ID: 1133511080

View in Genome Browser
Species Human (GRCh38)
Location 16:6457971-6457993
Sequence GCGTGTGCACACACATACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 8, 3: 54, 4: 439}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133511079_1133511080 21 Left 1133511079 16:6457927-6457949 CCTTTCAGGGGTGACATGGTGGT 0: 1
1: 0
2: 1
3: 9
4: 115
Right 1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG 0: 1
1: 0
2: 8
3: 54
4: 439
1133511077_1133511080 22 Left 1133511077 16:6457926-6457948 CCCTTTCAGGGGTGACATGGTGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG 0: 1
1: 0
2: 8
3: 54
4: 439
1133511075_1133511080 30 Left 1133511075 16:6457918-6457940 CCAGTGTGCCCTTTCAGGGGTGA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG 0: 1
1: 0
2: 8
3: 54
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133511080 Original CRISPR GCGTGTGCACACACATACAT AGG Intronic
900285612 1:1898599-1898621 GCATGTGCACACACATGAGTTGG + Intergenic
900285613 1:1898620-1898642 GGATGTGCACACACATAAGTTGG + Intergenic
900295274 1:1946131-1946153 GAGTGTGCACACACGCACACTGG - Intronic
900522870 1:3114686-3114708 CCGGGTGCACACACACACAGAGG + Intronic
900720960 1:4175500-4175522 GCATGTGCACACACACACTGAGG + Intergenic
901470748 1:9454746-9454768 ACATGTGCACACACGTTCATAGG + Intergenic
902210067 1:14898620-14898642 GCTTGTACACACACATACACAGG + Intronic
902516187 1:16990862-16990884 ATATGTGCACACACATTCATGGG - Intronic
902689828 1:18103840-18103862 ACGTGTCCACACACATATATAGG - Intergenic
904012933 1:27400138-27400160 GCCTGTGTACACACACACAAGGG - Intergenic
904356859 1:29945986-29946008 GCACGTGCACACACACACACAGG + Intergenic
905291367 1:36923885-36923907 GCATGTACACACACATGCACTGG + Intronic
906761038 1:48378876-48378898 GTATATGCACACACATACAATGG + Intronic
906842849 1:49158946-49158968 TCGTATGCAAAGACATACATAGG - Intronic
908369275 1:63465204-63465226 ACATGTGCACACACATACATAGG - Intronic
909071546 1:70999942-70999964 TCATGTGCACACACCTAGATTGG + Intronic
909205375 1:72750171-72750193 GTGTGTGCACAAACACACATAGG + Intergenic
909628422 1:77745304-77745326 TCATGTGCAGACACACACATAGG - Intronic
909733863 1:78931689-78931711 TCATGTGCAAAGACATACATAGG + Intronic
909822866 1:80087958-80087980 GCCTGTTCTCACTCATACATGGG - Intergenic
910398622 1:86816012-86816034 TCATGTGCAGAGACATACATAGG + Intergenic
910668606 1:89750915-89750937 TCATGTGCAGAGACATACATAGG - Intronic
911681670 1:100723777-100723799 GCATATGCACATACATACATAGG + Intronic
911824738 1:102467375-102467397 GTGTATATACACACATACATAGG - Intergenic
912542357 1:110426650-110426672 CTGTGTGCACACACACACACAGG + Intergenic
912951298 1:114122519-114122541 GCATATGCACACACACACGTGGG + Intronic
913247477 1:116882865-116882887 GTGTGTGCACACAAATCTATTGG + Intergenic
913990143 1:143603926-143603948 GCATGTGCAAAGACACACATAGG + Intergenic
915603246 1:156935687-156935709 GCGCGTGTACACACATATGTGGG + Exonic
915649336 1:157296475-157296497 TCATGTGCAAAGACATACATAGG + Intergenic
915771547 1:158430890-158430912 GCATGTGCAAAGACACACATAGG - Intergenic
915885308 1:159715286-159715308 GCGTGTTCTCACTCATAGATGGG - Intergenic
916372852 1:164118881-164118903 TCATGTGCAGACACACACATAGG + Intergenic
918541781 1:185640157-185640179 TCGTGTGCAGAGACACACATAGG + Intergenic
919325787 1:196105251-196105273 GCATGTTCTCACACATAGATGGG + Intergenic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
920847785 1:209608033-209608055 GCATGTGCACAAACAGACACAGG + Intronic
921189399 1:212696442-212696464 GTGTGTGTACACACACACATTGG + Intronic
921758642 1:218886769-218886791 GAGTGTGCACACACTTAAAAAGG + Intergenic
922693789 1:227715656-227715678 TCGTGTGCAAAGACACACATAGG + Intergenic
922831119 1:228555064-228555086 GCGTGCTCACACACACACACAGG - Intergenic
923279859 1:232432996-232433018 GCAGGTGCACACACCTTCATAGG - Intronic
924900665 1:248395487-248395509 TCATGTGCAAAGACATACATAGG - Intergenic
1062999674 10:1904200-1904222 ACAGGTGCACACACATACAGAGG + Intergenic
1063278530 10:4598531-4598553 GCATGTTCTCACTCATACATGGG + Intergenic
1063289189 10:4724336-4724358 GTGTGTGCACACTTATACCTGGG + Intergenic
1063471290 10:6288427-6288449 GCGTGTTCTCACTCATAGATGGG - Intergenic
1064841909 10:19602419-19602441 GCGTGTTCTCACTCATAGATGGG - Intronic
1066169610 10:32827561-32827583 GCGTGTTCTCACTCATAGATGGG + Intronic
1067074205 10:43164434-43164456 GTGTGTGTGCACACATGCATGGG - Intronic
1068951808 10:62784593-62784615 TCATGTGCAAAGACATACATAGG + Intergenic
1071044053 10:81351990-81352012 GCGTGTTCTCACTCATAAATGGG + Intergenic
