ID: 1133512583

View in Genome Browser
Species Human (GRCh38)
Location 16:6474053-6474075
Sequence GGGCTGGTTACTGCAAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133512578_1133512583 2 Left 1133512578 16:6474028-6474050 CCTGTAGACAATAAGCTGGTTTC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG 0: 1
1: 0
2: 5
3: 24
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133512583 Original CRISPR GGGCTGGTTACTGCAAACTG TGG Intronic
900764555 1:4495087-4495109 GGGCTGATTCCTTCTAACTGGGG - Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902658542 1:17886007-17886029 CGGCTGGTTACTGAAAGCTCAGG + Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
913455561 1:119027002-119027024 GGGGAGGCTACTGCAAACTCAGG + Intergenic
915812011 1:158923131-158923153 GGGTAGGTGACTGCAAAGTGAGG + Intergenic
918068548 1:181118348-181118370 GGGCTGGTTCCTGTGTACTGTGG + Intergenic
918088998 1:181271557-181271579 GGAATGGTTACTTCAAATTGAGG + Intergenic
919345250 1:196367874-196367896 GGGCAGATTATTGCCAACTGAGG - Intronic
919791644 1:201294572-201294594 GGGCAAGTTACTTCAAACTTTGG + Intronic
920098942 1:203504794-203504816 GGGCTGGTTCCTGGCTACTGGGG + Intronic
920552245 1:206872347-206872369 GGGCTGGTTGTTGCAGATTGTGG - Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
1062799654 10:369609-369631 GGGCTGGTTACTGTCATCCGTGG + Exonic
1063114578 10:3064716-3064738 TGACAGATTACTGCAAACTGTGG - Intergenic
1063882229 10:10542883-10542905 GGGCTGGACACTGCAGACTGTGG + Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064452243 10:15453008-15453030 GGGCGGGTTCCGGCAAGCTGAGG + Intergenic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065906803 10:30262253-30262275 GGGCTAGGGAATGCAAACTGGGG + Intergenic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1066654912 10:37688139-37688161 GGGCTGGTTACTGCCTGGTGGGG - Intergenic
1067039868 10:42943609-42943631 GGGCTGGTTACTGCCTGGTGGGG - Intergenic
1067564195 10:47325228-47325250 GGGCAGGTTTCTGGAACCTGGGG - Exonic
1069993883 10:72331154-72331176 GTGCTGATTACTTCAAACTGGGG - Intergenic
1070587508 10:77777753-77777775 GGACTGGTTACTGCAGACTGTGG - Intergenic
1074363441 10:112840071-112840093 GGCCAGGTTGCTGCAGACTGTGG - Intergenic
1076011174 10:126989917-126989939 GGGCGGGCTGCTGCACACTGTGG - Intronic
1076042925 10:127266875-127266897 GCCCTGGTGCCTGCAAACTGGGG - Intronic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1077659698 11:4056613-4056635 TGGCTGGAGACTGCAAAGTGTGG - Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1084589890 11:70084515-70084537 GGGTTGGTTTCTGCTAAATGCGG - Intronic
1085369480 11:75986773-75986795 GGGGTGGTTACTTAGAACTGGGG - Intronic
1085505424 11:77056130-77056152 GGGCTGGTTCCTGGAAAGTAGGG + Intergenic
1086295023 11:85356328-85356350 AGTCTGTTTACTTCAAACTGAGG + Intronic
1087987689 11:104704973-104704995 GTGCTGGTAGCTGCAAATTGTGG - Intergenic
1089461298 11:118655901-118655923 GTGCTGGTTACAGCTAAGTGGGG - Intronic
