAAAAAAGAAGGAGTGGACAGG - Intergenic
1017238515 6:152141772-152141794 AAAAATAAGCAGAGGTAGGCTGG + Intronic
1017413152 6:154191207-154191229 AAAAAAGATGAGAGGTTGTCAGG + Intronic
1017503617 6:155047538-155047560 AGAAGAAAGAAGAGGTGGTGTGG - Intronic
1017718602 6:157229199-157229221 AGAAAACAAGAGAGTTGGTCAGG - Intergenic
1017972970 6:159329114-159329136 AAAAAAGAGGGGAGGTGGTGGGG + Intergenic
1018323361 6:162636959-162636981 AAAAAAAAAAAGATGTGGCCAGG + Intronic
1018325297 6:162661263-162661285 AAAAAAAAGAACAAGGGGTCAGG + Intronic
1018735980 6:166687513-166687535 AAGAAAAGGAAGAGGTGGTTTGG + Intronic
1018897070 6:168027155-168027177 AGAAAAAGGGAAAGGTGGCCGGG + Intronic
1019224389 6:170498334-170498356 AAAAAAAAAGAGGGGTAGTTTGG - Intergenic
1019680579 7:2346450-2346472 AAAAAAAAGGTGAGGCAGCCAGG + Intronic
1019795803 7:3047431-3047453 AGAAAAAAGGACAGGAGGTTGGG - Intergenic
1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG + Intronic
1020193610 7:6019726-6019748 AAAAAAAGGGAAATTTGGTCGGG + Intronic
1020233957 7:6341147-6341169 AAAAAAAATGAGTGCTGGCCAGG + Intronic
1020237370 7:6366744-6366766 AAAAAAAAGGATAGTTAGCCAGG + Intergenic
1020664349 7:11020672-11020694 AAAAAAAGAAAGAAGTGGTCAGG - Intronic
1021233716 7:18117255-18117277 ATAAAAAAGAAGAGAAGGTCAGG + Intronic
1021618181 7:22523905-22523927 AACAAATAGGAGAGGTGGGTGGG + Intronic
1021656635 7:22880226-22880248 GAAAATAAGGAGTGATGGTCAGG - Intergenic
1021657108 7:22883195-22883217 AGAAAATAGAAGAGGTGGCCAGG - Intergenic
1021961519 7:25877873-25877895 AAAAAAAAAGAGAGATGGGATGG - Intergenic
1022070790 7:26911913-26911935 AAAAAAAAAAAGAGGTTATCAGG - Intronic
1022142151 7:27501719-27501741 AAAAAAAAGAAGAATTGGTTAGG - Intergenic
1022294249 7:29034955-29034977 AAAAAAAATGAGAGCTGGTATGG - Intronic
1022308995 7:29177547-29177569 AAAAAAAAAGTGAGGGGGCCAGG - Intronic
1022454531 7:30546777-30546799 CAAAAAAATCAGAGGTGGTCTGG + Intronic
1022513216 7:30956289-30956311 ACAAAAGAGGAGAGGAGGTGAGG - Intronic
1022516436 7:30977647-30977669 AACAAAAAGGAGAGTTGGGGAGG + Intronic
1022694599 7:32691869-32691891 AACAAACAGGAGAGGTGGGTGGG + Intergenic
1022927779 7:35073380-35073402 AACAAATAGGAGAGGTGGGTGGG + Intergenic
1022970976 7:35517091-35517113 AGATAAAAGTAGAGGTGCTCTGG + Intergenic
1023104754 7:36752665-36752687 AAAAAAAAAAAGAGGTGATTAGG - Intergenic
1023147081 7:37162000-37162022 AAAAAAAAGGGGAGGAGGGAAGG + Intronic
1023316250 7:38940394-38940416 AAAAAAAAGGAGGGGAGGGAGGG + Intergenic
1023624281 7:42100741-42100763 AAGAAAAAGAAGAGGGGGTGGGG + Intronic
1023815486 7:43946415-43946437 AAAAAAAAGGCGGGGGGGCCAGG - Intronic
