ID: 1133507390

View in Genome Browser
Species Human (GRCh38)
Location 16:6425494-6425516
Sequence TGTATAAGGGTCAGTCTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133507379_1133507390 26 Left 1133507379 16:6425445-6425467 CCAACCTCTCACCATTTCTGTGG 0: 1
1: 0
2: 3
3: 31
4: 356
Right 1133507390 16:6425494-6425516 TGTATAAGGGTCAGTCTTATAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1133507385_1133507390 15 Left 1133507385 16:6425456-6425478 CCATTTCTGTGGGCTTGGGATTA 0: 1
1: 0
2: 1
3: 20
4: 174
Right 1133507390 16:6425494-6425516 TGTATAAGGGTCAGTCTTATAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1133507378_1133507390 27 Left 1133507378 16:6425444-6425466 CCCAACCTCTCACCATTTCTGTG 0: 1
1: 0
2: 2
3: 30
4: 319
Right 1133507390 16:6425494-6425516 TGTATAAGGGTCAGTCTTATAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1133507382_1133507390 22 Left 1133507382 16:6425449-6425471 CCTCTCACCATTTCTGTGGGCTT 0: 1
1: 0
2: 2
3: 27
4: 323
Right 1133507390 16:6425494-6425516 TGTATAAGGGTCAGTCTTATAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133507390 Original CRISPR TGTATAAGGGTCAGTCTTAT AGG Intronic
918266603 1:182847901-182847923 TGCAGGAGGGTCAGTCTTACAGG + Intronic
921498137 1:215866174-215866196 TGTATTAAAATCAGTCTTATAGG - Intronic
922634034 1:227146456-227146478 TGTATAAAAATCAGTTTTATAGG - Intronic
1064365801 10:14706763-14706785 AGTAGAAGGGACAGTTTTATTGG - Intronic
1071156162 10:82691956-82691978 TTTATTAGGGTAAGTCTTATTGG - Intronic
1071823080 10:89297589-89297611 TGTATCAGGGGCTGTCTTTTTGG - Intronic
1077520755 11:3032425-3032447 TGAATTGGGGACAGTCTTATGGG + Intronic
1078040079 11:7852484-7852506 TGTATAAGGCTGAGTCTCAATGG - Intergenic
1080107201 11:28523339-28523361 TGTATAAGGGAGAATTTTATAGG - Intergenic
1086333885 11:85780846-85780868 TGAATTAGGGACAGTCTTGTGGG + Intronic
1086450689 11:86913435-86913457 TGTGGAAGGGTTGGTCTTATAGG + Intronic
1090938198 11:131364140-131364162 TGTATCAGGGTAAGTCATGTGGG + Intergenic
1091479208 12:809135-809157 TGTATAAAGGTGAGCCATATTGG + Intronic
1095103621 12:38206415-38206437 TCTCTAAGGGTCTGTCTTCTGGG - Intergenic
1100379684 12:94049899-94049921 TATATAAGAGTCTATCTTATTGG - Intergenic
1102517591 12:113460218-113460240 TGTATCAGGGTAGGTATTATTGG - Intergenic
1106601341 13:31189586-31189608 TGAAGTGGGGTCAGTCTTATGGG + Intergenic
1107777863 13:43865302-43865324 TGAAGCAGGGGCAGTCTTATGGG + Intronic
1109009305 13:56919920-56919942 TGTAGGAGGGTCAGTTTCATGGG + Intergenic
1111416529 13:87953908-87953930 TGTATCAGTGTCTGTCTAATAGG - Intergenic
1117529682 14:56647835-56647857 TGTGTAAGGGCCATGCTTATTGG + Exonic
1120609374 14:86621677-86621699 TTTATAAGGGGAAGTCATATTGG + Intergenic
1126391953 15:48167188-48167210 TGTATAAGTGTCAGACTTGCTGG + Intronic
1129218572 15:74117113-74117135 TGTTTGAGGGTCATTCATATAGG - Intronic
1130357655 15:83148713-83148735 TGTATAATATTCAGTTTTATGGG - Intronic
1132594496 16:742217-742239 TGTCTAATGGCCAGTTTTATGGG + Intronic
1133507390 16:6425494-6425516 TGTATAAGGGTCAGTCTTATAGG + Intronic
1133626266 16:7573313-7573335 TCTATAAGGTTCAGTGTTCTCGG - Intronic
1135177685 16:20245348-20245370 AGTATATGGGTGAGTTTTATAGG - Intergenic
