ID: 1133507775

View in Genome Browser
Species Human (GRCh38)
Location 16:6429293-6429315
Sequence GGGAGCTGGCAAAGATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133507775_1133507778 -5 Left 1133507775 16:6429293-6429315 CCCTGGGATCTTTGCCAGCTCCC 0: 1
1: 0
2: 3
3: 18
4: 215
Right 1133507778 16:6429311-6429333 CTCCCCACCACTGCTGCTGCAGG 0: 1
1: 0
2: 2
3: 59
4: 370
1133507775_1133507785 15 Left 1133507775 16:6429293-6429315 CCCTGGGATCTTTGCCAGCTCCC 0: 1
1: 0
2: 3
3: 18
4: 215
Right 1133507785 16:6429331-6429353 AGGGTTTCTTGTTGACCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 66
1133507775_1133507779 -4 Left 1133507775 16:6429293-6429315 CCCTGGGATCTTTGCCAGCTCCC 0: 1
1: 0
2: 3
3: 18
4: 215
Right 1133507779 16:6429312-6429334 TCCCCACCACTGCTGCTGCAGGG 0: 1
1: 0
2: 8
3: 31
4: 280
1133507775_1133507784 14 Left 1133507775 16:6429293-6429315 CCCTGGGATCTTTGCCAGCTCCC 0: 1
1: 0
2: 3
3: 18
4: 215
Right 1133507784 16:6429330-6429352 CAGGGTTTCTTGTTGACCCTAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1133507775_1133507786 16 Left 1133507775 16:6429293-6429315 CCCTGGGATCTTTGCCAGCTCCC 0: 1
1: 0
2: 3
3: 18
4: 215
Right 1133507786 16:6429332-6429354 GGGTTTCTTGTTGACCCTAGGGG 0: 1
1: 0
2: 1
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133507775 Original CRISPR GGGAGCTGGCAAAGATCCCA GGG (reversed) Intronic
901878333 1:12179675-12179697 GGGAGCAGGACAAGATCACAGGG + Intronic
902599625 1:17532141-17532163 GGGAGCAGGGAGAGAGCCCAGGG - Intergenic
904466678 1:30712270-30712292 GGGAGGTGGCCGAGATCTCAGGG + Exonic
904833434 1:33320211-33320233 GGGAGCTGGCAAGGCTGCCTCGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
908767803 1:67570016-67570038 GGGAGCAGTCAAAGATGCCATGG + Intergenic
912365296 1:109128554-109128576 GGGGGCTGGCAAGGATGCCTTGG - Intronic
912497783 1:110102497-110102519 AGGAGCTGGCCCAGAGCCCAAGG - Intergenic
913278675 1:117164214-117164236 GGGAGATGGCACAGATCTCTAGG + Intronic
915057821 1:153151852-153151874 TATAGCTGGCACAGATCCCACGG + Intergenic
917482805 1:175426486-175426508 GAGAGCTTGCAAAGTTTCCACGG + Intronic
917860382 1:179138198-179138220 TGGAGCTTGAAAAGATCCCTGGG - Intronic
918310691 1:183283289-183283311 TGGAGCTGGCACAGGTACCAGGG - Intronic
922127139 1:222738736-222738758 TGAAGCTGGCAATGTTCCCAAGG + Intronic
922606475 1:226892730-226892752 AGGAGTTAGCACAGATCCCACGG + Intronic
1063610918 10:7561381-7561403 GGGAGCTGGCCAGGCTCCCCGGG - Exonic
1064038275 10:11934548-11934570 TGGAGCTGGCAAAGACTTCACGG - Intronic
1067494655 10:46750945-46750967 GGGAGCTGGAAAGGTCCCCACGG + Intergenic
1067600001 10:47589452-47589474 GGGAGCTGGAAAAGTCCCCACGG - Intergenic
1069554683 10:69389973-69389995 GGATGCTGGGAAAGACCCCAGGG + Intronic
1069844719 10:71362964-71362986 GGGAGGTTGCAAAGAGCCCATGG - Exonic
1070438079 10:76413198-76413220 GAGAGATGCTAAAGATCCCATGG - Intronic
1073115936 10:101091642-101091664 GGAAGCTGGCAACCATGCCAAGG + Intronic
1074013773 10:109511438-109511460 AGGAACTGGCAAAGATTTCATGG - Intergenic
1075161987 10:120032412-120032434 GGGAGCTGGGGAAAAACCCAGGG + Intergenic
1076431823 10:130409423-130409445 GGGAGTTGGCAAAGACCGGATGG - Intergenic
1077881400 11:6353577-6353599 GGCAGCTGGCTTAGGTCCCAAGG - Intergenic
1078458420 11:11493909-11493931 GGGAGCTGTCACAGAGACCATGG + Intronic
1078507803 11:11965454-11965476 AGGAGCTGGCAGAGAGGCCACGG - Intronic
1078576045 11:12503562-12503584 GGGACCTGGCAAAGAACTGAGGG + Intronic
1080937013 11:36874814-36874836 GGGAGCTGGCAAAATTTACAGGG + Intergenic
1083268134 11:61556474-61556496 GGAGGCCGGCACAGATCCCATGG - Intronic
1084185336 11:67468297-67468319 AGGAGCCTGCATAGATCCCAGGG + Intronic
1084442059 11:69180176-69180198 GAGAGGTGGAAAAGACCCCAGGG + Intergenic
1085026727 11:73240653-73240675 GGGAGCAGCCAAAGAGCCCTGGG - Intergenic
1087389986 11:97519684-97519706 GGGAGTTTGCAAGGGTCCCATGG - Intergenic
1088099348 11:106137744-106137766 TAGAGCTGGCAAAGATTTCATGG + Intergenic
1090226996 11:125077603-125077625 GGCAGCTGGGAATGAGCCCAGGG + Intronic
1090878517 11:130812930-130812952 GTGAGCTGGCAAACAGCCCCAGG + Intergenic
1092679112 12:10957499-10957521 AGGACCTGGCAAAGATTTCATGG + Intronic
1092985321 12:13839453-13839475 GGGAGCTGAAAAACATCTCAGGG - Intronic
1093847843 12:23995937-23995959 GTGAGCTGACATATATCCCAAGG - Intergenic
1094552382 12:31465061-31465083 TGGCTCTGGCACAGATCCCAAGG + Intronic
1097440793 12:59605394-59605416 GGGAGGTGGCAAGACTCCCATGG + Intronic
1100877131 12:98974615-98974637 GGGGGATGGCAAACAACCCATGG + Intronic
1102051048 12:109862173-109862195 GGGTGCGGGCAAAGAATCCAGGG + Intronic
1102077664 12:110073091-110073113 GGGAGGAGGCAAGGATCTCAGGG - Intronic
1103687499 12:122743641-122743663 GGGAGCTGGCTATGTTGCCAGGG + Intergenic
1104416119 12:128597916-128597938 TGGAGCAGGCAGAGGTCCCAGGG + Intronic
1104429915 12:128707703-128707725 GGGCGCTCACAAAGATGCCAGGG + Exonic
1108044621 13:46372004-46372026 GGGAGGTGGCCAAAATCCCAGGG + Exonic
1108165119 13:47684910-47684932 AGGACCTGACAAAGATCTCATGG + Intergenic
1108605196 13:52030510-52030532 GGGAACTGCCAAAGACCTCACGG - Exonic
1111029770 13:82580388-82580410 GGGAGCTGGGATCTATCCCACGG + Intergenic
1112522250 13:100106821-100106843 AGGAGATGGCAAAGATAGCAGGG - Intronic
1119168594 14:72515795-72515817 GGGAGCCTGCAGAGCTCCCAGGG + Intronic
1120975118 14:90241646-90241668 GGGAGCTTGCAAGGGTCCCATGG + Intergenic
1121503881 14:94461716-94461738 GAGAGCTGGCAGAAGTCCCAGGG - Intergenic
1121953976 14:98197555-98197577 GAGAGCTGGCAATGACTCCAAGG - Intergenic
1122065306 14:99169044-99169066 GGGAGCTTTCAAAAATCTCAGGG - Intergenic
1122363850 14:101183043-101183065 CGGAGCTGGAGAAGATGCCAAGG - Intergenic
1122956326 14:105073207-105073229 GGCAGCTTGCCCAGATCCCACGG - Intergenic
1123403623 15:20008195-20008217 GGAAGCTGGCACAGGCCCCAAGG - Intergenic
1123410760 15:20056955-20056977 GGCAGCTGGCAAAGGTACCCTGG - Intergenic
1123512959 15:21014840-21014862 GGAAGCTGGCACAGGCCCCAAGG - Intergenic
1123520089 15:21063661-21063683 GGCAGCTGGCAAAGGTACCCTGG - Intergenic
1124680356 15:31725132-31725154 GCGAGCTTGCAAGGATGCCATGG + Intronic
1125722417 15:41851611-41851633 AGGAGCTGGGAAGGGTCCCAAGG + Intronic
1126645674 15:50872670-50872692 GGGAGTTTGCAAGGGTCCCATGG - Intergenic
1129489217 15:75906688-75906710 GGGAGCTGGCCAGTATCCAAAGG + Intronic
1129788021 15:78322129-78322151 GGGAGCAGGGAATGACCCCAAGG - Intergenic
1130323847 15:82862979-82863001 GGGAGCCAGCAAAGATGACAGGG - Intronic
1130393223 15:83478056-83478078 GGGAGATGGCATGGGTCCCAGGG + Intronic
1133007946 16:2895049-2895071 GTAAGCTGGGAAAGACCCCATGG + Intronic
1133071008 16:3246790-3246812 GGGAAATGGCAGAGATCCCCTGG + Intronic
1133507775 16:6429293-6429315 GGGAGCTGGCAAAGATCCCAGGG - Intronic
1134392909 16:13836239-13836261 GAGAGCTTGAGAAGATCCCAGGG + Intergenic
1135665092 16:24328980-24329002 GGCAACTAGCAAAGATCCTAAGG + Intronic
1136247524 16:28984404-28984426 GGGAGCTGGCACACGGCCCAGGG - Exonic
1136402435 16:30025860-30025882 GGGGGCTGCCCAAGAACCCAGGG - Intronic
1136532319 16:30877865-30877887 AGGAGCTTGTAAAAATCCCAGGG + Intronic
1136642199 16:31576341-31576363 GGGAGCTGGCAAATAGCAAAGGG + Intergenic
1138558984 16:57788794-57788816 CGGAGCTGGCAAGGATCCCAGGG + Intronic
1141049896 16:80751380-80751402 AAGAGCTGGCAAATAACCCAAGG - Intronic
1141151243 16:81565888-81565910 GGGAGCGGGCACAGATGTCACGG + Intronic
1142265248 16:89061453-89061475 GGGAGCGAGCACAGAGCCCACGG - Intergenic
1146006493 17:29163776-29163798 GGGAGCTGGCAACAATCCCCTGG + Intronic
1146563594 17:33892874-33892896 GGGAGCTGGCTATGCTCCCTTGG - Intronic
1146622502 17:34409989-34410011 AGGAACTGGCAAAGATTTCATGG + Intergenic
1146891259 17:36507928-36507950 GGAAGATGGCAGAGAACCCATGG + Intronic
1150023158 17:61641226-61641248 GGGAGCTGGCGCACATCACATGG - Intergenic
1150176136 17:63058480-63058502 AGGAACTGGCAAAGATGTCATGG - Intronic
1150338390 17:64346162-64346184 GACAGATGGCAATGATCCCAGGG + Intronic
1150859598 17:68787532-68787554 GGGAGCTGGCACCGAGGCCAAGG + Intergenic
1151670052 17:75567096-75567118 GGGATCTGGCAAAGAACACCTGG + Intronic
1152448232 17:80359068-80359090 GGGAGGGAGCACAGATCCCAGGG - Intronic
1152475881 17:80517938-80517960 GGGACCAGGCATAGCTCCCAGGG + Intergenic
1152724872 17:81940220-81940242 GTGAGCTGGCACAGCTCCCCAGG + Exonic
1157423942 18:47569334-47569356 GGGGGCTGGAAGAGATCACAGGG - Intergenic
1157977099 18:52340088-52340110 TGGATCAGGCAAAGATTCCACGG - Intergenic
1160958738 19:1707636-1707658 GGGAGCTGCCCTACATCCCAAGG + Intergenic
1161459759 19:4389705-4389727 GGGAGCCGGTAAATATCACATGG - Intronic
1163529292 19:17840429-17840451 GTCACCTGGCAAGGATCCCAGGG - Intronic
1165382052 19:35488572-35488594 GAGAGCTTGCAAAGCTGCCACGG - Intronic
1166405533 19:42519312-42519334 GAGAGCTGGCTAAAATCTCAGGG - Intronic
1168125511 19:54280358-54280380 AGGGGCTCACAAAGATCCCAGGG - Intronic
1168168968 19:54573995-54574017 AGGGGCTCACAAAGATCCCAGGG + Intronic
1168171741 19:54594361-54594383 AGGGGCTCACAAAGATCCCAGGG + Intronic
1168176460 19:54631190-54631212 AGGGGCTCACAAAGATCCCAGGG + Intronic
926293747 2:11552343-11552365 GGGATCTAGCAAAGAGACCACGG + Intronic
927866329 2:26590177-26590199 GGGAGCTTCCAAAAAGCCCAGGG + Intronic
927903484 2:26840479-26840501 GAGGGATGGCAAAGATCTCAAGG + Intergenic
928123497 2:28600684-28600706 ATGAGCTGGCAGAGATCCCGAGG - Intronic
931417813 2:62098072-62098094 GGGAGTTTGCAAGGGTCCCATGG - Intronic
931604255 2:64036357-64036379 GGGAGCTGGGAAGGAGCCCAGGG - Intergenic
931925664 2:67069548-67069570 AGGAACTGGCAAAGATTTCATGG + Intergenic
932920470 2:75908319-75908341 GGGAGCTGGCAAAGAGAGTAGGG - Intergenic
934844065 2:97650579-97650601 GGGAGTTGTAAAAGATCCCCAGG - Intergenic
935726197 2:106026158-106026180 GGCAGCTGGCCAATATCCCACGG - Intergenic
936517935 2:113193765-113193787 GGGAGCTGGAAAGGGTTCCATGG + Intronic
940378796 2:152989180-152989202 GTAGGCTGGCAAAGATACCAGGG - Intergenic
940615440 2:156043570-156043592 AGGAACTGGCAAAGATTTCATGG + Intergenic
940816094 2:158299322-158299344 AGAAGCTGGCAAAGGACCCAAGG + Intronic
941507528 2:166366060-166366082 AAGACCTGGCAGAGATCCCAAGG - Intronic
941985998 2:171512281-171512303 GGGAGCCCCCAAAGAACCCATGG + Intergenic
942140374 2:172971569-172971591 GGGAGATGGGAAAAATCCCAAGG - Intronic
945373496 2:209051235-209051257 CGGACCTGGCAAAGATTCCCAGG - Intergenic
946170942 2:217895150-217895172 GGAAGTTGGCAATGATGCCACGG - Intronic
948365061 2:237449339-237449361 GGGAGCTGTCAAGGATTCCACGG - Intergenic
948936825 2:241170972-241170994 GGGAGTTGGCAAAGAAGCCAGGG + Intronic
1169088010 20:2839274-2839296 GGGAGGAGACAGAGATCCCAAGG + Intronic
1170953769 20:20959651-20959673 GGGAGCTGGCAAGCATGGCAAGG + Intergenic
1172201935 20:33132712-33132734 GGGAATTGGCAATGTTCCCAAGG - Intergenic
1172393979 20:34586083-34586105 GGGTTCTGGCTAAGATCCCCAGG + Intronic
1172832195 20:37845482-37845504 GGGCACTGGCAAACATTCCAAGG + Intronic
1173919824 20:46735238-46735260 GGGTGCTGGCAGAGCCCCCAAGG + Exonic
1173965062 20:47106503-47106525 GGGAGCTCACAAAGCACCCAGGG + Intronic
1175762590 20:61571596-61571618 GGGAGCTGGCATAGAATGCAGGG - Intronic
1175766666 20:61597336-61597358 CGGGGCTTGCAAAGATGCCAAGG - Intronic
1176515100 21:7777890-7777912 GGAAGCTTGTAAAAATCCCATGG - Intergenic
1176931394 21:14815201-14815223 GGGATGTGGCAAACTTCCCAGGG + Intergenic
1178649128 21:34407902-34407924 GGAAGCTTGTAAAAATCCCATGG - Intergenic
1179056823 21:37944047-37944069 GAGAGCTGTCAAAGATCCCCAGG - Intergenic
1179423414 21:41253947-41253969 GGAAGCTGGGAAAGATCACCTGG + Intronic
1179731018 21:43367537-43367559 GGGAACTGGCACCGATCTCAGGG + Intergenic
1181151792 22:20889183-20889205 GGGAAATGGCAAAGGTCACATGG - Exonic
1183464449 22:37972694-37972716 GGGAGCTGGCAAGGAGCCCAGGG + Exonic
1184028416 22:41875750-41875772 GGGAAATGGGAAAGATTCCAGGG - Intronic
1184602395 22:45551401-45551423 GGCAGCTGGCCAAGAGCCCAAGG - Intronic
1184877861 22:47286793-47286815 GGGAGCAGGCGGAGGTCCCAGGG - Intergenic
1185132302 22:49046206-49046228 AGGAGCTGGCAGAGCCCCCAGGG + Intergenic
951305235 3:21052257-21052279 AGGATCTGGCAAAGATCTCATGG + Intergenic
953743288 3:45555027-45555049 AGGAGCCTGCAAAGATCTCATGG - Intergenic
953747404 3:45585625-45585647 GGAGGCTGGCAAAGTTGCCATGG - Intronic
955732991 3:62007089-62007111 GGGAGCTGTTAAAATTCCCAAGG - Intronic
956152070 3:66253824-66253846 AGGAGGTGACAAACATCCCATGG - Intronic
959822001 3:110746528-110746550 GGGAACTGGCAAAGATTTCATGG + Intergenic
959954802 3:112224096-112224118 GGGAGCTGGCTATGCTACCATGG - Intronic
961437849 3:126931693-126931715 GGGAGCTTAGAAAGGTCCCAAGG - Intronic
962984066 3:140518450-140518472 GGGGGCTCTCTAAGATCCCAGGG - Intronic
964868588 3:161288966-161288988 GGGAGCTGGCAAAGTTACCACGG + Intergenic
966259121 3:177954127-177954149 GGGAACTGTGAAAGATCCAAAGG + Intergenic
966818226 3:183906170-183906192 GGGAGGTGGCAGAGGGCCCAGGG + Intergenic
969177875 4:5412989-5413011 GGGAACCAGCAAAGATGCCAGGG - Intronic
971374586 4:26046640-26046662 GGGAACTGGCCAAGAACACAGGG + Intergenic
974594682 4:64000088-64000110 GGGAGTTTGCAAGGGTCCCATGG - Intergenic
975250589 4:72174045-72174067 GGGAGTTTGCAAGGGTCCCATGG + Intergenic
980785390 4:137547616-137547638 AGGAGCTGGAAAAGTTCCCCAGG + Intergenic
981658580 4:147140465-147140487 AGGAGCAGGCAGAGATCACATGG + Intergenic
981773432 4:148336584-148336606 GGGGCCTTGCAAAGATTCCATGG - Intronic
982484753 4:155953673-155953695 GGGAGCAGGGACAGATCCCGGGG + Intronic
985091372 4:186365797-186365819 GGCAGCTGGCAGACAGCCCATGG + Intergenic
985654355 5:1122168-1122190 GGGGGCAGGGAAAGTTCCCAAGG - Intergenic
985676249 5:1232701-1232723 GGGAGCTGGGAAGGAGCCCCGGG + Intronic
986407120 5:7437221-7437243 GGGGGCTGAAAAAGATCACAGGG - Intronic
992066666 5:73115977-73115999 GGGAGGAGGAAAATATCCCAGGG + Intergenic
997039427 5:130234208-130234230 GGGATCTGGCAAAGAAGCCTAGG - Intergenic
998936984 5:147239866-147239888 GAAAGCTGCCAAAGGTCCCATGG - Intronic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1003023119 6:2529336-2529358 ATGAGCTGGCACAGATCCTATGG + Intergenic
1006091122 6:31629648-31629670 TGGAGCTGGCACAGCCCCCAGGG - Exonic
1006096764 6:31660980-31661002 GGGATGTGGAAAAGAACCCAGGG - Intergenic
1006230977 6:32586521-32586543 GGGGGCTGAGAAAGAGCCCAAGG - Intronic
1006451285 6:34107142-34107164 GGAATCAGGCAAAGATCCCCTGG - Intronic
1011162538 6:84407711-84407733 GGGAGTGGGCAGACATCCCATGG + Intergenic
1011779558 6:90771695-90771717 TGGAGCTGACAAAGATTCCTTGG + Intergenic
1013373927 6:109495907-109495929 AGGAAGTGGCAAAGATGCCAGGG - Intronic
1014330194 6:120055135-120055157 AGGAGCTGTCAGAGAGCCCATGG + Intergenic
1014863987 6:126505790-126505812 GATAGCTGCCTAAGATCCCAGGG + Intergenic
1017926014 6:158912309-158912331 GGGAGGTGGCAAAGCAGCCAAGG - Intergenic
1017959574 6:159210074-159210096 AGAAGCTGGCACAGTTCCCAAGG - Intronic
1022092998 7:27119901-27119923 AGGAGCTGGAAAAGTTCACATGG - Intronic
1023922276 7:44639037-44639059 GGGAGAGGACAAACATCCCATGG + Intronic
1028621005 7:92829541-92829563 AGGTGCTGGGAAAGATACCAGGG - Intronic
1029264359 7:99326405-99326427 GAGAGCAGGCAAACATCCTATGG - Intronic
1032184486 7:129712493-129712515 GAGAGCTGGCAAAGGCCACATGG + Intronic
1032431665 7:131867264-131867286 TGGAGTAGGCAAAGTTCCCAGGG - Intergenic
1034391559 7:150791512-150791534 GTGAGCTGCCAAAGACCCCACGG - Exonic
1034478350 7:151301678-151301700 GGGTGCTGGGAGAGGTCCCATGG + Intergenic
1034821079 7:154216665-154216687 GGGAGCTGGCACTGATTCCCTGG - Intronic
1035363192 7:158327839-158327861 GGGAGCTGGCAGCGTTGCCAGGG + Intronic
1036788448 8:11702930-11702952 AGGAGTTGGCCACGATCCCATGG + Intronic
1037775500 8:21832975-21832997 GGGAGGTGTCAAAGAGGCCATGG + Intergenic
1039620368 8:38991776-38991798 GCTACCTGGCAAAGATACCAGGG + Intronic
1042710634 8:71713210-71713232 GGGAGCCAGCAAGGAGCCCATGG + Intergenic
1043509741 8:80938135-80938157 GGGAGCTAGGAAAGTTCCCAAGG + Intergenic
1045417847 8:101984930-101984952 GGGAGCTGGAATACCTCCCATGG + Intronic
1047080553 8:121454827-121454849 GGCTGCTGGCAAACAGCCCAGGG - Intergenic
1048372332 8:133790075-133790097 GGCAGCTGGGCAAGTTCCCAAGG - Intergenic
1048794987 8:138141461-138141483 GGGAACTGGCAAAGAGAACAGGG + Intronic
1048958284 8:139554859-139554881 GGAACCTGGCAAGGGTCCCATGG - Intergenic
1049347100 8:142144911-142144933 GGGTGGAGGCAAAGCTCCCATGG - Intergenic
1049728055 8:144160165-144160187 GGGAGCTGGCTAAGTTACTAGGG + Intronic
1049759852 8:144327020-144327042 GGGAGCTGCCACGGCTCCCAGGG - Intergenic
1052330282 9:27260507-27260529 GGGTGCTGGAGATGATCCCAGGG + Intergenic
1053001625 9:34579921-34579943 GGGAGCTGGAGAACACCCCAGGG - Intronic
1054823596 9:69548361-69548383 GGAAGCTGACACAGGTCCCATGG - Intronic
1054990365 9:71318890-71318912 GGGATCTGGGATAGATACCAAGG - Intronic
1055058041 9:72041490-72041512 GGGTGCTTGCAAGGATCTCAGGG + Intergenic
1056714961 9:89021279-89021301 TGGAGATGGCACAGTTCCCAAGG - Intronic
1056941333 9:90958999-90959021 AGGAGCTGGGAAGGAACCCAAGG + Intergenic
1057971754 9:99565395-99565417 GGGAGCTGGCACGGTCCCCACGG - Intergenic
1058773308 9:108260048-108260070 GGGAGCTGGCCAAGAGGCCTTGG - Intergenic
1059663819 9:116427040-116427062 GGGAGCTGGGAGAGATCTGATGG + Intronic
1060058510 9:120437439-120437461 GGGAGATGACACAGATGCCATGG + Exonic
1061714068 9:132507851-132507873 TGGATCTCGCAAAGATCCCCGGG + Intronic
1062193588 9:135260227-135260249 GGGAGCTTTCACAGAGCCCATGG - Intergenic
1062381388 9:136288471-136288493 GGGAGCTGGCTCAGAGGCCAGGG - Intronic
1185452661 X:291000-291022 GGGAGGTGGCCAAGCTCCCGTGG + Intronic
1187120830 X:16404716-16404738 GGGAGCTGTCAGGGAGCCCAGGG - Intergenic
1189167322 X:38873049-38873071 TTGACCTGGCAAAGAACCCAGGG - Intergenic
1189369402 X:40415930-40415952 TGGAGCTGGCAAGGGTCCCAGGG + Intergenic
1189439692 X:41024237-41024259 GGGAGCTGTCAAAGATTACTGGG - Intergenic
1189969036 X:46399422-46399444 GGGACCTGGGGAAGCTCCCATGG - Intergenic
1190755369 X:53396669-53396691 GGGAGCAGGAGAATATCCCAGGG - Intronic
1197167493 X:123393950-123393972 TGGAGCTGGCAGAGCTCACATGG + Intronic
1199854161 X:151746157-151746179 GGGAGTTGGGAAAGATCTCCTGG + Intergenic