1023821985 7:43985633-43985655 AAAAAAAAGGGGGGGGTGTCAGG - Intergenic
1023957252 7:44896345-44896367 TAAAAAAAGGAGGGATGGCCGGG + Intergenic
1023977290 7:45040105-45040127 AAAAAAAAGGCCAGGTGCTGTGG + Intronic
1024239958 7:47427137-47427159 AAAAAAAAACAGAAGTGCTCAGG + Intronic
1024244670 7:47460230-47460252 AAAAAAAAGAAGAGGAGATTAGG + Intronic
1024274618 7:47667734-47667756 AAAGAAAAGGTGAGTTGGCCAGG + Intergenic
1024755507 7:52525348-52525370 AAAAAAAAGGAGAGATTCTGGGG + Intergenic
1025152747 7:56573027-56573049 AAAAAAAAAAAGAGCTGGTGTGG - Intergenic
1025169156 7:56740718-56740740 AAAAAAAAAAAGTGGTGGTAGGG - Intergenic
1025948472 7:66123755-66123777 AAAAAAAAGGTGGGGGGGCCGGG + Intronic
1026432984 7:70366771-70366793 ACAAAAGAGGAGAGGAGGTAAGG + Intronic
1026523637 7:71136481-71136503 AAAAAAAAGAAGAGGAAGCCAGG - Intronic
1026585303 7:71651234-71651256 AAAAAAAAGGAAGGGAGGTGGGG + Intronic
1026781477 7:73270724-73270746 AAAAAAAAGAACTGGTGGCCAGG + Intergenic
1026802224 7:73407513-73407535 AAGAAAAAGGAAAGGAGGCCGGG + Intergenic
1026856263 7:73757168-73757190 AAAAAAAAGAAGAGAGGGCCGGG + Intergenic
1026868677 7:73837838-73837860 AAAAAAAAGGGGGGGTGGGCAGG - Intronic
1026917781 7:74132535-74132557 AAAAAAAAGGAAGGGAGGGCGGG - Intergenic
1026927069 7:74201813-74201835 AAAAAAAAGTAGAGCCGGCCGGG - Intronic
1027022333 7:74824171-74824193 AAAAAAAAGAACTGGTGGCCAGG + Intronic
1027045513 7:74988590-74988612 AAAAAAAAGGAGCGTGGGCCGGG - Intronic
1027065684 7:75121752-75121774 AAAAAAAAGAACTGGTGGCCAGG - Intronic
1027127282 7:75565723-75565745 AAAAAAAAGGAAAGGAGGGGAGG - Intronic
1027222240 7:76221348-76221370 AAAAAAAAAAAGAGGAGGGCAGG - Intronic
1027282055 7:76615982-76616004 AAAAAAAAGGGGGGGGGGGCAGG + Intronic
1027415999 7:77975491-77975513 AAAAAAAAAAAGACGTGGTTTGG + Intergenic
1027698763 7:81442762-81442784 AAAAAAAAAAAGAAGTGCTCTGG - Intergenic
1027788791 7:82613661-82613683 AAAAAAATGGTGAGGTGGGGAGG + Intergenic
1027847164 7:83395251-83395273 AAAAAAAAGCATAGCTGCTCCGG + Intronic
1028068408 7:86417583-86417605 AAAAAAATAGAGAAGTGGCCAGG - Intergenic
1028173175 7:87623891-87623913 AGAAAAAAAGAGTGGTGGTATGG - Intronic
1028368833 7:90067792-90067814 AAAAAAAAGGAAATGTACTCTGG + Intergenic
1028374498 7:90132204-90132226 AACAAATAGGAGAGGTGGGTGGG - Intergenic
1029210817 7:98907026-98907048 AAAAAAAAGTAGTTGTGGCCAGG + Intronic
1029304601 7:99609727-99609749 AAAAAAAAGAACAAGTGGCCGGG - Intergenic
1029356487 7:100055936-100055958 AAAAAAAAAAAGAGGAGGGCCGG - Intronic
1029376350 7:100179129-100179151 AAAAAAAAGGCAAGGTGCCCAGG - Intronic
1029415496 7:100440623-100440645 AAAAAAATGGGGAGGAGGACAGG + Intergenic
1029435345 7:100561112-100561134 AAAAAAAGGGAGATCTGGCCAGG - Intronic
1029574986 7:101397529-101397551 AAAAAAAAGGAGGGGGGGGGAGG - Intronic
1029590980 7:101506914-101506936 AAAAAAAAGGAGTGGTTCTAGGG - Intronic
1029675767 7:102067529-102067551 AAAAAAATAGAGTTGTGGTCAGG - Intronic
1029750247 7:102539047-102539069 AAAAAAAAGGGGGGGGTGTCAGG - Intronic
1029768198 7:102638155-102638177 AAAAAAAAGGGGGGGGTGTCAGG - Intronic
1030021607 7:105280649-105280671 AAAAAAAAGGGGGGGGGGGCCGG + Intronic
1030283637 7:107802527-107802549 AAAAAAAAAGGGAGGGGGTAGGG - Intronic
1030349913 7:108472955-108472977 AAAAAAAAGGAAAGTTGGAAAGG - Intronic
1030415836 7:109241375-109241397 AAAAAAAAAAAGAGCTGGCCGGG - Intergenic
1030480742 7:110100826-110100848 AAAAAAAAATAGAGGTTGGCAGG + Intergenic
1031048546 7:116921384-116921406 AAAAAAAAAAAGTGGTGGGCTGG + Exonic
1031871980 7:127097396-127097418 AAAAGAGAGGGGAGGTGGTCAGG + Intronic
1031944519 7:127825402-127825424 AAAAAAAAAAAAAGGTGGCCAGG - Intronic
1032259454 7:130323207-130323229 AAAAAACAGGAGAGGAGGGAGGG - Exonic
1032330207 7:130971629-130971651 AAAAAAAAAAAAAGGTGGTGGGG + Intergenic
1032404555 7:131646649-131646671 AAAAAAAAGGAAAGGAATTCTGG - Intergenic
1032699276 7:134364535-134364557 AAAGGGAAGGAGAGGTGTTCTGG - Intergenic
1033017337 7:137685161-137685183 AAAGGAAAGGAAAGGTGGTTCGG + Intronic
1033075734 7:138248697-138248719 GAAAAAAAGAAGAGGAGGGCTGG + Intergenic
1033198049 7:139343936-139343958 AAAAAAAAAAAGAGTTGGTGGGG + Intronic
1033373685 7:140736421-140736443 AAAAAAAAAAAGTGGTGTTCAGG - Intronic
1033444782 7:141410698-141410720 AAAAAAGAGGTGAGGAGGTTTGG - Intronic
1034121415 7:148631449-148631471 AGAAAAAAGAAGAGGGGGCCAGG + Intergenic
1034161740 7:148998909-148998931 AAAAAAAAATAGAGGTGGAACGG - Intergenic
1034378446 7:150667180-150667202 AACAAAATGGAGAGGTGCTGTGG + Intergenic
1034604698 7:152301207-152301229 AAAAAAAAGAAAAGTTGGCCGGG + Intronic
1034915733 7:155037333-155037355 AAAAAAAAAGAGAAGTGGATTGG - Intergenic
1035090358 7:156305324-156305346 AATACAAAGGACAGGTGCTCAGG - Intergenic
1035528009 8:329106-329128 AGAAAATTGGAGAAGTGGTCTGG + Intergenic
1035884865 8:3280911-3280933 AAAAAAAAGAAGTGATGGCCAGG + Intronic
1036091426 8:5669767-5669789 AGGAAAAAGGAGAGGCTGTCAGG - Intergenic
1036655942 8:10677568-10677590 AAATAAAAAAAGAGGTGGTGTGG - Intronic
1037883509 8:22584604-22584626 AAAAGAAAGGACAGTTGGCCAGG - Intronic
1037942874 8:22966625-22966647 AAAAAAAAAGCGGGGTGGTGGGG + Intronic
1038077038 8:24087919-24087941 AAAAAAAAGGAGAGGAAGGTGGG - Intergenic
1038145185 8:24888646-24888668 AAAAAAAAAGAGAGAGGGCCAGG + Intergenic
1038476529 8:27872318-27872340 ACTAAAAAGGAGAGGTTGTCCGG - Intronic