1093512827 12:19949227-19949249 GGGCTGGTTGCTGCAGACTGTGG - Intergenic
1094049593 12:26204598-26204620 GGGGTGGTGATTGCATACTGTGG + Intronic
1094794597 12:33956543-33956565 GGGCTAGTTACTGCAGATTGAGG - Intergenic
1095628040 12:44341300-44341322 GGGCTGGGCACTGCACACTTGGG - Intronic
1095724392 12:45435944-45435966 GGGCAGGTTGCTGCAGGCTGAGG - Intronic
1097573795 12:61365211-61365233 GAGCTGGTTGCTGCAGACTGTGG + Intergenic
1097688617 12:62713643-62713665 GGGATGGGTACTGATAACTGTGG - Intronic
1098756503 12:74370295-74370317 GGGCTCGTTAATGCAAAGTTGGG + Intergenic
1100814354 12:98371656-98371678 AGGCTGGTTGCTGCAGATTGTGG + Intergenic
1102645962 12:114404039-114404061 GTGCTGGTAGCTGGAAACTGGGG - Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105016396 12:132788516-132788538 GGGCTGGCTTCTGCACACAGTGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106001270 13:25725555-25725577 GCGCTGGTCACTGCATGCTGTGG + Intronic
1106105891 13:26733313-26733335 AGGCTGGTTTCTGCACATTGTGG - Intergenic
1107095828 13:36534044-36534066 GGGCAGGTTGCTGCAGATTGTGG + Intergenic
1108212463 13:48152138-48152160 GGGCAGGTGACAGCAGACTGAGG + Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109459225 13:62632870-62632892 GCGGTGGTTGCTGAAAACTGAGG + Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1110967108 13:81713535-81713557 GGGATGGTTACTGGGGACTGGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1112802057 13:103123752-103123774 GAGCTGGTTACTGTAGACAGTGG - Intergenic
1114648486 14:24268737-24268759 GGGCCGGTTCCTGCCATCTGGGG + Exonic
1115111998 14:29835488-29835510 AGGCTGGTCAGTGGAAACTGGGG - Intronic
1115894711 14:38073359-38073381 GGGATCTTCACTGCAAACTGAGG + Intergenic
1115980340 14:39045114-39045136 GGTCTTGTTACTGCAATGTGTGG - Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1117376446 14:55122482-55122504 TGGCTGTTTACTATAAACTGTGG - Intergenic
1118951412 14:70439554-70439576 CTGCTGGTTTCTGCCAACTGGGG + Intergenic
1119902070 14:78269652-78269674 GGGCTTCTGACTCCAAACTGAGG + Intronic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1122097866 14:99384593-99384615 GGGCTGGTGGCTGCATTCTGGGG - Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1124603277 15:31151877-31151899 TGCCTGGTTCCTGCACACTGAGG - Intronic
1124935031 15:34161835-34161857 GGGTTGTTTACTGGAAACTAGGG + Intronic
1126733950 15:51712957-51712979 GGGATGGTTCTTCCAAACTGAGG - Intronic
1128912646 15:71530277-71530299 GGGCTGGTTCCAGCAAGTTGAGG + Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1131054048 15:89365233-89365255 GGGCTGGGCACTGCCAGCTGAGG - Intergenic
1133145445 16:3782271-3782293 AGGCTGGTCACTTCCAACTGAGG + Intronic
1133475235 16:6114968-6114990 GGACAAGTTAATGCAAACTGAGG + Intronic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1136607468 16:31346140-31346162 GGGCTGGTTGCTGCAGGCTGGGG - Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142747854 17:1968945-1968967 GGGCTGGTTGCTGCAGACCATGG - Intronic
1145285642 17:21504140-21504162 GGGCTGGTTGCTGCAGATTATGG + Intergenic
1145391882 17:22461559-22461581 GGGCTGGTTGCTGCAGATTATGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1147344453 17:39779739-39779761 GGGCAGGTGAGGGCAAACTGTGG - Intronic
1147510737 17:41066773-41066795 AGGCTACTTACTGCAGACTGAGG - Intergenic
1147654072 17:42078550-42078572 ATCCTGATTACTGCAAACTGAGG - Intergenic
1149435361 17:56629306-56629328 GGGCTGGTGACTGAGCACTGGGG + Intergenic
1150993163 17:70284438-70284460 AAGCTGGTTACTACAGACTGGGG - Intergenic
1151408767 17:73907042-73907064 GTGCTGGTCACTGCAGCCTGGGG + Intergenic
1151483855 17:74386505-74386527 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
1151905465 17:77045611-77045633 GGGTTGGTTAATGCAGAGTGAGG - Intergenic
1152660210 17:81538558-81538580 GGGCTGGGGACTGCCCACTGTGG + Intergenic
1153833526 18:8944060-8944082 GAGCTGGTCACTGCAGATTGTGG - Intergenic
1153986633 18:10356817-10356839 GAACTGGTTACTGTAAACAGTGG - Intergenic
1153986669 18:10357087-10357109 GGGCTGGTTACTGTAGATGGTGG - Intergenic
1153986680 18:10357155-10357177 GGGCTGGTTACTGTAGATGGTGG - Intergenic
1159017365 18:63112262-63112284 GGGCTGGCTGCTGTAGACTGTGG - Intergenic
1159611249 18:70527767-70527789 GGGCTGGCTGCTGCAGATTGTGG + Intergenic
1162501328 19:11055649-11055671 GGGGGGCTTACTGCACACTGTGG - Intronic
1165136887 19:33675182-33675204 GGCCTGGCTACTGGAAACAGCGG - Intronic
1165225618 19:34352731-34352753 GGGCTGGTGACTGCATAGAGTGG - Exonic
1165423016 19:35731766-35731788 TGGGTGGTCACTGGAAACTGGGG + Intronic
925270817 2:2606199-2606221 GGGCTGGATGCTGCAAGCAGCGG - Intergenic
927209768 2:20631914-20631936 GGGCAGGTTACTGCAGACTGTGG - Intronic
927413842 2:22856142-22856164 GGTCTGGTTACAGAAAACAGAGG + Intergenic
929101303 2:38317072-38317094 TGGCTAGGTACTTCAAACTGAGG + Intronic
929450395 2:42033117-42033139 GAGCTGGATGCTGCAGACTGGGG + Intergenic
930921140 2:56755292-56755314 TGGGTGGTTACTGTAGACTGGGG + Intergenic
931954955 2:67412638-67412660 GGGTTGCTTACTGCAGACAGTGG + Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
932070058 2:68611074-68611096 ATGCTGATTACTTCAAACTGAGG - Intronic
934729683 2:96648734-96648756 GGGCTGGTTGCTGCAGATGGTGG + Intergenic
937882400 2:126878230-126878252 GGGCTGGTTACAGCACGATGAGG + Intergenic
938058930 2:128237348-128237370 GGCCTGGTTGCTGCAGATTGCGG - Intronic
938618309 2:133022406-133022428 ATGCTGATTACTTCAAACTGAGG + Intronic
940367484 2:152864118-152864140 GGGCTGGTTGCTGCAATTTGTGG + Intergenic
942389777 2:175479772-175479794 GAGCTGGTGACTGGAAGCTGTGG + Intergenic
944297688 2:198085563-198085585 GGGCTGGTTTCTTCAAAACGGGG + Exonic
947617561 2:231568304-231568326 AGGCTGGTGTCTGCAAGCTGAGG + Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1169074816 20:2754033-2754055 GGGCTGGGTTCTGCACACTGGGG - Intronic
1172121390 20:32600985-32601007 GGGCTGGGTGCTGCATACAGTGG - Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173702287 20:45083369-45083391 GGGCAGGTTACTGCAGGTTGTGG + Intergenic
1173996611 20:47343416-47343438 GGGATGGTTACTTTATACTGTGG - Intronic
1176386535 21:6140916-6140938 TGGAAGTTTACTGCAAACTGGGG + Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178461092 21:32803074-32803096 GGGCTAGTTATGGCAAACTATGG + Intronic
1179736938 21:43397336-43397358 TGGAAGTTTACTGCAAACTGGGG - Intergenic
1179801167 21:43812072-43812094 TGGCTTGTTTCTGGAAACTGAGG + Intergenic
1183225495 22:36547072-36547094 GGGCTGGAGACTGCAAAGAGAGG + Intergenic
951218341 3:20044522-20044544 GGCCTGGCTACTGCTATCTGTGG + Intronic
952427484 3:33190667-33190689 ATGCTGATTACTTCAAACTGAGG + Intronic
954777442 3:53032852-53032874 AGGGTGGTTAATGCAACCTGAGG + Intronic
955101567 3:55854821-55854843 GGCCTGCATACTGTAAACTGGGG + Intronic
956237057 3:67084025-67084047 GGACTGGCTGCTGCAGACTGTGG + Intergenic
957295754 3:78330672-78330694 GATCTGGTTAATGCAAAGTGTGG + Intergenic
957989034 3:87607741-87607763 GTGCTGATTACTTTAAACTGAGG - Intergenic
957990138 3:87616263-87616285 GTGCTGATTACTTTAAACTGAGG - Intergenic
961471927 3:127120558-127120580 TGGCTGGTTGCTGCAGATTGTGG + Intergenic
962488457 3:135867231-135867253 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
965514686 3:169608336-169608358 AGGGTGGTTTCTGCAAACTAGGG - Intronic
967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG + Intergenic
969668734 4:8577423-8577445 GTGCTGGATACAGCAGACTGTGG + Intronic
970208228 4:13678408-13678430 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
971276687 4:25205168-25205190 GGGTTGGTTACTACAGATTGTGG - Intronic
971409583 4:26355864-26355886 GGGATGGTTAATTCAGACTGGGG + Intronic
972401944 4:38713021-38713043 GGGCTAGTTGCTGCAGATTGTGG + Intergenic
972608510 4:40635567-40635589 GGGCTGGCTACTGCATTCTAGGG - Intergenic
976775609 4:88702926-88702948 GGGCAGGTTGCTGCAGATTGTGG - Intronic
978118134 4:105047129-105047151 GGGATGAGTACTGCAACCTGAGG + Intergenic
983203631 4:164888552-164888574 GGGCTGGTTGCTGCAGTTTGTGG + Intronic
983811829 4:172072083-172072105 GGGCAGGTTGCTGCAGATTGTGG + Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986646394 5:9920700-9920722 GGACTGGTTGCTGCAGGCTGCGG + Intergenic
988865569 5:35330876-35330898 GGTCTGGTTATTGCAAAGTGGGG + Intergenic
990115584 5:52386331-52386353 GGGGTAGTTACTAGAAACTGAGG + Intergenic
992226520 5:74624305-74624327 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
996670888 5:126115520-126115542 GGGCTGGTTGCTGCAGGTTGTGG + Intergenic
997810056 5:136958228-136958250 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
1003461620 6:6334067-6334089 GGGCAGGTTGCTGCAGGCTGTGG + Intergenic
1004039349 6:11960543-11960565 GGGCTGGTTGCTGCAGGTTGAGG - Intergenic
1005970317 6:30755929-30755951 GGGCAGGTTACTGGCCACTGAGG - Intergenic
1008146182 6:47894219-47894241 GGACTGATTGCAGCAAACTGTGG - Intronic
1008702017 6:54112252-54112274 TTGCTGTTTACTGCATACTGTGG - Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1012412392 6:98973737-98973759 GGACTGATTACTGCACACTGTGG + Intergenic
1014480363 6:121928372-121928394 GGGCTGATTAATGCTAATTGTGG - Intergenic
1014713376 6:124835625-124835647 GGGCTAGTTCCTGAGAACTGAGG + Intergenic
1015599996 6:134902631-134902653 GGGGTGGTTGCTGCAAGCAGGGG - Intergenic
1016386429 6:143535474-143535496 AGGCTGGTTACTTCAAACTGAGG + Intergenic
1016574244 6:145550105-145550127 CTGCTGATTACTTCAAACTGAGG + Intronic
1016797955 6:148137947-148137969 GGGCTGGTTGCTGCAGACTGTGG + Intergenic
1016849336 6:148601157-148601179 GGGCTGGTTACTCCAAGTTGTGG - Intergenic
1022966760 7:35481409-35481431 GGGCTGGTGATTGCAAGGTGAGG - Intergenic
1023992326 7:45135671-45135693 CGGCTGGTTGCTGCAGACTATGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1027560017 7:79717709-79717731 GGGCTGGCAAATGCGAACTGTGG - Intergenic
1031795584 7:126170269-126170291 GGGCTGGTTGCTGCAGATTGCGG + Intergenic
1034018248 7:147610480-147610502 ATGCTGGTTGCTTCAAACTGAGG - Intronic
1036605085 8:10297545-10297567 TGGCTGGTTCCTGTAAAGTGTGG + Intronic
1036610631 8:10346881-10346903 GGGCTGGTTGCTGCAGGTTGTGG + Intronic
1036746988 8:11416928-11416950 TGGCTGGTGACGTCAAACTGTGG - Intronic
1039250666 8:35660743-35660765 GGGTTGTTTACTGCAAAGTCTGG + Intronic
1041777243 8:61536830-61536852 GGGCAGGTTACTGCAGGTTGTGG + Intronic
1044785774 8:95790992-95791014 CGACTGGGTTCTGCAAACTGTGG + Intergenic
1048473089 8:134720673-134720695 TGCCTGCTTACTGCCAACTGCGG - Intergenic
1048777768 8:137966569-137966591 GGAGTGTTTACTGGAAACTGAGG - Intergenic
1049222654 8:141434993-141435015 GGGCTGGGCAAGGCAAACTGGGG - Intergenic
1050521165 9:6501848-6501870 GGGCTTGTTAGTGATAACTGAGG + Intronic
1050587989 9:7133032-7133054 GGGCTGTGCAATGCAAACTGAGG + Intergenic
1052481868 9:29039756-29039778 GGGCTGGCTGCTGCTGACTGAGG + Intergenic
1054799728 9:69335365-69335387 GGGCAGGTGACTGCTAAATGGGG + Intronic
1054962470 9:70983931-70983953 GGGGTGGTTACTGCAGATTGTGG + Intronic
1055875620 9:80938444-80938466 GGACTGGTTTCAGCAAACAGTGG + Intergenic
1056602021 9:88053927-88053949 GGGCAGCTTGCTGCAGACTGTGG - Intergenic
1056915338 9:90741206-90741228 ATGCTGATTACTTCAAACTGAGG - Intergenic
1057239444 9:93395562-93395584 GGTCTGGTTATTTGAAACTGTGG - Intergenic
1061101407 9:128495340-128495362 GGGCTGCTTTCTGTAAAATGGGG - Intronic
1061174222 9:128983084-128983106 GTCCAGGTTCCTGCAAACTGAGG - Intronic
1061201457 9:129140762-129140784 GGGCTGGAGCCTGCAGACTGGGG + Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191882614 X:65857655-65857677 GGACTGGTCAATGCAAAGTGTGG + Intergenic
1192139921 X:68638624-68638646 GGGCTTGCTTCAGCAAACTGTGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196837927 X:119830370-119830392 GAGCTGGTTGCTGTAAAGTGTGG + Intergenic
1197096299 X:122599925-122599947 GTGCTGATTACTGCAGACTGTGG + Intergenic
1200014649 X:153149251-153149273 GGGGTGGGCAGTGCAAACTGAGG + Intergenic
1200024952 X:153250701-153250723 GGGGTGGGCAGTGCAAACTGAGG - Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic