ID: 1133512586

View in Genome Browser
Species Human (GRCh38)
Location 16:6474106-6474128
Sequence CTGCATACACAAATGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 235}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133512586_1133512589 -8 Left 1133512586 16:6474106-6474128 CCAGTGTCCATTTGTGTATGCAG 0: 1
1: 0
2: 2
3: 51
4: 235
Right 1133512589 16:6474121-6474143 GTATGCAGTCTATCCTTGATGGG 0: 1
1: 4
2: 181
3: 4413
4: 6107
1133512586_1133512598 26 Left 1133512586 16:6474106-6474128 CCAGTGTCCATTTGTGTATGCAG 0: 1
1: 0
2: 2
3: 51
4: 235
Right 1133512598 16:6474155-6474177 AAAAGGAAGGAAAGAAGGGAGGG 0: 13
1: 159
2: 1571
3: 7204
4: 21836
1133512586_1133512596 22 Left 1133512586 16:6474106-6474128 CCAGTGTCCATTTGTGTATGCAG 0: 1
1: 0
2: 2
3: 51
4: 235
Right 1133512596 16:6474151-6474173 ATTAAAAAGGAAGGAAAGAAGGG 0: 1
1: 4
2: 50
3: 790
4: 5401
1133512586_1133512593 9 Left 1133512586 16:6474106-6474128 CCAGTGTCCATTTGTGTATGCAG 0: 1
1: 0
2: 2
3: 51
4: 235
Right 1133512593 16:6474138-6474160 GATGGGAGGGAAAATTAAAAAGG 0: 1
1: 0
2: 3
3: 50
4: 600
1133512586_1133512588 -9 Left 1133512586 16:6474106-6474128 CCAGTGTCCATTTGTGTATGCAG 0: 1
1: 0
2: 2
3: 51
4: 235
Right 1133512588 16:6474120-6474142 TGTATGCAGTCTATCCTTGATGG 0: 1
1: 4
2: 199
3: 5110
4: 11242
1133512586_1133512597 25 Left 1133512586 16:6474106-6474128 CCAGTGTCCATTTGTGTATGCAG 0: 1
1: 0
2: 2
3: 51
4: 235
Right 1133512597 16:6474154-6474176 AAAAAGGAAGGAAAGAAGGGAGG 0: 12
1: 155
2: 2061
3: 13462
4: 64039
1133512586_1133512595 21 Left 1133512586 16:6474106-6474128 CCAGTGTCCATTTGTGTATGCAG 0: 1
1: 0
2: 2
3: 51
4: 235
Right 1133512595 16:6474150-6474172 AATTAAAAAGGAAGGAAAGAAGG 0: 1
1: 4
2: 97
3: 1143
4: 8306
1133512586_1133512594 13 Left 1133512586 16:6474106-6474128 CCAGTGTCCATTTGTGTATGCAG 0: 1
1: 0
2: 2
3: 51
4: 235
Right 1133512594 16:6474142-6474164 GGAGGGAAAATTAAAAAGGAAGG 0: 1
1: 0
2: 8
3: 86
4: 818
1133512586_1133512591 -4 Left 1133512586 16:6474106-6474128 CCAGTGTCCATTTGTGTATGCAG 0: 1
1: 0
2: 2
3: 51
4: 235
Right 1133512591 16:6474125-6474147 GCAGTCTATCCTTGATGGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 100
1133512586_1133512590 -5 Left 1133512586 16:6474106-6474128 CCAGTGTCCATTTGTGTATGCAG 0: 1
1: 0
2: 2
3: 51
4: 235
Right 1133512590 16:6474124-6474146 TGCAGTCTATCCTTGATGGGAGG 0: 1
1: 0
2: 3
3: 13
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133512586 Original CRISPR CTGCATACACAAATGGACAC TGG (reversed) Intronic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
901419310 1:9139707-9139729 TTGGATACACCAAGGGACACGGG + Intergenic
902042419 1:13502475-13502497 CTGCACACACAAATGAACTCTGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904662067 1:32092790-32092812 CTGCACTCTAAAATGGACACAGG - Intronic
905807350 1:40886488-40886510 CTGAATAAACAAGTGAACACTGG + Intergenic
907310862 1:53538298-53538320 CTGCATACATGAATGGAAAGTGG + Intronic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909371169 1:74885057-74885079 CTGCACACACACAGGGACCCTGG - Intergenic
909481952 1:76135594-76135616 ATGCATACCCAAAAGAACACAGG - Intronic
912247299 1:107973185-107973207 TTGCACACACAAATGGAAAAAGG + Intergenic
915921742 1:159980968-159980990 CTGCATACACTAAGGGACCAGGG + Intergenic
916522320 1:165575282-165575304 CTCAATGGACAAATGGACACTGG - Intergenic