1038873427 8:31520947-31520969 AAAAAAAAGGAGATACTGTCAGG - Intergenic
1039052614 8:33508632-33508654 AAAAAAAAGGGCAGGGGGGCAGG + Intronic
1039444931 8:37623399-37623421 AATAAAAAGAAGAGGTAGCCAGG + Intergenic
1039687161 8:39815998-39816020 AAAAAAATGTGGAGGAGGTCAGG + Intronic
1039934640 8:42031031-42031053 AAAAAAAAGGGGGGGGGGACAGG + Intronic
1040477716 8:47795179-47795201 AAAAAAAAAAAGAGTTGGCCAGG - Intronic
1041098993 8:54378013-54378035 AAAAGAAAAGAAAGGTGGTCGGG - Intergenic
1041331140 8:56726464-56726486 AGAAAAAAAGAGAGGTGACCTGG - Intergenic
1041439861 8:57882942-57882964 AAAAAAAAGGAAAGGAGGTTTGG - Intergenic
1041546491 8:59049625-59049647 GAAAAAATGGAGAGCTGGGCAGG - Intronic
1041548656 8:59076007-59076029 AAAAAAAAAAAAAGGGGGTCAGG + Intronic
1042003680 8:64156131-64156153 AAAAAAAAGGGGAGGGAATCTGG + Intergenic
1042277263 8:67018811-67018833 AAAAAAAAGGGGGGGGGGGCGGG - Intronic
1042388526 8:68204974-68204996 AAAAGAAAGCAGAGGGGGCCGGG - Intronic
1042865223 8:73350847-73350869 AAAAAAAAGTAGAGATGGCTGGG - Intergenic
1043579782 8:81698899-81698921 AAAAAAAAGGACAGGTGTGGTGG - Intergenic
1043739680 8:83795136-83795158 AAAAAAGATGAGTGGTTGTCAGG + Intergenic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1043917170 8:85936421-85936443 AAACAAAATGAGAGATGGACTGG + Intergenic
1043970412 8:86522534-86522556 AAAAAAAAGCAGCGGGCGTCAGG - Intronic
1044296123 8:90529607-90529629 AAAAAAAAGAAGAGGGGGTAGGG - Intergenic
1044682961 8:94800395-94800417 AAAAAAAAAAACAGGTGGTGGGG + Intergenic
1044783308 8:95766228-95766250 AAAAAAAATTAGTAGTGGTCAGG - Intergenic
1044993502 8:97817431-97817453 AAAAAAAAGTAAAGTTGGCCTGG - Intronic
1045000574 8:97874709-97874731 AAAAAAAAGTAGAAGAGGTCAGG - Intronic
1045390063 8:101706323-101706345 AAAAAAAGGGAGTGGTGGGGAGG + Intronic
1045448346 8:102291291-102291313 AAAAAAAAGGACAGCTGTGCAGG + Intronic
1045452667 8:102343855-102343877 AAAAAAAGGGGGGGGTGGGCAGG + Intronic
1045737379 8:105312632-105312654 ATAAAAAAGGAAAGGTGGGAAGG + Intronic
1045841241 8:106584306-106584328 AAAAAAAGAGAGGGGTGTTCGGG + Intronic
1046276684 8:111970899-111970921 AAAAAAAAAGATAAGTGGTTAGG + Intergenic
1046362889 8:113185309-113185331 AAAAAAAAGTTGAGGTGATGTGG + Intronic
1046405320 8:113765093-113765115 AAAAAAAAAGAGGCTTGGTCAGG + Intergenic
1046870457 8:119199922-119199944 AAAAAAAAGAAGAGGTAATAGGG + Intronic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1047046380 8:121057092-121057114 ATAAAAAAGAAGAGATTGTCAGG - Intergenic
1047147913 8:122226415-122226437 AAAAAAAAGTAGAGGGGGGAGGG - Intergenic
1047152605 8:122281502-122281524 AAAACCATGGAGAGGTGGTGTGG + Intergenic
1047317860 8:123750919-123750941 AAAAAAAAGAAAAGGAGGCCAGG - Intergenic
1047491674 8:125379938-125379960 ATATAAAAGCAGAGGTGGGCAGG + Intergenic
1047492731 8:125387816-125387838 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1047965087 8:130040528-130040550 AAAAAAAAAAAAAAGTGGTCTGG + Intergenic
1048235016 8:132681304-132681326 AAAAAAAAGGAATGGTTGGCTGG - Intergenic
1048369875 8:133768004-133768026 AAAGAGAGGGAGAGGTGATCAGG - Intergenic
1048389780 8:133951674-133951696 GAAAGAAAAAAGAGGTGGTCAGG - Intergenic
1049395827 8:142400042-142400064 AAAAAAAAAAAGAGGTGGCTGGG + Intronic
1049659793 8:143814843-143814865 GCAAAAAAGGAGAGGAGGTCTGG + Intronic
1050100340 9:2112465-2112487 AAAAAAAATGAGAGGCGGGGTGG - Intronic
1050175434 9:2865166-2865188 AAAAAATAACAGAGGTAGTCAGG + Intergenic
1050844567 9:10198335-10198357 GAAAAACAGGAGTAGTGGTCAGG + Intronic
1051115212 9:13686557-13686579 CAAAAAAAGGAGATATGGTTTGG - Intergenic
1051138021 9:13945611-13945633 AGAAACAAGGAGAAATGGTCAGG - Intergenic
1051534540 9:18142135-18142157 AAAAAGAAGGGGAAGAGGTCAGG - Intergenic
1051593537 9:18800397-18800419 AAAAAAAAGGAAAAATGGACAGG + Intronic
1051737416 9:20215629-20215651 AGAAAAAAGGAAAAGTGGTCTGG - Intergenic
1051777011 9:20645840-20645862 AAAAAAAAGGAAAATTGGTGAGG - Intergenic
1052051396 9:23852439-23852461 AAAAAAAAAAAAAGGTGGTGGGG - Intergenic
1052065227 9:24010210-24010232 AAAAAATCGGAGAGGGGCTCTGG - Intergenic
1052336760 9:27328200-27328222 AAAAAGAAGGAGAGTAGGACAGG + Exonic
1053023853 9:34714764-34714786 GAAAAAAAGGAGAGATGGCAGGG + Intergenic
1053046553 9:34924847-34924869 AAACAATAAGAGAGGTGGTAAGG - Intergenic
1053180961 9:35969879-35969901 AAAAAAAAGGGGGGGGGGCCAGG - Intergenic
1053530348 9:38874988-38875010 AAAAAAATGTAGGGGTGGCCAGG - Intergenic
1053587334 9:39473011-39473033 AAAAAAAACAAGTGTTGGTCAGG - Intergenic
1054202574 9:62099418-62099440 AAAAAAATGTAGGGGTGGCCAGG - Intergenic
1054578968 9:66892227-66892249 AAAAAAAACAAGTGTTGGTCAGG + Intronic
1054635788 9:67488947-67488969 AAAAAAATGTAGGGGTGGCCAGG + Intergenic
1054928698 9:70614327-70614349 AAAAAAAAGGCCAGGTGTTGTGG + Intronic
1055112194 9:72570982-72571004 ACAAAAATGGAGATTTGGTCGGG - Intronic
1055288572 9:74757575-74757597 AAAAAAAAGGAGGGGAGGGTAGG + Intronic
1055316153 9:75036414-75036436 AAAAAAAAAAAAAGGTGGGCTGG + Intergenic
1055601850 9:77927641-77927663 AAAAAAAAGTAGAAGTGGTATGG - Intronic
1055667089 9:78563631-78563653 AAAAAAAAGCTGAGGGGGTTAGG + Intergenic
1055674352 9:78640131-78640153 AAAAAAAAAAAAAGGTGGCCAGG + Intergenic
1056434715 9:86564711-86564733 CAAAAAAAAGAGAGTTGGTAAGG - Intergenic
1056436756 9:86581708-86581730 TAAAAAGAGGAGAGGTTGGCTGG - Intergenic
1056584402 9:87919063-87919085 AAAAACAGGAAGAGGGGGTCGGG - Intergenic
1056612465 9:88133844-88133866 AAAAACAGGAAGAGGGGGTCGGG + Intergenic
1056620963 9:88214255-88214277 AAAAAAAAGGAGATCTTGGCCGG - Intergenic
1056811625 9:89769474-89769496 AAAAAAAAGAATAGGAGGCCGGG - Intergenic
1057190100 9:93082610-93082632 AATAAAAAGGAAAGGGGGTCAGG - Intronic
1057237305 9:93372067-93372089 AGAAAAAAGGAGAGTTGGGCTGG + Intergenic
1057521841 9:95766439-95766461 GAACAAAAGGAAAGGTGGTGAGG + Intergenic
1057598125 9:96433892-96433914 AAAGAAAAGAAAAGCTGGTCAGG + Intergenic
1057688012 9:97253603-97253625 ATAAAAAAGGAGTAGTGGCCAGG - Intergenic
1057696609 9:97327262-97327284 ATAAAAAAGGAAAAGTGGGCAGG - Intronic
1057752346 9:97803185-97803207 AAGAAAAAGGAGAGGAGGAAAGG + Intergenic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1057927317 9:99164929-99164951 AAAAAATCAGAGAGGTGGTGGGG - Intergenic
1058082664 9:100716184-100716206 TAAAAAGAGAAGAGGTGGCCAGG - Intergenic
1058377151 9:104335974-104335996 AAGAAAACGGAGAGATTGTCAGG - Intergenic
1058597249 9:106628616-106628638 AGAAAACAGGACAGGTGGTGTGG + Intergenic
1058828151 9:108793367-108793389 CAAAAGAAAGAGAGGTGGTAGGG - Intergenic
1058852963 9:109030717-109030739 GAATAAAAGGAGAGGTGCTTCGG - Intronic
1059065528 9:111079449-111079471 AAAAAAAAGAAAAGCTGGTTAGG - Intergenic
1059560229 9:115327581-115327603 AAAAAGAATCAGAGCTGGTCTGG + Intronic
1059688284 9:116658720-116658742 AAAAAAAAAGAGCGGTGGTCAGG - Intronic
1059836638 9:118162056-118162078 AAAAAAAAATGGGGGTGGTCGGG + Intergenic
1060098401 9:120814482-120814504 AAATAAATGGAGAGGAGGTAGGG - Intergenic
1060627151 9:125124046-125124068 AAGCAAAAGGAGAGGTGCTTGGG - Intronic
1060828540 9:126699959-126699981 AAAGAGAATGAGAGGTGGGCAGG + Exonic
1060844652 9:126826440-126826462 AAAAAAAAGGCGGGGGGGCCAGG - Intronic
1060861622 9:126959582-126959604 AAAAAAAAAAAGAACTGGTCAGG - Intronic
1061006603 9:127931587-127931609 AAAATAAAGGTGATGTGATCAGG - Intergenic
1061105997 9:128530910-128530932 AAAAAAAAAAAAAGGTGGGCCGG + Intronic
1061132540 9:128716008-128716030 AAAAAAAAGGAGGGGGAGGCTGG + Intronic
1061154454 9:128849114-128849136 AAAAAAAAGGTGGGGAGGCCAGG + Intronic
1061317445 9:129805149-129805171 AAAAAAAGAGAGATGTAGTCAGG + Intronic
1061441519 9:130607265-130607287 AAAAAAAAGGAGGTCAGGTCAGG - Intronic
1061441520 9:130607270-130607292 AAAAAAAAAAAAAGGAGGTCAGG - Intronic
1061479439 9:130889662-130889684 AAAAAAAAAAAGTGGTGGGCCGG - Intergenic
1061484274 9:130912408-130912430 AAAAAAAAAGTGGGGTGGGCCGG + Intronic
1061557796 9:131382628-131382650 AAAAAAAAGGAATGGGGGCCTGG - Intergenic
1061871901 9:133525377-133525399 AAAAAAAAAGAGAGAAGGCCGGG - Intronic
1061944878 9:133903086-133903108 AAAAAAAAAAAGAGGTAGTTTGG + Intronic
1062189158 9:135238505-135238527 AAAAAAAGGGAGAGGGGGCAAGG - Intergenic
1062376649 9:136264747-136264769 AAAAAAAAGGTGAGCTGGGGTGG - Intergenic
1062416337 9:136452468-136452490 AAAAAAAAAAAGAGATGGCCAGG + Intronic
1203696637 Un_GL000214v1:104512-104534 AAAAAAAAGGAGGGGAGGAAAGG + Intergenic
1203496371 Un_GL000224v1:155294-155316 AAAACACAGGAGGGGTGTTCTGG + Intergenic
1203508993 Un_KI270741v1:97216-97238 AAAACACAGGAGGGGTGTTCTGG + Intergenic
1203552580 Un_KI270743v1:176516-176538 AAAAAAAAGGAGGGGAGGAAAGG - Intergenic
1185470871 X:382172-382194 AAAAAAAAGATGAGATGTTCAGG - Intronic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185661636 X:1733203-1733225 GAAAAAAAGGAGAGGGGGCCGGG + Intergenic
1185714486 X:2330225-2330247 AAAAAAAAGTAGAAGGGGCCAGG + Intronic
1186003665 X:5043272-5043294 AAATAAAAAGAGAGGTGGGATGG + Intergenic
1186068353 X:5790577-5790599 AAAAAAAAAAAGTGATGGTCTGG + Intergenic
1186153318 X:6699700-6699722 AAAAAAAAAAAGAGGTGGGGAGG - Intergenic
1186371413 X:8951221-8951243 AAAAAGAAAGAGAGCTGCTCCGG - Intergenic
1186466551 X:9787934-9787956 AAAAAAAAAGAGGAGTGTTCTGG - Intronic
1187062383 X:15799444-15799466 AAAAAAAAAAAAAGGTGGTGGGG - Intronic
1187077809 X:15952921-15952943 AAAAAAAAAAAGAGGAGGCCGGG - Intergenic
1187123114 X:16428342-16428364 AAAAAAAAAAAAAGGTAGTCAGG + Intergenic
1187188844 X:17013759-17013781 AAAAAAAAGGAAAGGGGGATTGG - Intronic
1187226734 X:17380336-17380358 AAAGAATAGGAGAGGTGGAGAGG + Intronic
1187648935 X:21378531-21378553 GCAAAAAAGTAGAGATGGTCTGG - Intronic
1188091942 X:25975361-25975383 AAAAAAAAAGGGAGGGAGTCTGG + Intergenic
1188188033 X:27140250-27140272 AAAAAAAAGGCCAGGTGCTGTGG - Intergenic
1188390655 X:29615393-29615415 AAAACAAAGGAGAGGAGGGGAGG + Intronic
1188406012 X:29810482-29810504 AAATAAAAGGAAATGTGGGCTGG - Intronic
1188464788 X:30467574-30467596 AAAAAAAAGGAGAAATGAGCAGG - Intergenic
1188745499 X:33836830-33836852 AAAAAAAAGGAGAAATGGAAAGG + Intergenic
1189140703 X:38602682-38602704 AAGAGAATGGAGAGGTGGGCGGG + Intronic
1189152199 X:38720169-38720191 AAAAAAAAAAAGAGATGGCCAGG + Intergenic
1189328319 X:40126848-40126870 AAAAAAAAAAAGAGGAGGTTAGG + Intronic
1189512975 X:41682255-41682277 AAAAAGAAGGTGAAGGGGTCAGG + Intronic
1189516312 X:41716553-41716575 AAAAAAAAGTTGAGGTGATGTGG - Intronic
1189719863 X:43905164-43905186 AAACTAAAGGAGGGGTGGGCTGG + Intergenic
1190833609 X:54080872-54080894 AAAAAAAAGGAAAGTTGGTCAGG + Intronic
1190836273 X:54103744-54103766 AAAAAAAAAAAGAGGTGTTTTGG - Intronic
1191033631 X:56002254-56002276 AAAAAAAAGAATAGGTGTGCAGG - Intergenic
1191194582 X:57707622-57707644 AAGAAAAAAGAGGGGAGGTCTGG + Intergenic
1192623086 X:72699524-72699546 AAAAAAAAAGAGGGATGTTCAGG + Intronic
1192678754 X:73229505-73229527 AGGAAAAGGGAGAGGTGGTGTGG - Intergenic
1193169730 X:78321699-78321721 AAAAAAAGGCATAAGTGGTCTGG + Intronic
1193584828 X:83308028-83308050 GATAAAAAGGAGAAGTTGTCTGG + Intergenic
1193952328 X:87815168-87815190 AAAAAGAAGAAAAGGTGGTTAGG - Intergenic
1195257357 X:103103452-103103474 AAAAAAAAGGAAAGTTCGGCTGG - Intergenic
1195449272 X:104991952-104991974 AAAAATAAGGAGATTTGGACAGG + Intronic
1195876786 X:109550489-109550511 AAATAAAAGGAGAGGAAGACGGG + Intergenic
1196417203 X:115484081-115484103 AAGAAAAAGGAGAGGGGGAAGGG + Intergenic
1196683683 X:118493934-118493956 AAAAAAAAGGAGAGAGGCCCAGG - Intergenic
1196718197 X:118829389-118829411 AAAAAAAAGGGGAGGGGGCGAGG - Intergenic
1196784403 X:119409504-119409526 AAAAAAAAAAAAAGGTGGGCTGG - Intronic
1196815273 X:119660731-119660753 TATAAAAAGCAGAGGTGGCCAGG + Intronic
1197310737 X:124901933-124901955 AAAATAAAGGAGAGGGGGGAGGG + Intronic
1197549793 X:127876315-127876337 AAAAAAAAAGACAAGTGGTGAGG - Intergenic
1197719811 X:129737662-129737684 AAACAAAAGGAATGGTGGCCAGG + Intergenic
1197720393 X:129740946-129740968 AAAAAAAAGGAGGGGGGGCGGGG + Intronic
1198077530 X:133208466-133208488 CAAAAAAAGGAGTTGTGTTCAGG - Intergenic
1198237145 X:134746012-134746034 AAAACAAGGGAGAGGTGGGGAGG - Intronic
1198255450 X:134920374-134920396 AAATAACAGGAGAGGAGCTCTGG - Intergenic
1198517814 X:137427036-137427058 AAAAAAAAATAGAGGTGGCTTGG + Intergenic
1198744052 X:139871502-139871524 AAAAAAAAGCGGGGGTGGCCAGG - Intronic
1198791002 X:140345841-140345863 AAAAAAAAGCAGATCTGGGCCGG - Intergenic
1198935279 X:141897310-141897332 AAGAAATAGGAGTGGTTGTCGGG - Exonic
1198987359 X:142470657-142470679 AATAAGAAGAAGAGGTGGTGAGG + Intergenic
1199134530 X:144234810-144234832 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1199233095 X:145461999-145462021 AAAACAAAGAGGGGGTGGTCAGG + Intergenic
1199233340 X:145464316-145464338 AAACAAAAATGGAGGTGGTCAGG + Intergenic
1199533155 X:148872061-148872083 AGAAGAACGGAGAGCTGGTCTGG - Intronic
1200232779 X:154452573-154452595 AGAAAAAAGGTGAGCTGGGCTGG + Intergenic
1200602309 Y:5220696-5220718 AAAAAAAAGGCCAGGTGTTGTGG - Intronic
1201548174 Y:15189388-15189410 AAAAAAAAGAAGCGGTGGGCAGG + Intergenic
1202341365 Y:23872355-23872377 AGAAAAAAACAGAGGTGTTCGGG + Intergenic
1202529401 Y:25797731-25797753 AGAAAAAAACAGAGGTGTTCGGG - Intergenic