1071166005 10:82807518-82807540 GGATGTGAACACACATCCATAGG + Intronic
1071272635 10:84022165-84022187 TCATGTGCAGAGACATACATAGG + Intergenic
1071341063 10:84649537-84649559 TCGTGTGCAAAGACATACATAGG - Intergenic
1071763581 10:88636417-88636439 TCGTGTGCAAAGACACACATAGG - Intergenic
1071763831 10:88639241-88639263 GCATGTTCTCGCACATACATCGG - Intergenic
1072485927 10:95855319-95855341 TCGTGTGCAGAGACACACATAGG - Intronic
1073041934 10:100613629-100613651 GTGTGTGCACACATTTTCATGGG - Intergenic
1074310928 10:112322777-112322799 GTGTGTACACACACACACACTGG + Intergenic
1074730092 10:116362231-116362253 GTGTGTACACACATGTACATAGG + Intronic
1076165794 10:128281406-128281428 ATGTGTGCACACACACATATGGG - Intergenic
1077353608 11:2104468-2104490 GAGTGCGCACACACACACACAGG + Intergenic
1077783465 11:5357234-5357256 TCATGTGCACACACACACATAGG + Intronic
1077785163 11:5375569-5375591 TCATGTGCACACACACACATAGG + Intronic
1078711598 11:13797711-13797733 TCATGTGCAGAGACATACATAGG - Intergenic
1080066485 11:28021505-28021527 GCGTGCACATACACAGACATCGG + Intronic
1080234654 11:30055089-30055111 TCGCGTGCAGACACACACATAGG - Intergenic
1080704654 11:34678931-34678953 GCGTGCACACACACACACAGAGG - Intergenic
1082209839 11:49485483-49485505 GTGTGTGTGTACACATACATTGG - Intergenic
1082575648 11:54799864-54799886 TCATGTGCAGAGACATACATAGG + Intergenic
1083144324 11:60747527-60747549 ACGTGTGCACACTCACCCATAGG + Intergenic
1084506039 11:69569075-69569097 AAGTGTGCACACACACACAGAGG - Intergenic
1084890393 11:72233933-72233955 ACGTATGCACACACACTCATGGG - Intronic
1084949234 11:72655488-72655510 GTGCGTGCACACACACACACAGG - Intronic
1085741660 11:79082589-79082611 ATGTGTGCACACACACACACAGG + Intronic
1086411747 11:86550959-86550981 GCATGTGCACACACACCCAGAGG - Intronic
1086590342 11:88508523-88508545 CCGTGTTCACACACACACAATGG - Exonic
1087543651 11:99554436-99554458 TCATGTGCACACACATACATGGG - Intronic
1087736348 11:101838894-101838916 GCATGTTCACACTCATAGATGGG + Intronic
1087888009 11:103502748-103502770 TCATGTGCAAAGACATACATAGG + Intergenic
1087967931 11:104441173-104441195 GCATGTTCTCACACATAAATGGG + Intergenic
1088163404 11:106901710-106901732 GCGTGTTCTCACTCATACGTGGG - Intronic
1088566671 11:111179923-111179945 GCATGTGCACACACTCACATAGG - Intergenic
1088679427 11:112226530-112226552 GGGTGTGCACACAGGTACAGCGG + Intronic
1088845473 11:113662513-113662535 GCATGTTCTCACACATAGATGGG + Intergenic
1089140440 11:116279905-116279927 GTGTGTGCGCGCACACACATAGG - Intergenic
1089193060 11:116668993-116669015 TCATGTGCAGACACACACATAGG + Intergenic
1089285242 11:117403051-117403073 TCGTGTGCAAAGACACACATAGG - Intronic
1089623782 11:119738359-119738381 GTGTGTGCATTCACATGCATAGG - Intergenic
1091218356 11:133917186-133917208 GCCTGGGCACACACAGGCATCGG - Intronic
1091318161 11:134630684-134630706 GTGTATACACACACATACACAGG - Intergenic
1091477536 12:790570-790592 GCTTTTACACACACATACACAGG - Intronic
1091879676 12:3967062-3967084 GGGTGTACACACCCATACACAGG - Intergenic
1092276669 12:7066712-7066734 CCTTGATCACACACATACATTGG - Intronic
1092759508 12:11796909-11796931 GCTTGTGGTCCCACATACATGGG - Intronic
1093493735 12:19732567-19732589 TCATGTGCAGACACACACATAGG - Intergenic
1093860000 12:24153565-24153587 TCCTGTTCTCACACATACATAGG + Intergenic
1094060845 12:26314203-26314225 TCATGTGCAAAGACATACATAGG - Intergenic
1094428215 12:30338096-30338118 GCGTGTTCTCACTCATAGATGGG + Intergenic
1094473767 12:30825683-30825705 GCCTGTGGACACACAAACAGTGG + Intergenic
1094520927 12:31187860-31187882 ATGTGTGCACACACACACACAGG - Intergenic
1095813969 12:46401134-46401156 TCATGGGCACACACAGACATGGG + Intergenic
1096116119 12:49056279-49056301 GGGTTTCCACACACATACATGGG + Intronic
1097701233 12:62822014-62822036 TCATGTGCAGAGACATACATAGG + Intronic
1097910474 12:64964608-64964630 ACATGTGCAAAGACATACATAGG - Intergenic
1097915054 12:65012488-65012510 TCATGTGCAAACACATGCATAGG + Intergenic
1098439333 12:70501401-70501423 GCATGTTCTCACTCATACATGGG - Intergenic
1098767360 12:74507404-74507426 TCATGTGCAAAGACATACATAGG - Intergenic
1098796121 12:74890008-74890030 GTGTGTGCACACACACACAGAGG + Intergenic
1099963942 12:89424969-89424991 ACGTGTGCACACAAATGCATAGG + Intronic
1099988342 12:89695231-89695253 ACATGTGCACACACTTACACTGG + Intronic
1100446603 12:94666561-94666583 GCATGTACACACACATACAAAGG + Intergenic
1101715039 12:107303244-107303266 GAGTGTGTACACACACACATAGG + Intergenic
1104759875 12:131290484-131290506 GCATGTGCACACGGGTACATGGG - Intergenic
1104820853 12:131676767-131676789 GCATGTGCACACATGTACATGGG + Intergenic
1104919689 12:132284184-132284206 ACGTGTGCACACACATGCGTGGG - Intronic
1105746481 13:23381430-23381452 GCGCGCGCACACACACACACAGG + Intronic
1105754828 13:23454505-23454527 GCGTGAGCACATGTATACATAGG + Intergenic
1105964645 13:25372875-25372897 GCGCGCGCACACACACACACAGG + Intronic
1107325589 13:39238918-39238940 TCATGTGCAAACACACACATAGG - Intergenic
1107489579 13:40868457-40868479 TCATGTGCAGACACACACATAGG - Intergenic
1107550933 13:41474578-41474600 GCGTGTTCTCACTCATAAATGGG - Intergenic
1108166015 13:47693901-47693923 GTGCGTGCACACACATGCACAGG - Intergenic
1108253726 13:48591128-48591150 AGGTGTGCACACACACTCATAGG - Intergenic
1108600092 13:51985176-51985198 TCATGTGCAAACACACACATAGG + Intronic
1109173811 13:59129944-59129966 GAGCGTGCACACACACACACAGG + Intergenic
1109529222 13:63619237-63619259 ACGTGTGCACACACACACACAGG + Intergenic
1110353053 13:74532779-74532801 GCATGCACACACACATACAGTGG + Intergenic
1110363810 13:74659238-74659260 GGGTGTGCACACTCATGCTTAGG - Intergenic
1111325039 13:86683167-86683189 GCATGTTCTCACTCATACATGGG + Intergenic
1112878976 13:104082655-104082677 GCGTGTTCTCACTCATAGATAGG + Intergenic
1113010129 13:105754909-105754931 GCGTGTTCTCACTCATAGATGGG + Intergenic
1113269002 13:108652138-108652160 GCGCGCACACACACACACATTGG - Intronic
1113590881 13:111500006-111500028 TCATGTGCAGACACACACATGGG - Intergenic
1114425566 14:22619510-22619532 TCATGTGCAGAGACATACATAGG - Intergenic
1114433510 14:22683705-22683727 GCATGTTCTCACTCATACATGGG + Intergenic
1114541385 14:23462551-23462573 GCGTGTTCTCACTCATAGATGGG - Intergenic
1114743751 14:25124693-25124715 GATTGTGAACACAAATACATAGG + Intergenic
1114765677 14:25368422-25368444 TCATGTGCAGAGACATACATAGG - Intergenic
1115054343 14:29104509-29104531 GTGTGTGCACACACACACTGTGG + Intergenic
1116712568 14:48386989-48387011 GCTTCTTAACACACATACATAGG + Intergenic
1117889876 14:60408335-60408357 TCATGTGCACAGACACACATAGG - Intronic
1117936393 14:60912204-60912226 TCATGTGCACAGACACACATAGG - Intronic
1119100590 14:71876558-71876580 TCATGTGCAGAGACATACATAGG - Intergenic
1119513688 14:75231366-75231388 GTGTGTGCATACACATATGTGGG + Intergenic
1121869305 14:97392626-97392648 GTGTGTGTGCACACATGCATGGG - Intergenic
1122043614 14:99007926-99007948 GTGTGTGCACGCACATGCAATGG - Intergenic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1202932577 14_KI270725v1_random:52345-52367 TCGTGTGCAGAGACACACATAGG - Intergenic
1124715791 15:32060337-32060359 GCGCGTGCACACACACACACAGG - Intronic
1128023624 15:64415184-64415206 GCATGTGTACACAAAAACATGGG + Intronic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1130931237 15:88429553-88429575 GTGTGCGCATGCACATACATAGG - Intergenic
1131346147 15:91650321-91650343 GTGTGTGCACACATGTGCATGGG - Intergenic
1132076098 15:98821859-98821881 ATGTGTGCACACACACACACAGG + Intronic
1132808357 16:1786207-1786229 GCGTGTGCAAACACACACGTGGG - Intronic
1133285896 16:4690673-4690695 CCGAGTGCACACACATGCATGGG - Exonic
1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG + Intronic
1136004940 16:27323023-27323045 GGGTGGGGACACACAGACATGGG - Intronic
1137296606 16:47099569-47099591 TCATGTGCAAAGACATACATAGG + Intronic
1137751001 16:50861053-50861075 ATGTGTACACACACACACATAGG + Intergenic
1138720584 16:59074496-59074518 GCATGTGCAGAGACACACATAGG + Intergenic
1138774077 16:59699706-59699728 GAGCATTCACACACATACATGGG - Intergenic
1139615479 16:68085885-68085907 GCGCGCGCACACACACACACAGG - Intronic
1140168974 16:72583036-72583058 TCATGTGCAGAGACATACATAGG + Intergenic
1141490185 16:84367640-84367662 GCGTATGGACTCACATACTTTGG + Intergenic
1141520921 16:84578669-84578691 AAGTGTGCACACACACACACAGG + Intronic
1141675442 16:85515066-85515088 ACGTGTGCACACACATCCATAGG - Intergenic
1141772067 16:86095566-86095588 GCATGTGCACACACGAACACGGG - Intergenic
1141990211 16:87604978-87605000 GCGCGCGCACACACACACACAGG - Intronic
1142116012 16:88356467-88356489 GCATGTGTACACACACACACAGG - Intergenic
1142268364 16:89076558-89076580 GCATGAGCACACACAGACAGTGG - Intergenic
1142309553 16:89304552-89304574 ACACGGGCACACACATACATGGG + Intronic
1142731434 17:1861117-1861139 TCGTGTCCACACACACACACGGG + Intronic
1145714849 17:27009815-27009837 ATGTGTGCACAGACATACATGGG - Intergenic
1146498782 17:33346511-33346533 GCATGTGCACACACATACACAGG - Intronic
1146845958 17:36182337-36182359 GCGTGCACACACACACACACAGG - Intronic
1147039167 17:37704212-37704234 GCCTGTGCCCTCCCATACATGGG - Intronic
1147882298 17:43661742-43661764 GTGTGTGCACACACCTATGTCGG + Exonic
1149093632 17:52815301-52815323 TCATGTGCAAAGACATACATAGG - Intergenic
1149170853 17:53809440-53809462 GCGTGTTCTCACTCATAGATGGG - Intergenic
1149351975 17:55799456-55799478 TCATGTGCAAACACACACATAGG - Intronic
1152101113 17:78302226-78302248 GCGTGTGCACACGCTAGCATAGG + Intergenic
1153408370 18:4765959-4765981 GCATGTTCTCACACATAAATAGG - Intergenic
1153582871 18:6592963-6592985 GCGTGCGCGCACACACACAGAGG - Intergenic
1155038041 18:22041868-22041890 GTGTGTGTACACACGTGCATGGG + Intergenic
1156089270 18:33445326-33445348 GTGTGTGCACACATGTGCATGGG + Intergenic
1156227219 18:35120977-35120999 GCGTGTGCACACACACATGCAGG - Intronic
1156501156 18:37559293-37559315 GTGTGTGCATACACACACACAGG - Intronic
1156504257 18:37578994-37579016 GCGCGTACACACACACACACAGG - Intergenic
1157050722 18:44161036-44161058 GCGTGTTCTCACTCATAGATGGG - Intergenic
1157336679 18:46744323-46744345 TCATGTGCAGAGACATACATAGG + Intronic
1159989608 18:74888913-74888935 GCACGTTCACACACACACATAGG + Intronic
1160002988 18:75045166-75045188 ACGTGTGCATGCACATACACAGG - Intronic
1160272520 18:77400576-77400598 GCATGTTCACACACATTCACAGG + Intergenic
1160543136 18:79636219-79636241 GCGTGTTCTCACTCATAGATGGG - Intergenic
1160860074 19:1233993-1234015 GCGTGTCCTCACACATGCAGGGG - Intronic
1161003289 19:1921957-1921979 GCTTATGCACACACATGCACGGG - Intronic
1161967780 19:7558099-7558121 GGATGTGCACACACGTAGATAGG + Intronic
1167050606 19:47075595-47075617 GTGTGTGCGCACACACACGTGGG - Intronic
1167095001 19:47370543-47370565 TGGTGTTAACACACATACATGGG - Intronic
1168530611 19:57125646-57125668 TCATGTGCAAAGACATACATAGG - Intronic
925067386 2:938988-939010 CCATGTGCACACGCATGCATGGG + Intergenic
925160520 2:1680630-1680652 GCTTGTGCACACCCAGGCATCGG + Intronic
925576933 2:5369768-5369790 GCATCTGCACACCCATACATTGG - Intergenic
927350748 2:22110999-22111021 GTGTGTGCACACACATATGTGGG - Intergenic
927516278 2:23673559-23673581 ACATGCTCACACACATACATGGG + Intronic
928584297 2:32742872-32742894 GTGTGCGCACACACACACAAGGG - Intronic
928790656 2:34948633-34948655 GCGTGTTCTCACTCATAGATGGG - Intergenic
930933161 2:56914383-56914405 TCATGTGCAAAGACATACATAGG - Intergenic
931960472 2:67476914-67476936 GCGTGTGCTCACACACACACAGG - Intergenic
931971456 2:67591167-67591189 TCATGTGCAGAGACATACATAGG + Intergenic
932379871 2:71272196-71272218 TCATGTGCAAAGACATACATAGG + Intergenic
932645078 2:73491832-73491854 GAGGTTGCACACACATACATGGG + Intronic
933063528 2:77767884-77767906 GAGTGTGCACACACCTAGCTGGG - Intergenic
934704709 2:96468908-96468930 GTGTGTACACAGACATGCATAGG + Intergenic
934837026 2:97599917-97599939 GCACGTGCACAGACACACATAGG - Intergenic
935003493 2:99045840-99045862 TCATGTGCAGAGACATACATAGG + Intronic
936292220 2:111235052-111235074 GCGGATGCACACAGAAACATGGG - Intergenic
936765181 2:115838776-115838798 GTGTGAGCACACACACACATAGG + Intronic
936806222 2:116335683-116335705 TCATGTGCACAGACACACATAGG - Intergenic
937018832 2:118632382-118632404 GCGTGTGCACACACATGGACTGG + Intergenic
937205983 2:120237491-120237513 GCGTGTGCACACGCACACATGGG + Intergenic
937611016 2:123861332-123861354 GCATGTTCTCACACATAAATGGG + Intergenic
937711126 2:124981302-124981324 ACGTGTGCACACACAAACATGGG - Intergenic
938798636 2:134739676-134739698 GCTGCTGCACAGACATACATAGG + Intergenic
939704187 2:145431584-145431606 GCGTGCTCACACACACACACTGG - Intergenic
940305684 2:152223590-152223612 GCGCGCACACACACATACACAGG + Intergenic
940439567 2:153698353-153698375 TCATGTGCAAAGACATACATAGG + Intergenic
941276822 2:163499923-163499945 TCATGTGCAAAGACATACATAGG + Intergenic
941277125 2:163503607-163503629 GCATGTTCTCACTCATACATGGG + Intergenic
941746951 2:169096972-169096994 GCACGTGCACACACACACAGAGG + Intergenic
941973472 2:171378195-171378217 TCATGTGCAAAGACATACATAGG + Intronic
942834567 2:180278021-180278043 GCATGTTCTCACTCATACATGGG + Intergenic
943130880 2:183851641-183851663 TCATGTGCAGAGACATACATAGG + Intergenic
943549837 2:189325084-189325106 GCGTGTGCTCACTCATAGGTGGG + Intergenic
945409419 2:209490537-209490559 TCGTGTGCAAAGACACACATGGG + Intronic
947744944 2:232502627-232502649 GCGTGCGCACACACAGTCCTGGG - Intergenic
1170226459 20:13995942-13995964 GCGTGTGTACACACGGACACCGG - Intronic
1170316460 20:15046532-15046554 GTGTGTGCGCACACATACCTAGG - Intronic
1170494407 20:16911312-16911334 TCGTGTGCAGAGACACACATAGG - Intergenic
1170837981 20:19901343-19901365 GCATCTGCACACAGATACATGGG + Intronic
1170910058 20:20557392-20557414 AAATGTGCACACACAAACATAGG + Intronic
1171247758 20:23626428-23626450 GCTTGTGAACACACATTCTTGGG + Intergenic
1171349740 20:24493451-24493473 ACAGGTACACACACATACATGGG + Intronic
1172823105 20:37756425-37756447 ACGGGTGCACACACACACAACGG - Intronic
1173087145 20:39933892-39933914 GTGTGTGTACACACACACACTGG + Intergenic
1173771583 20:45664304-45664326 TCATGTGCACAGACACACATAGG - Intronic
1176058938 20:63163612-63163634 GAGTGCGCACACACACACACAGG + Intergenic
1176106067 20:63388147-63388169 ACGTGCCCACACACATACACAGG + Intergenic
1176546216 21:8201418-8201440 GCGTGTTCTCACACATAAGTGGG + Intergenic
1176565167 21:8384464-8384486 GCGTGTTCTCACACATAAGTGGG + Intergenic
1177460041 21:21397509-21397531 GAGTGTGCACACACCTAGGTGGG + Intronic
1177465579 21:21474770-21474792 GTGTATACACACACATATATGGG - Intronic
1179038834 21:37783865-37783887 GCATGTGCACAGACACACAGAGG - Intronic
1180055024 21:45353175-45353197 GTATGTGCACACACATGCACAGG + Intergenic
1180080385 21:45484251-45484273 ATATGTGCACACACACACATAGG + Intronic
1180969595 22:19808217-19808239 GCATGCACACACACATGCATGGG + Intronic
1181048964 22:20229772-20229794 CCATGTGGACACACACACATGGG + Intergenic
1182051007 22:27312779-27312801 ATGTGTACACACACATGCATAGG + Intergenic
1183105577 22:35612848-35612870 GTGTGTGCACACTCACATATGGG + Intronic
1183620567 22:38969729-38969751 GCACGTGCACATGCATACATGGG - Intronic
1184026291 22:41859409-41859431 AAATGTGCACACACATACACAGG - Intronic
1184127035 22:42494780-42494802 GCGTGCGCACACACATGCATAGG + Intergenic
1203251088 22_KI270733v1_random:117655-117677 GCGTGTTCTCACACATAAGTGGG + Intergenic
950727290 3:14924630-14924652 GTGTATTCACAGACATACATTGG - Intronic
950836829 3:15928194-15928216 GCATGTACACACACATCCCTAGG - Intergenic
950994403 3:17480106-17480128 GGGTGTGCACACACATAGGGCGG + Intronic
951324230 3:21283623-21283645 TCATGTGCAAACACACACATAGG - Intergenic
951347987 3:21569825-21569847 GCGTGTTCTCACTCATAGATGGG + Intronic
951439779 3:22709156-22709178 TCATGTGCAGACACACACATAGG + Intergenic
952023838 3:29055497-29055519 TCATGTGCAAACACACACATAGG - Intergenic
952031936 3:29153661-29153683 GTGTGTGCACACACACATGTGGG - Intergenic
952615634 3:35269443-35269465 ACATATACACACACATACATAGG - Intergenic
953188118 3:40657178-40657200 TCATGTGCACATACATGCATAGG - Intergenic
955323696 3:57993401-57993423 GTGTGTGTATATACATACATGGG - Intergenic
955895637 3:63696498-63696520 CCATGTGCACAGACACACATTGG + Intergenic
956427481 3:69151787-69151809 GCGTTTGAACACACTTACATGGG + Intergenic
956636869 3:71373753-71373775 GCGTGTCCAGAAACATTCATAGG - Intronic
957891645 3:86366377-86366399 GGGTGTGGGCACACATACTTGGG - Intergenic
957972686 3:87403418-87403440 CCATGTGCAGACACACACATAGG + Intergenic
958423233 3:93951840-93951862 TCATGTGCACAGACACACATAGG + Intronic
959688268 3:109171051-109171073 GTATGTGTGCACACATACATAGG + Intergenic
960770441 3:121187800-121187822 TCATGTGCAAAAACATACATAGG + Intronic
961501481 3:127338779-127338801 GCATATGCGCACACACACATAGG + Intergenic
961931130 3:130533922-130533944 GCGTGCACACACACATACGTGGG - Intergenic
961979056 3:131057111-131057133 GCGTGTTCTCACTCATAGATGGG - Intronic
962249958 3:133829915-133829937 ATGTGTGTACACACACACATGGG - Intronic
962291659 3:134142125-134142147 TCATGTGCAGAGACATACATAGG + Intronic
963385493 3:144587575-144587597 GCATGTGTACACACATAAATGGG - Intergenic
964007541 3:151850155-151850177 TCGTGTGCAAAGACACACATAGG - Intergenic
964113825 3:153114561-153114583 GCATGTTCTCACTCATACATGGG + Intergenic
965017129 3:163172545-163172567 TCATGTGCAAAGACATACATAGG - Intergenic
966361549 3:179135538-179135560 GCATGTTCTCACCCATACATGGG + Intergenic
966539405 3:181073231-181073253 TCATGTGCAGAGACATACATAGG - Intergenic
967160847 3:186736604-186736626 GCATGTGCACACACAGATCTTGG - Intronic
967204201 3:187104315-187104337 CCTTGTGCACGCACATACACAGG + Intergenic
967357523 3:188588801-188588823 GTTTGTGGACACACATACACTGG - Intronic
968564765 4:1305710-1305732 GCGTGCGCACACACACATGTGGG - Intronic
969504878 4:7579354-7579376 GTGCGTGCACACACACACACGGG - Intronic
970085631 4:12343147-12343169 TCATGTGCACAGACACACATAGG + Intergenic
970221429 4:13815876-13815898 GTGTGTGTACACACGGACATAGG - Intergenic
970631160 4:17947170-17947192 GCGTACACACACACATACAATGG + Intronic
971031799 4:22645753-22645775 GTGTGTACACACACACACACAGG + Intergenic
971733155 4:30411887-30411909 GTGTGTGTACACACATACACAGG + Intergenic
972122000 4:35714654-35714676 GCGTGTTCTCACTCATAGATGGG - Intergenic
974196565 4:58583500-58583522 TCGTGTGCAAAGACATACATAGG - Intergenic
974720094 4:65726911-65726933 TCATGTGCAAAGACATACATAGG + Intergenic
974885499 4:67811908-67811930 TCATGTGCAAAGACATACATAGG + Intergenic
975150372 4:71014026-71014048 TCATGTGCAGAGACATACATAGG + Intronic
975305982 4:72849032-72849054 TCATGTGCAAAGACATACATAGG + Intergenic
976506260 4:85851331-85851353 TCATGTGCAGACACACACATGGG - Intronic
977318622 4:95482776-95482798 GCGTGTTCTCACTCATAGATGGG + Intronic
977455820 4:97258480-97258502 TCATGTGCACAGACACACATAGG - Intronic
977502778 4:97862204-97862226 GTGTGTGCAGAGACACACATAGG + Intronic
977631252 4:99246103-99246125 TCATGTGCAAACACAGACATAGG - Intergenic
977770601 4:100853431-100853453 ATGTGTGCACACACACACAATGG - Intronic
978018942 4:103785181-103785203 CTGTGAGCATACACATACATAGG + Intergenic
978179308 4:105774236-105774258 TCATGTGCAAAGACATACATAGG - Intronic
979281480 4:118873031-118873053 GTGTGTGTACACACACACAATGG - Intronic
979446406 4:120818252-120818274 GCGTGCACACACACACACACAGG + Intronic
981638966 4:146913151-146913173 GCCAGTGCATACACATACAAAGG - Intronic
981775021 4:148356715-148356737 TTATGTACACACACATACATAGG - Intronic
982060037 4:151595907-151595929 TCATGTGCAAAGACATACATAGG - Intronic
983832933 4:172352753-172352775 GAGTATGCACACACAAACAGAGG + Intronic
983895283 4:173074890-173074912 GCGTGCACACACACACACACGGG + Intergenic
985053071 4:186012238-186012260 GTGTGTGCACACACACGCATAGG + Intergenic
985383809 4:189424147-189424169 GTGTGTGCACAAACCCACATGGG - Intergenic
986386635 5:7240561-7240583 GCATGTTCTCACTCATACATGGG - Intergenic
986522560 5:8636297-8636319 ACATGTGCATACACATGCATAGG - Intergenic
986923000 5:12710568-12710590 ACATGTACACACACATGCATGGG - Intergenic
987274841 5:16351639-16351661 GCGCGCGCACACACACACACAGG + Intergenic
988029455 5:25743888-25743910 GTGTGTGGACACACAAACATGGG - Intergenic
988306330 5:29498901-29498923 GCCTGTGCACACATATGCAGTGG + Intergenic
989517019 5:42355429-42355451 TCGTGTGCAAAAACACACATAGG + Intergenic
989733075 5:44670624-44670646 TCATGTGCACAGACATACATAGG + Intergenic
989747349 5:44845822-44845844 GCGTGCACACACACACACACGGG + Intergenic
991101914 5:62802854-62802876 TCATGTGCAGAGACATACATAGG - Intergenic
991229653 5:64317158-64317180 GTGTGTACACACACATATACAGG + Intronic
991611131 5:68450682-68450704 GTGTGTGCACACACACATACAGG + Intergenic
993811436 5:92482874-92482896 GCGTGTGCACACACACACGCAGG + Intergenic
993822435 5:92635278-92635300 GCGCGTGCACATACACACACAGG + Intergenic
993836187 5:92822998-92823020 GCGTGTGCACACTTATAAGTTGG + Intergenic
994405033 5:99334785-99334807 GCATGCACACACACATACACAGG + Intergenic
994758568 5:103825173-103825195 GTGTGTGTGCACACATGCATGGG - Intergenic
995112077 5:108439439-108439461 TCATGTGCACAGACACACATAGG + Intergenic
995467330 5:112464617-112464639 TCATGTGCAGAGACATACATAGG - Intergenic
995660667 5:114479156-114479178 TCATGTGCAGACACACACATAGG + Intronic
995815959 5:116168090-116168112 TCGTGTGCAAAGACACACATAGG + Intronic
996482007 5:123986500-123986522 TCATGTGCAAAGACATACATAGG - Intergenic
996690542 5:126335449-126335471 GAGAGTGCACCCAAATACATAGG - Intergenic
998571302 5:143260631-143260653 GTGTGTGCACACACACAAATGGG + Intergenic
998717991 5:144907789-144907811 TCATGTGCAAAGACATACATAGG + Intergenic
998768441 5:145514250-145514272 TCATGTGCACAGACACACATAGG + Intronic
999415607 5:151393285-151393307 TCATGTGCAGACACACACATAGG - Intergenic
1000981944 5:167825573-167825595 GCGTGCACACACACATGCATAGG + Intronic
1001425928 5:171622367-171622389 GCATGCTCACACACACACATAGG + Intergenic
1002394891 5:178944993-178945015 ACATGTGCATACACACACATGGG - Intronic
1002853260 6:1015513-1015535 GCGTGTTCACACTCATAAGTGGG + Intergenic
1002901539 6:1414144-1414166 GCTTGTGCAGACAGATGCATAGG - Intergenic
1003145513 6:3506960-3506982 CAGTGTGCATACACATACACAGG - Intergenic
1003877711 6:10452945-10452967 GCACGTGCACACACACACACAGG - Intergenic
1004760343 6:18658648-18658670 TCATGTGCAAAGACATACATAGG + Intergenic
1006839382 6:37018607-37018629 GGGTGTGGACACACATACCTAGG + Intronic
1007037950 6:38695374-38695396 GTGTGTGTATACATATACATGGG - Intronic
1007206600 6:40157520-40157542 TCATGTGCACATACATACAAGGG - Intergenic
1007247347 6:40472066-40472088 GCATGTGCACACACACACCGGGG - Intronic
1008295534 6:49771442-49771464 GCATGTTCTCACTCATACATGGG - Intergenic
1009341101 6:62555831-62555853 TCATGTGCACAGACACACATAGG + Intergenic
1010002565 6:70962480-70962502 TTGTGTGCACACGCATGCATGGG + Intergenic
1010468232 6:76194065-76194087 GCATGTTCACACTCATAGATGGG + Intergenic
1010879229 6:81147561-81147583 GCGTGTTCCCACTCATACGTGGG - Intergenic
1011578447 6:88829640-88829662 GTGTGTGCAAAGACACACATAGG + Intronic
1011997747 6:93614666-93614688 TCTTATGCACACACTTACATAGG + Intergenic
1012757403 6:103249380-103249402 TCATGTGCAGAGACATACATAGG + Intergenic
1013193506 6:107824889-107824911 GTGTGTGCACACACCTGGATAGG - Intergenic
1014729391 6:125014072-125014094 TAGTGTGTACACACATACAGAGG + Intronic
1015002773 6:128239910-128239932 GCGTGTGCACACGCATGTAGTGG - Intronic
1015305494 6:131701914-131701936 ACGCGTGCACACGTATACATAGG + Intronic
1015875768 6:137820584-137820606 ACGTGCACACACACACACATAGG + Intergenic
1016247571 6:142002201-142002223 GCATGTGCACACACAAAAAAGGG - Intergenic
1016659163 6:146556199-146556221 GCGTGTTCTCACTCATAGATGGG - Intergenic
1016864510 6:148751647-148751669 GGGGGAGCACAAACATACATTGG + Intronic
1018798134 6:167202965-167202987 GGATGTGCACACACACACACGGG + Intergenic
1018814581 6:167321211-167321233 GGATGTGCACACACACACACGGG - Intergenic
1019295736 7:273058-273080 TCGTGTGCACACACACACCCAGG + Intergenic
1019521571 7:1462972-1462994 GTGTGTACACATACATATATGGG + Intergenic
1019601810 7:1887966-1887988 GCATGCACACACACATGCATAGG - Intronic
1019601833 7:1888311-1888333 ACGCATGCACACACACACATAGG - Intronic
1019965246 7:4493506-4493528 ACGTGTGCACACAAAGAGATGGG + Intergenic
1020584520 7:10049591-10049613 TCATGTGCAAAGACATACATAGG + Intergenic
1020751752 7:12149297-12149319 GTGTGTGCACACACAAATAATGG + Intergenic
1021322539 7:19229122-19229144 TCATGTGCAAAGACATACATAGG + Intergenic
1022344381 7:29500150-29500172 GTGTGTGCGCACACATGCGTAGG - Intronic
1022696755 7:32713931-32713953 GCATGTTCACACTCATAGATAGG + Intergenic
1024532113 7:50401900-50401922 ATGTGTGTCCACACATACATAGG + Exonic
1025146533 7:56510293-56510315 TCATGTGCAGAGACATACATAGG - Intergenic
1027447033 7:78286094-78286116 TAGTGTGCACACACACACAATGG - Intronic
1027810958 7:82897480-82897502 GTGTATACACACACATACATAGG + Intronic
1028578696 7:92382000-92382022 TCATGTGCAGAGACATACATAGG + Intronic
1028697096 7:93727149-93727171 GTGTATGAAAACACATACATTGG - Intronic
1029057611 7:97762668-97762690 TCATGTGCAGACACACACATAGG + Intergenic
1029855077 7:103506793-103506815 TCATGTGCAAAGACATACATAGG + Intronic
1030331517 7:108276618-108276640 TCATGTGCACAGACACACATAGG - Intronic
1030708143 7:112716493-112716515 GCCTGTTCTCACTCATACATGGG - Intergenic
1031339767 7:120584766-120584788 GCGTGCACACACACACACTTTGG + Intronic
1031547465 7:123068183-123068205 GCGTGTGCACACACTTGTACTGG + Intergenic
1031743302 7:125462163-125462185 GAGTCTGCATACACATACAAGGG - Intergenic
1033991670 7:147295250-147295272 ACGCATGCACACACACACATGGG - Intronic
1034491048 7:151393285-151393307 CTGTGTGCACACACAGGCATAGG - Intronic
1034831558 7:154312609-154312631 CCCTCTGCCCACACATACATGGG - Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035389085 7:158493419-158493441 ACGTATGCACACACGTACATGGG + Intronic
1035389093 7:158493575-158493597 ACGTATGCACACACGTACATGGG + Intronic
1035389101 7:158493731-158493753 ACGTATGCACACACGTACATGGG + Intronic
1035448961 7:158962771-158962793 GTGTATGCACACACATACACGGG - Intergenic
1035628544 8:1091530-1091552 GTGTGTGCACACACATAGGTGGG - Intergenic
1035891522 8:3348984-3349006 ACGGGTGCACACACACACAGAGG + Intronic
1035964928 8:4180344-4180366 GCATGTTCTCACTCATACATGGG + Intronic
1035978755 8:4344055-4344077 GTGTGCGCACACACATACTCTGG + Intronic
1036772221 8:11587161-11587183 GTGTGTGCGCACACACGCATGGG - Intergenic
1037001931 8:13730202-13730224 GAATTTGCAGACACATACATTGG + Intergenic
1037529472 8:19758663-19758685 GCATACGTACACACATACATAGG + Intergenic
1037784401 8:21893980-21894002 GTGTGCACACACACACACATTGG + Intergenic
1039829692 8:41203187-41203209 GAATGCGCACACACAGACATGGG + Intergenic
1040640474 8:49328578-49328600 GTGTGTGTACACATATAAATAGG - Intergenic
1040738805 8:50546606-50546628 GCATGTTCTCACTCATACATGGG - Intronic
1041161768 8:55052099-55052121 TCATGTGCAGAAACATACATAGG + Intergenic
1041208992 8:55527987-55528009 GTGTGTGTACATACATATATAGG - Exonic
1043072389 8:75655221-75655243 ATATGTGCACACACATAGATTGG - Intergenic
1043233847 8:77835619-77835641 GCATGTTCTCACTCATACATGGG + Intergenic
1043410096 8:79984533-79984555 TCATGTGCACAGACACACATAGG + Intronic
1044388697 8:91622774-91622796 GTGTCTGCACACACACACACAGG + Intergenic
1045648058 8:104318407-104318429 GCGTGTGCACTCAGATGCATGGG - Intergenic
1045877756 8:107002008-107002030 TCATGTGCAAAGACATACATAGG + Intergenic
1046470880 8:114672277-114672299 GCATGTTCTCACACATAAATTGG - Intergenic
1046984125 8:120368961-120368983 GTGTGTGCACGCCCATAGATTGG + Intronic
1048709292 8:137190039-137190061 GTGTCTGCACACACTTAGATAGG + Intergenic
1048882192 8:138880335-138880357 GCGCGTGCACACACACGCACAGG - Intronic
1049342832 8:142122678-142122700 GTGTGTGTGCACGCATACATGGG - Intergenic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1050053607 9:1629029-1629051 GCATGTTCTCACTCATACATAGG + Intergenic
1050320917 9:4451107-4451129 TCATGTGCAGAGACATACATAGG + Intergenic
1051156464 9:14152800-14152822 GCATGTTCTCACTCATACATGGG + Intronic
1052199981 9:25766140-25766162 TCATGTGCACAGACATACATAGG + Intergenic
1052489432 9:29145998-29146020 GCATGCACACACATATACATTGG + Intergenic
1053172857 9:35903305-35903327 GCGTGTGCACACACAGTTATTGG + Intergenic
1054339530 9:63845612-63845634 TCATGTGCAGACACACACATAGG + Intergenic
1054863499 9:69976469-69976491 GCATGTTCAGACACATCCATTGG + Intergenic
1054987160 9:71275487-71275509 ACATGTGCACACACACACACGGG - Intronic
1057896667 9:98914688-98914710 GCGTGTTCTCACTCATACGTGGG - Intergenic
1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG + Intergenic
1058064611 9:100535049-100535071 GGGTGTGCAAAAACAGACATTGG + Intronic
1059075388 9:111187865-111187887 GTGTGTATACACACATACAAGGG - Intergenic
1059927742 9:119228298-119228320 ACGTGTATACACACACACATAGG + Intronic
1062025774 9:134339748-134339770 GGGTGTGCACAGACACACACGGG - Intronic
1062232041 9:135487170-135487192 GCGTGTGCACACGCAGCCAGAGG + Exonic
1203467493 Un_GL000220v1:100922-100944 GCGTGTTCTCACACATAAGTGGG + Intergenic
1203398046 Un_KI270519v1:45990-46012 TCGTGTGCAGAGACACACATAGG + Intergenic
1203399698 Un_KI270519v1:74983-75005 TCATGTGCAGAGACATACATAGG + Intergenic
1185470524 X:379260-379282 ACAGGTGCATACACATACATAGG - Intronic
1185579592 X:1200863-1200885 GTGTGTGTACACACACATATAGG + Intronic
1185700973 X:2229568-2229590 GTGTGTGCACAGATATGCATAGG + Intronic
1187039208 X:15575571-15575593 GCGTGTACACACACACACAGAGG - Intronic
1187759457 X:22564508-22564530 GCGTGTTCTCACTCATAAATGGG + Intergenic
1188037054 X:25330293-25330315 TCATGTGCACAGACACACATAGG + Intergenic
1188129789 X:26417645-26417667 TCATGTGCAAAGACATACATAGG - Intergenic
1188267116 X:28090840-28090862 GCGTGTTCTCACACATAAGTGGG - Intergenic
1188310599 X:28612303-28612325 AGGGGTGCACACACAAACATTGG + Intronic
1189222851 X:39387621-39387643 GCATGTGCACACACACACAGAGG + Intergenic
1189263776 X:39698046-39698068 GCGTGTGCACACACACACACAGG - Intergenic
1190298277 X:49041266-49041288 GTGTGTACACACATATACCTGGG - Intronic
1191074897 X:56442291-56442313 GCATGTTCTCACACATAAATAGG + Intergenic
1191084497 X:56549468-56549490 TCATGTGCACAGACACACATGGG + Intergenic
1191591541 X:62890357-62890379 TCATGTGCAAAGACATACATAGG + Intergenic
1191771376 X:64762919-64762941 TCATGTGCAAAGACATACATAGG - Intergenic
1191809305 X:65169916-65169938 TCGTGTGCAGAGACACACATAGG - Intergenic
1192952631 X:76033458-76033480 GCATGTTCTCACTCATACATGGG - Intergenic
1193727947 X:85065261-85065283 GCATGTGCAAAGACACACATAGG - Intronic
1193840111 X:86399264-86399286 TCATGTGCAGAGACATACATAGG - Intronic
1193901752 X:87187823-87187845 GTGTGTGTATACACATACATAGG - Intergenic
1194046465 X:89011661-89011683 AAGTGTGCACACACACAAATGGG - Intergenic
1194078106 X:89422665-89422687 ACATATGCACACACATACAATGG + Intergenic
1194630022 X:96271622-96271644 TCATGTGCAGACACACACATAGG + Intergenic
1194986847 X:100499772-100499794 GCATGTTCTCACACATATATGGG + Intergenic
1195117063 X:101709729-101709751 GTGTGTGCACACGTATGCATGGG + Intergenic
1195217830 X:102717775-102717797 TCGTGTGCACTTACAAACATAGG + Intergenic
1196439448 X:115704912-115704934 GTTTGTGCATCCACATACATAGG - Intergenic
1196476188 X:116089915-116089937 TCATGTGCAAACACACACATAGG - Intergenic
1197365127 X:125555104-125555126 GCATGTTCTCACTCATACATGGG + Intergenic
1197506231 X:127308041-127308063 TCGTGTGCAAAGACACACATAGG + Intergenic
1199504346 X:148544481-148544503 ATGTGTGCACACTCACACATTGG - Intronic
1200375505 X:155775554-155775576 TTGTGAGCACACACACACATCGG - Exonic
1200430752 Y:3078211-3078233 ACATATGCACACACATACAATGG + Intergenic
1200740053 Y:6844749-6844771 TCATGTGCAAACACACACATAGG - Intergenic
1200798659 Y:7364590-7364612 GCATTGGCACACACATGCATTGG + Intergenic
1200973741 Y:9184320-9184342 GCATGTTCACACTCATGCATGGG + Intergenic
1202137376 Y:21680474-21680496 GCATGTTCACACTCATGCATGGG - Intergenic
1202232708 Y:22672081-22672103 GCCTCTGGACACACACACATGGG + Intergenic
1202310448 Y:23524077-23524099 GCCTCTGGACACACACACATGGG - Intergenic
1202560354 Y:26146517-26146539 GCCTCTGGACACACACACATGGG + Intergenic