1135622609 16:23968637-23968659 TCTGTAAGGGTCAGCCTTTTGGG + Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1150669092 17:67174316-67174338 TGTAAAAGGCACAGTCTGATGGG + Intronic
1156596180 18:38550746-38550768 TGAATCAGGTTCAGTCTTCTAGG + Intergenic
1162000202 19:7739758-7739780 TGAAGCAGGGTCAGTCTTTTGGG - Intergenic
929806368 2:45149615-45149637 TGTATGAGGGTCAGTGTGTTTGG + Intergenic
930528594 2:52562951-52562973 TGTCTAAGGGTAGGTCTTTTTGG + Intergenic
932030727 2:68181545-68181567 TGTACAAGGGCCAGTCTTGCAGG + Intronic
933132144 2:78684919-78684941 TTTATAATGGCCAGTCTTACAGG - Intergenic
941479484 2:165988514-165988536 TGTATGAGGGGCAGTCTGATTGG + Intergenic
946875195 2:224122612-224122634 TGCATAAGGGAAAGTGTTATAGG - Intergenic
1175476245 20:59276771-59276793 TGTATAAGGCTGAATGTTATGGG + Intergenic
1183111638 22:35653853-35653875 TGAAGTAGGGGCAGTCTTATGGG - Intronic
1184833359 22:47005423-47005445 TGTATAAGGGTGTGTGTTATAGG - Intronic
951712501 3:25599021-25599043 TGGAAAAGGGTCAGACTAATTGG + Intronic
959007690 3:101039090-101039112 TGCCTAAGGGTAAATCTTATGGG + Intergenic
959524161 3:107357406-107357428 AGCATAAAGGTCAGTCTGATCGG - Intergenic
960630874 3:119729244-119729266 TGTAAGAGGGTCAGACTTCTGGG + Intronic
962658549 3:137575574-137575596 TGTATATGGGTCATTCCTTTTGG + Intergenic
964417671 3:156465117-156465139 TGATTAAGGGTCTGTCTTCTGGG + Intronic
966566541 3:181388651-181388673 TTTATAATGGTCATTCTAATAGG + Intergenic
969975378 4:11095413-11095435 TGTATAATGGTAAGTCATAATGG - Intergenic
973723367 4:53748047-53748069 TGTGTGAGGGTCTGTCTTTTAGG + Intronic
980039855 4:127926714-127926736 TGTATCAGGTTCAGTGCTATGGG - Intronic
985975988 5:3419534-3419556 TGTTTAAGGGCAAGTCCTATGGG + Intergenic
987404877 5:17514473-17514495 TGAATAAGGGTCATTCTGGTGGG + Intergenic
987528543 5:19084301-19084323 TGTATAAGAGTAAGGCTGATTGG - Intergenic
998257047 5:140596006-140596028 TGAATTAAGGTCAGTCTTGTTGG - Intergenic
1003246889 6:4389543-4389565 TCCATCAGGGTCAGTGTTATTGG - Intergenic
1011659397 6:89581432-89581454 TGTTTAAAGGTCAGTCCCATTGG - Intronic
1023170664 7:37387456-37387478 TTTATAAGGACCAGTCATATTGG + Intronic
1034315511 7:150127579-150127601 TATATAAGGCTCACTCTTCTTGG - Intergenic
1034539368 7:151746473-151746495 TGTAAAATGGTCTCTCTTATGGG - Intronic
1038421448 8:27436586-27436608 TGGAGAAGGGTCAGTATTCTTGG + Intronic
1040579830 8:48688858-48688880 TGTATCAAGGTCAGTCTTAATGG - Intergenic
1050766983 9:9146785-9146807 TGTCTGAGGGTCATTTTTATTGG - Intronic
1056489561 9:87091999-87092021 TGTATAATTTTCAGTCTGATGGG + Intergenic
1058057704 9:100465695-100465717 AGCATAAGGGTCAATATTATTGG - Intronic
1186456984 X:9717427-9717449 TGGACAAGGGTCAGTCTTCGGGG + Exonic
1188206410 X:27364352-27364374 TTTATAAGGACCAGTCATATTGG + Intergenic
1189347524 X:40253267-40253289 TGTTTCAGGGTCATTCTTTTTGG - Intergenic
1189593210 X:42537288-42537310 TCCATATGGGTCAGTCTTCTTGG + Intergenic
1190017549 X:46840329-46840351 TGTAATTGGGTCAGTCTTAGGGG + Intronic
1200319695 X:155174352-155174374 TGTATAAGAGTTTATCTTATTGG + Intergenic
1201456023 Y:14167530-14167552 TGAATAAAGGTCACTCTGATAGG + Intergenic