916697863 1:167258565-167258587 CTGTATACACATGTGTACACAGG + Intronic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923307952 1:232705540-232705562 CTGCATACACAAATATAAATTGG + Intergenic
923716940 1:236433231-236433253 ATGCATACAAAAATGTACAAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924448605 1:244157519-244157541 CTGCATACACCCAAGGACTCTGG - Intergenic
1062921745 10:1285458-1285480 ATGAATGCACAAATGGGCACCGG + Intronic
1063135924 10:3216145-3216167 ATGTATACACACATGCACACAGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068175477 10:53451550-53451572 CAGCACACACAAATTGACCCTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069722087 10:70556232-70556254 CTACACACACAAAAGCACACGGG - Intronic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1069866028 10:71503373-71503395 CTGTGTGCACAAATGGACAGGGG - Intronic
1070826729 10:79394534-79394556 GTGCCTGCACACATGGACACAGG - Intronic
1071151380 10:82639074-82639096 CTTCATACATAAAGAGACACTGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074473211 10:113745862-113745884 CTAAATACAAAAATAGACACTGG + Intergenic
1074658816 10:115627082-115627104 GTGAATACACAAAGTGACACCGG - Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1074916934 10:117966160-117966182 TTTGATACACCAATGGACACGGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1076238688 10:128885652-128885674 AGGCACACACATATGGACACGGG + Intergenic
1078235361 11:9479711-9479733 TTGCATCCACCAATGAACACTGG - Intronic
1082716549 11:56620803-56620825 ATGCTCACACACATGGACACAGG + Intergenic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1085643501 11:78208113-78208135 CAGCAGCCACAAATGGAGACAGG - Intronic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1085888122 11:80545294-80545316 CTGCCAACACAAATGTCCACTGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1088596761 11:111446928-111446950 CTGCATATCCAAATGCACTCTGG + Intronic
1089191083 11:116653770-116653792 CTGCATACACTGCTGGGCACAGG - Intergenic
1091529412 12:1339926-1339948 GTGCACACACACATGCACACTGG + Intronic
1091646507 12:2275977-2275999 CTACATACATAAAAGGACATGGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096071961 12:48780413-48780435 CCACATACCCAAATGGGCACAGG + Intronic
1097907194 12:64932276-64932298 CTGCAGACACAAGTGAACACAGG - Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1100575663 12:95889710-95889732 CTGCAAACTCAGATGGATACAGG + Intronic
1100713817 12:97284915-97284937 CTGAATTCAAAAATAGACACAGG + Intergenic
1101111625 12:101492125-101492147 CTCCACACACAAAGGGACACAGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1103186922 12:118966226-118966248 CTGAGAACACACATGGACACAGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106633491 13:31502631-31502653 CTCCATACAAAAATGGACTGAGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112989460 13:105494586-105494608 CATAATACACAAAGGGACACAGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115417226 14:33149978-33150000 ATGAAAACACACATGGACACAGG - Intronic
1119603841 14:75997473-75997495 CAGCAAACACAAATGCACAGAGG - Intronic
1120778613 14:88464765-88464787 TTGCATAAAGAAATGGAAACAGG - Intronic
1122274266 14:100583387-100583409 ATGGATACATAAATGGATACAGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126820571 15:52499725-52499747 ATTCATCCACCAATGGACACTGG + Intronic
1130130700 15:81139681-81139703 ATTTATACACAAATGCACACTGG - Intronic
1131971835 15:97901300-97901322 CTGCATAAAGAAATGGAAATGGG - Intergenic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1138399126 16:56731065-56731087 TTGCAAACACAAATGCACAAAGG - Intronic
1138956430 16:61976168-61976190 CTGCATACAAAACTTAACACAGG + Intronic
1139434382 16:66927539-66927561 CAGCCTAGATAAATGGACACAGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1141136781 16:81470954-81470976 ATGCATACACACATGCACACAGG + Intronic
1141136782 16:81470984-81471006 GTGCATACACACATGCACACAGG + Intronic
1141136783 16:81471028-81471050 GTGCATACACACATGCACACAGG + Intronic
1144519994 17:15946955-15946977 CTGCCTACTCAAATGGCCTCTGG - Intronic
1144655522 17:17032904-17032926 GTGCATACACACAGGGACACAGG - Intergenic
1144798251 17:17907147-17907169 CTGCAGAGACTAATGGCCACTGG + Intronic
1145757615 17:27404151-27404173 ATGCATTGACACATGGACACAGG + Intergenic
1149476819 17:56968190-56968212 ATGCAAACAAAAATGTACACTGG - Intergenic
1151414722 17:73954316-73954338 ATGCACACACCAATGCACACAGG + Intergenic
1151881901 17:76900964-76900986 ATGCACACACACATGCACACAGG - Intronic
1155072013 18:22325014-22325036 CTGCATGCACACATGGTCTCAGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158439633 18:57463236-57463258 ATCCATACACATATGGACACTGG - Intronic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160855240 19:1214357-1214379 CAGCATAGACCAAGGGACACTGG - Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1163710662 19:18844948-18844970 CTGCACGCACAGATGCACACTGG - Intronic
1166664378 19:44669970-44669992 CAGCACACACAACTGGGCACTGG + Intronic
925550808 2:5072200-5072222 ATGCACACACAGATGCACACAGG + Intergenic
926040370 2:9667880-9667902 CTGCAGGAACAAATGGACACAGG + Intergenic
927001559 2:18800280-18800302 CTGCATGGAGAAATGGACGCAGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927906970 2:26865611-26865633 ATGCATTTAAAAATGGACACAGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
931047941 2:58378133-58378155 ACACACACACAAATGGACACAGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971079 2:76542895-76542917 TTTCATACACACATGCACACAGG + Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935372889 2:102365924-102365946 CTGCACACAGAAAGGGACCCTGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
940678521 2:156754428-156754450 CTGCATACATACATACACACTGG - Intergenic
941045563 2:160671575-160671597 CTGCCTACACAAATGGCTCCCGG - Intergenic
941111479 2:161422867-161422889 CTGAACAATCAAATGGACACAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172916806 20:38449372-38449394 CTGCATTCAAAAATGATCACGGG + Intergenic
1173326238 20:42036202-42036224 CTGTATGCACCAATGGCCACAGG - Intergenic
1173957709 20:47047285-47047307 CAGCAAACACAAATGCCCACAGG + Intronic
1174912351 20:54620742-54620764 ATGCGTACACAAATGTTCACGGG + Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175914905 20:62421439-62421461 CGGCACACACACATGCACACTGG - Intronic
1175914929 20:62421799-62421821 CAGCAAACACACATGCACACTGG - Intronic
1175914936 20:62421902-62421924 CAGCACACACACATGCACACTGG - Intronic
1176168185 20:63685435-63685457 CCGCATACACAGAAGGTCACAGG - Intronic
1176176925 20:63732673-63732695 ATGCATACACACATGCACACAGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176932989 21:14835657-14835679 ATACATATACAAATTGACACAGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177999862 21:28149023-28149045 ATGCATACACACATGCACACTGG + Intergenic
1178159665 21:29897083-29897105 GTGCACACACACATGCACACAGG - Intronic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178902236 21:36606813-36606835 CTGCATCCACAGGGGGACACCGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181329115 22:22075330-22075352 CTGCAGACACAGATGCACATGGG - Intergenic
1181333347 22:22111551-22111573 CTGCAAACACAAATGCTCATGGG - Intergenic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1184806414 22:46797352-46797374 CAGCATTCACAAAGGGACAGTGG + Intronic
1185094995 22:48801295-48801317 ATACATACACACATGCACACAGG + Intronic
950130891 3:10546143-10546165 CTGCATGCACAACTGGCCTCCGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953901543 3:46846566-46846588 CTGCATCCACTCAGGGACACAGG - Intergenic
955707171 3:61739757-61739779 GTGCAAACACAGATGGCCACAGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
957460970 3:80520172-80520194 TTTCATACACAAATGGTCACGGG + Intergenic
961426924 3:126855727-126855749 ATGCCTACAGAAATGGACAAAGG - Intronic
963180316 3:142348645-142348667 CAGCACAGACAAATGGACACTGG + Intronic
965819568 3:172671645-172671667 ATACATACACACATGCACACAGG + Intronic
965819570 3:172671738-172671760 ATACATACACACATGCACACAGG + Intronic
967182526 3:186918846-186918868 CTACATACACAAAAGGAGAAAGG - Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
969962893 4:10963770-10963792 GTGTATACACAAGTGAACACAGG + Intergenic
969962894 4:10963817-10963839 ATGCATACACACGTGAACACAGG + Intergenic
969962903 4:10964018-10964040 ATGCATACACACGTGAACACAGG + Intergenic
969962909 4:10964172-10964194 GTGCATACACACTTGAACACAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972531564 4:39966067-39966089 CTCCCTTCACAAATGTACACTGG + Intronic
972834154 4:42848562-42848584 CTTCATTTAAAAATGGACACAGG - Intergenic
975397863 4:73898473-73898495 CTCCATGCACACATGGACAGAGG - Intergenic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
980000454 4:127481528-127481550 CTTCATGCACAAAGTGACACGGG - Intergenic
981199010 4:141956505-141956527 CTGCCCACACAGATGGACAGAGG + Intergenic
982163505 4:152593467-152593489 ATGCATAAACAAATCGACATTGG + Intergenic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
983756771 4:171348294-171348316 CTGCAGACAGAAGTGGACTCTGG - Intergenic
984950376 4:185003585-185003607 GTGCAGACACAAGTGGAGACGGG + Intergenic
985900415 5:2784664-2784686 GTGCACACACATATGCACACAGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
993208437 5:84917383-84917405 CTACATACACAAATCAATACAGG + Intergenic
993884556 5:93400300-93400322 CTGCAGACACAGACGGCCACTGG - Intergenic
994725518 5:103430636-103430658 CTGCAGAAAAAAATAGACACAGG + Intergenic
995282238 5:110349464-110349486 CTGCATACTAACAAGGACACGGG + Intronic
995303019 5:110607583-110607605 CTTCATACATTAATGTACACAGG - Intronic
995629451 5:114117572-114117594 CTGCATGCAGATATGGACCCAGG + Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998136045 5:139675240-139675262 CTGCACACAGACATGTACACAGG - Intronic
999785333 5:154885058-154885080 CTGCAAACAAAAATGTAGACTGG + Intergenic
1002591739 5:180295362-180295384 CTGCATACACAGCTGGCCTCCGG - Intergenic
1004109130 6:12697887-12697909 CTCCATACATAAAGGGACCCTGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004762486 6:18683843-18683865 ATGCATGCACACATGCACACAGG + Intergenic
1005392831 6:25350541-25350563 CTGCAAACTCAAATGCCCACAGG - Intronic
1006605465 6:35253411-35253433 CTGCATACAAAGAATGACACTGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010886911 6:81255227-81255249 CTGCATACATAAAAGGAACCAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1013187170 6:107769772-107769794 CTCCATACACAGCTGGACACTGG - Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014297345 6:119636201-119636223 ATGCATACTCAAAGGGACACTGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020921596 7:14271789-14271811 CAGCACACACAAAAGGATACTGG - Intronic
1021029799 7:15717545-15717567 CTACAGACACAAAAGTACACAGG - Intergenic
1023867764 7:44246595-44246617 ATGTATACACACATGCACACAGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025021093 7:55480782-55480804 TTGAACACACAAATGGACATAGG - Intronic
1026788008 7:73313817-73313839 CTGGAGAAAGAAATGGACACTGG + Intronic
1028520747 7:91727906-91727928 CTGCAAACACAAAGGCAAACTGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029321357 7:99763455-99763477 CTGTATCCACATATGGACACAGG - Intronic
1032001391 7:128267730-128267752 GTGTATGCACAAATGCACACTGG + Intergenic
1032293762 7:130615766-130615788 CTGCATACAAAGAATGACACTGG + Intronic
1032375183 7:131407721-131407743 CAGCATACACAAAGGCACAAAGG - Intronic
1033354131 7:140585797-140585819 ATGCCTACAAGAATGGACACAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035112944 7:156499303-156499325 ATGCAAACACACATGGGCACAGG + Intergenic
1036127576 8:6077151-6077173 CTGCATTCATACATGCACACAGG - Intergenic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1039177339 8:34824824-34824846 CTGCACACATAAATTGACAGAGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040478763 8:47804658-47804680 ATTCATACACAAATGTTCACAGG - Intronic
1040777240 8:51060256-51060278 GTGGATAAACAAATGTACACAGG - Intergenic
1040888131 8:52287684-52287706 TTGCATATACAAAGGGAGACAGG + Intronic
1042103020 8:65294896-65294918 CTGCATCCTCCAATGGGCACAGG - Intergenic
1042433972 8:68742441-68742463 CTGCTTACACAGATGAATACAGG - Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043874793 8:85473626-85473648 CTGCATACACATATATACATAGG - Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044500630 8:92951263-92951285 TTACATACAGAAATGGAAACTGG - Intronic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047104075 8:121713918-121713940 CTGCACAGGCAAATGGACAGAGG + Intergenic
1047912596 8:129546564-129546586 CAGCATACAGAAAAGGACAGAGG + Intergenic
1048279124 8:133091803-133091825 AGGCATACACTCATGGACACAGG - Intronic
1048878698 8:138856318-138856340 ATTCACACACAAATGCACACAGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051865912 9:21682359-21682381 ATACATACACACATGAACACAGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059469318 9:114492564-114492586 ATGCATACACAGATGCACACAGG + Intronic
1060679981 9:125553628-125553650 CTACATAGACAAATGGGCATGGG - Intronic
1061343467 9:130002595-130002617 CTGCATCCAGAAAGGGCCACAGG - Intronic
1187899442 X:24013607-24013629 CTACATACACAAATGCATACTGG + Intronic
1190381361 X:49842289-49842311 CTTCATAAACAACTGGACCCGGG + Intergenic
1192738322 X:73870050-73870072 CCTAAGACACAAATGGACACAGG - Intergenic
1193951456 X:87805482-87805504 CTATATTCACAAATGGGCACAGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1197043724 X:121970816-121970838 ATCCAGACACCAATGGACACAGG + Intergenic
1197274693 X:124464698-124464720 CAGCATACACACACAGACACAGG + Intronic
1197561268 X:128024853-128024875 CTGCACACACAGAGGGACCCTGG + Intergenic
1198197689 X:134381370-134381392 TTGCTTAGACAAATTGACACAGG - Intronic
1201286453 Y:12383018-12383040 CTGCACACACACATGCACACTGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic