ID: 1133518648

View in Genome Browser
Species Human (GRCh38)
Location 16:6534718-6534740
Sequence CAGAATGCAAAGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1285
Summary {0: 1, 1: 1, 2: 10, 3: 158, 4: 1115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133518642_1133518648 8 Left 1133518642 16:6534687-6534709 CCTTTGCATTTTTTCTGCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 296
Right 1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG 0: 1
1: 1
2: 10
3: 158
4: 1115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133518648 Original CRISPR CAGAATGCAAAGAGGGAGAA GGG Intronic
900877906 1:5358907-5358929 CAGAAGGCAAAGGGGGACCAGGG - Intergenic
901959013 1:12810016-12810038 CAGGAGGGAATGAGGGAGAATGG - Intergenic
902137520 1:14322953-14322975 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902367794 1:15988967-15988989 CAAAAGGCAAAGAGAGAGACAGG - Intergenic
902548644 1:17206237-17206259 CTGAGTCCCAAGAGGGAGAAAGG - Intronic
902688963 1:18097707-18097729 GAGAAGGGAAAGAGGGAGAGAGG - Intergenic
903806160 1:26007038-26007060 CAGGAAGCAGACAGGGAGAAGGG - Intergenic
904953794 1:34266336-34266358 CAGGATGCACAGAGAGTGAATGG - Intergenic
906672985 1:47671525-47671547 CAGAACGCAAAAGGGGAGAAAGG + Intergenic
906778987 1:48555717-48555739 CAGACTGCAGACAGGAAGAATGG + Intronic
907097547 1:51795505-51795527 CAGAATGAAGATAGAGAGAAAGG + Intronic
907205727 1:52768903-52768925 AAGAATTCAAAGATAGAGAAAGG - Intronic
907234348 1:53031502-53031524 CAGAATTCAAAGAAGGGCAATGG - Intronic
907864407 1:58385692-58385714 CAGGATGCAAAGCAGGAGGAAGG + Intronic
907938029 1:59060135-59060157 GAGAAGGAAAAGAGGGTGAAGGG + Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908462944 1:64363844-64363866 TAGAATGAAAAAAGGGAGAGGGG - Intergenic
908502838 1:64761369-64761391 CAGTTTCAAAAGAGGGAGAAGGG + Intronic
908948411 1:69527698-69527720 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
909225004 1:73008295-73008317 CAGCATGAAAAGAGGTATAATGG + Intergenic
909573285 1:77142620-77142642 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
909669636 1:78173605-78173627 TAGAAGGCACAGAGGCAGAATGG - Intergenic
909866889 1:80685371-80685393 CAGAAGGCAAAGGGGAAGTAAGG + Intergenic
910434005 1:87187044-87187066 AAGAAAGGAGAGAGGGAGAAAGG - Intergenic
910705679 1:90127084-90127106 CAGAAGGCAAAGGGGAAGCACGG - Intergenic
910746532 1:90580792-90580814 GTGAAAGCAAAGAGGGAGCAAGG - Intergenic
910926256 1:92400953-92400975 CAGAAGGCAAAGGGGAAGAAAGG + Exonic
911241981 1:95477303-95477325 CAGCAGGCAAAAAGAGAGAATGG - Intergenic
911343645 1:96671076-96671098 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
911635993 1:100237147-100237169 CAGCATTCCAAAAGGGAGAAGGG - Intronic
911638427 1:100261614-100261636 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
911709836 1:101057827-101057849 CAGAATGCAAAGAGGCAGCAAGG - Intergenic
911753502 1:101525943-101525965 CAAAATGCAGAGATGGAAAAGGG - Intergenic
911760441 1:101608419-101608441 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
911773133 1:101773130-101773152 CAGAAATCAAAGAGGAAGCAAGG + Intergenic
912254988 1:108049156-108049178 CAGCCTGCAAAGAAGGACAAGGG + Intergenic
912600289 1:110924453-110924475 CAGAGGGCAAAGAGGCAGCAAGG + Intergenic
913037701 1:114988184-114988206 CAGAAGGAGAAGAGGGAGAGAGG + Intronic
913208586 1:116564566-116564588 CAGAATGCAAAGGAGAAGTAAGG + Intronic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
913398423 1:118398693-118398715 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
913424405 1:118711358-118711380 GAGATTGCAAAGAGGGGAAAGGG + Intergenic
913566131 1:120074334-120074356 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
913599757 1:120412000-120412022 CAGAATCCTAACAGGGAGATGGG + Intergenic
913631999 1:120719219-120719241 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
913944252 1:125142819-125142841 GAGAATGCTAAAAGGGAGGAAGG + Intergenic
914227459 1:145732845-145732867 AAGAATGCAGAGAAGGAAAATGG + Intronic
914286719 1:146233693-146233715 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
914347480 1:146812402-146812424 CAGAAGGAAAAGAGAGAGAGTGG + Intergenic
914547750 1:148684434-148684456 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
914591112 1:149106557-149106579 CAGAATCCTAACAGGGAGATGGG - Intergenic
914751875 1:150540181-150540203 AAGAAAAGAAAGAGGGAGAAGGG + Intergenic
915058551 1:153159722-153159744 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
915225655 1:154409342-154409364 CAGAAGGCAGAGGGGGATAAAGG - Intronic
915431814 1:155872583-155872605 CAGAAGGACAAGGGGGAGAAAGG - Intronic
915717956 1:157962269-157962291 AAGAGTGCAGAGAGGGGGAATGG - Intergenic
916000535 1:160611056-160611078 GAGAGGGCAAAGAGGGAGACAGG - Intronic
916256323 1:162791125-162791147 CAGTAGGCAAAGATGGAAAAGGG - Intronic
916304201 1:163310870-163310892 CGGAATGCAAAGGGGAAGCAAGG + Intronic
916681006 1:167105105-167105127 AGGAAGGCAAAGAGGAAGAAAGG - Intronic
916766072 1:167861955-167861977 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
917726538 1:177833196-177833218 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
918614160 1:186524790-186524812 CAGAAGGCAAAGGGGAAGTAAGG - Intergenic
918670774 1:187212698-187212720 CAGAATATAAAGAAGAAGAAAGG + Intergenic
918790704 1:188823555-188823577 CAGAGGGCAAAGCAGGAGAATGG - Intergenic
918935228 1:190913036-190913058 CAGAAGTCAAAGAGGAAGAAAGG + Intergenic
919001629 1:191839172-191839194 CAAAAGGAAAAGAGGGCGAAGGG + Intergenic
919232520 1:194792346-194792368 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
919273865 1:195386096-195386118 CAGAAAGCAAAGGGGAAGTAAGG - Intergenic
919291786 1:195642750-195642772 CAGCAGGCAAAGAGAGAGAGAGG + Intergenic
919649216 1:200129110-200129132 CAACATGCAAATAGGGAGACTGG + Intronic
919713212 1:200749097-200749119 TAGGATGCAAACAGGGAGGAAGG + Intronic
920055483 1:203187756-203187778 CAGAACTCCAAGAGGCAGAATGG + Intergenic
920579798 1:207095893-207095915 CAGAAGGCAAAGGGGGAGGGAGG - Intronic
920581959 1:207118437-207118459 CAGAAGGCAAAGGGGAAGAAAGG + Intronic
922108905 1:222538607-222538629 TAAAATAAAAAGAGGGAGAAGGG + Intronic
922211017 1:223486937-223486959 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
922569840 1:226627946-226627968 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
922610525 1:226923781-226923803 CACAGTCCAAAGAGGGAGCAGGG + Intronic
922648513 1:227317668-227317690 CAGAATGCATAGAAGGGGGAGGG + Exonic
922794983 1:228335425-228335447 GAGAATGAAAAGAGGAAGGAGGG - Intronic
923397300 1:233579675-233579697 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
923583570 1:235242905-235242927 CAAAATGAAAAGAGGTAGATGGG - Intronic
923874317 1:238030973-238030995 CAGATGGGAAAGAGAGAGAAAGG + Intergenic
924309463 1:242725138-242725160 CAGAAGGCACTGTGGGAGAAAGG + Intergenic
924659104 1:246000393-246000415 CAGAATGTGAAGATGGAGATAGG + Intronic
924836381 1:247651864-247651886 CAGAAATCAAAGAGGGAGCGAGG - Intergenic
924939318 1:248801793-248801815 CAGAAGGCAATGGGGGAGCAAGG + Intergenic
1063194406 10:3727742-3727764 CAGGAGGGAGAGAGGGAGAAAGG - Intergenic
1063585006 10:7344457-7344479 CAGAAGGCAAAGGAGGAGAAAGG - Intronic
1064592637 10:16910187-16910209 GAGAAGGAGAAGAGGGAGAAGGG - Intronic
1065637675 10:27746635-27746657 CACAGGGCAAAGAGAGAGAATGG + Intergenic
1066083354 10:31954166-31954188 CAGAAGGCAAAGCGGAAGGAAGG - Intergenic
1066722785 10:38356778-38356800 CAGTAGGCAAAGATGGAAAAGGG - Intergenic
1066995398 10:42558456-42558478 CAGTATGCAAAAATAGAGAAAGG - Intergenic
1067230204 10:44400993-44401015 AAGAAAGCAAGGAGAGAGAAAGG - Intergenic
1067377681 10:45742749-45742771 CAGCAAGCAAACAGGGAAAAGGG - Intronic
1067885381 10:50083433-50083455 CAGCAAGCAAACAGGGAAAAGGG - Intronic
1067918450 10:50426689-50426711 CAGAATTCAATCAGGAAGAAAGG + Intronic
1067939985 10:50647221-50647243 CAGACTGCAAAGAGTAAAAAAGG - Intergenic
1067940324 10:50649843-50649865 AAGAAGGGAAAGAGGGAAAAGGG + Intergenic
1068122492 10:52797317-52797339 CAGAAGGCAAAGTGGAAGCAAGG - Intergenic
1068175197 10:53448115-53448137 CAGAAGCCTAAGAGGAAGAATGG - Intergenic
1068903160 10:62292713-62292735 CAGAAAGTGAAGAGGAAGAAAGG + Intergenic
1068944680 10:62717918-62717940 CAGAAGGCAAAGGGAGAGCAGGG + Intergenic
1069196476 10:65556955-65556977 CAGAATGAAAAGCAGGAAAAGGG + Intergenic
1069208433 10:65723714-65723736 CAGAAGGCAAAGGGGAAGTAAGG + Intergenic
1069267077 10:66473398-66473420 CAGAAGGCAAAGGGGCAGCAAGG - Intronic
1069344487 10:67452012-67452034 AAGAATAGGAAGAGGGAGAAAGG + Intronic
1069635174 10:69920600-69920622 CACAAGGCAGAGAGGGAGAACGG - Intronic
1069789570 10:71011049-71011071 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1070047606 10:72854487-72854509 AAGAATGCAAGCAGGGGGAATGG + Intronic
1070144409 10:73763413-73763435 CAGAGTGCCAAGAGTGAAAAAGG - Intronic
1070153155 10:73817716-73817738 CAGACTGCAGAGAGGGAGACGGG - Intronic
1070210638 10:74316577-74316599 CAGAAGGCAAAGGAGAAGAAAGG - Intronic
1070350086 10:75583428-75583450 CAGAAGGAAGAGAGAGAGAAGGG + Intronic
1070468516 10:76750856-76750878 CAGAAAGCAAAGAGAGAGTGGGG + Intergenic
1070549910 10:77482927-77482949 AAGAAGGGAAGGAGGGAGAAAGG - Intronic
1070625207 10:78046175-78046197 CAGAATTCTCAGAGGCAGAACGG - Intronic
1070803244 10:79255630-79255652 CAGAATGCAGAGACAGAGATAGG - Intronic
1071423410 10:85524738-85524760 CAGGAAGAAAGGAGGGAGAAAGG + Intergenic
1071444810 10:85735964-85735986 AAGAAGGGAGAGAGGGAGAAAGG + Intronic
1071699363 10:87913666-87913688 CAGAATAAAAAGAGAGAAAAGGG - Intronic
1071822568 10:89293226-89293248 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1072086326 10:92082960-92082982 CAGAATGTACAAAGGGTGAAGGG + Intronic
1072305456 10:94102467-94102489 CAAAATGCAAAAGGGGACAAAGG - Intronic
1072316378 10:94207217-94207239 CAGCATGCAAGGATGCAGAATGG + Intronic
1072331167 10:94353402-94353424 CAGAAGGCAAAGGGGGAGCCAGG + Intronic
1072445881 10:95498114-95498136 CTGAATGCTAACAGGCAGAAAGG + Intronic
1072470887 10:95712024-95712046 CAGATTCCACAGAGGGAGAGAGG - Intronic
1072570775 10:96655781-96655803 CAGAAGGCAAGGAGGAGGAAAGG - Intronic
1072919436 10:99563556-99563578 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1073622378 10:105062618-105062640 CAGAAGGGTAAGAGGCAGAAGGG + Intronic
1073851526 10:107624586-107624608 AAGAATGCACAGAGAGGGAAAGG - Intergenic
1073941419 10:108703171-108703193 TAGAAGGCAAAAAGGGAAAAGGG + Intergenic
1073976880 10:109112234-109112256 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1074094715 10:110301229-110301251 CAGAAGGCAGAGAAGGAAAAAGG + Intronic
1074208049 10:111301614-111301636 CAGAAGGCAAAGGGGAAGCACGG - Intergenic
1074376020 10:112941299-112941321 CGGAAGGCAAAGGGGGAGCAGGG + Intergenic
1074594831 10:114852574-114852596 CAAAAAGCAAAAATGGAGAAGGG - Intronic
1075293692 10:121253553-121253575 AAGAATGAAAAGTGGGAAAATGG + Intergenic
1075559523 10:123458459-123458481 AAGAAGGGAAAGAGGGAGGAAGG - Intergenic
1075864052 10:125702655-125702677 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1076182397 10:128420480-128420502 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1076210361 10:128636717-128636739 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1076873921 10:133206757-133206779 CAGAAGGAAAAGAGGAACAAAGG + Exonic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1076961808 10:133769008-133769030 CAGATTGCAAAAAGAGAGAGAGG - Intergenic
1077345225 11:2045245-2045267 GAGAATGGAAAAATGGAGAATGG - Intergenic
1077791254 11:5442477-5442499 CTGAAGGAAAAGAGGCAGAAAGG - Intronic
1077892281 11:6427924-6427946 CAGCATGAAAAGGGGGAAAATGG + Intergenic
1077951262 11:6960414-6960436 CAGCCTACAAAGAGGAAGAAAGG + Intronic
1077972330 11:7207443-7207465 GAGCATGCATATAGGGAGAAGGG + Intergenic
1078108842 11:8375782-8375804 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1078306383 11:10191922-10191944 CAGACATCATAGAGGGAGAAGGG - Intronic
1078322704 11:10351057-10351079 GAGAATGGAAAGGGAGAGAAGGG + Intronic
1078353850 11:10618658-10618680 CATTAGGCAAAGAGGGAGAGAGG + Intronic
1078452309 11:11449396-11449418 CAGACAGTGAAGAGGGAGAAGGG - Intronic
1078579448 11:12527210-12527232 AGGAAGGCAAAGAGGGAGGATGG + Intronic
1078674195 11:13394403-13394425 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1078893747 11:15580027-15580049 CAGAAAGCCAAGAGGAAGAGGGG - Intergenic
1078925747 11:15873308-15873330 CAGAATAGAGAGAGAGAGAATGG + Intergenic
1078944188 11:16045400-16045422 AAGAATGGAAACAGGGAGACTGG - Intronic
1078949378 11:16112281-16112303 CAGAATGCAAAGCAGGTGAAAGG - Intronic
1079105025 11:17565490-17565512 CAGTATGGAAAGGGGGAAAAAGG - Intronic
1079246230 11:18754254-18754276 CAGGATGCAAACAGGGTGAAGGG - Intronic
1079384514 11:19966916-19966938 CGGAATGAAAAGAGAGAGAAAGG + Intronic
1079569358 11:21923175-21923197 GAGGATCTAAAGAGGGAGAAAGG - Intergenic
1079769862 11:24445381-24445403 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1079896575 11:26126760-26126782 CAGAAGGCAAAGGTGAAGAAAGG + Intergenic
1080017999 11:27527373-27527395 CAGAATGCCAAGATGGGGACGGG - Intergenic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080905956 11:36544883-36544905 CAGAAGGCAAAGGGGAAGCATGG - Intronic
1080925158 11:36748546-36748568 CAAAATGCAAAGAGAGAACAAGG - Intergenic
1080962272 11:37174398-37174420 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1081088788 11:38835505-38835527 CAGAATTCACACAGGTAGAAGGG + Intergenic
1081141468 11:39506288-39506310 CAGAAAGTGAAGAGGAAGAAAGG + Intergenic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1081637899 11:44733012-44733034 CAGATGGGGAAGAGGGAGAAGGG + Intronic
1081693576 11:45094520-45094542 CAGGAAGAAAAGAGGGAGAGAGG + Intergenic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1082864325 11:57884741-57884763 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1083668200 11:64286415-64286437 CAGGGTGCAGAGAGGGAGATGGG - Intronic
1084025450 11:66445629-66445651 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084025850 11:66448879-66448901 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084212343 11:67630005-67630027 CCGAAAGCTGAGAGGGAGAAGGG + Intergenic
1084277792 11:68063853-68063875 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1084721902 11:70911760-70911782 CAAAATGACAAGAGTGAGAATGG + Intronic
1084905685 11:72344631-72344653 GAGAATGCCTAGAGAGAGAAAGG - Intronic
1084965471 11:72742086-72742108 CAGAAGGGAAAGAGGGAGACAGG + Intronic
1085000481 11:73028876-73028898 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1085008739 11:73120016-73120038 CAGAAGGCAAAGAGGGAATGAGG + Intronic
1085247294 11:75113179-75113201 CAGAAGGCAAAGGGGAAGACAGG + Intronic
1085333602 11:75672696-75672718 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1085557494 11:77438173-77438195 CAGAAGGTAAAGAGGGAAACAGG + Intronic
1085954854 11:81379320-81379342 TAGGATGCATATAGGGAGAATGG - Intergenic
1086077441 11:82869479-82869501 AAGAAGGAAGAGAGGGAGAAAGG + Intronic
1086313448 11:85562895-85562917 CACAATGCAAACATAGAGAAGGG + Intronic
1086503815 11:87480500-87480522 CAGAAGGCAAAGGAGGGGAAAGG - Intergenic
1086925102 11:92631571-92631593 CAGAAGGCGAAGGGGAAGAAAGG - Intronic
1086996897 11:93368494-93368516 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1087348149 11:96997461-96997483 AAGAAAGGAAAGAGGAAGAAAGG - Intergenic
1087429808 11:98038608-98038630 TAGAATGAAAGGAAGGAGAAAGG - Intergenic
1087725605 11:101712767-101712789 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1087817909 11:102679334-102679356 CAGAAGGCAAAGGGGGAGCAGGG + Intergenic
1088072665 11:105809669-105809691 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1088110553 11:106256209-106256231 CAGAAACCAACGAGGGAGAGGGG - Intergenic
1088275599 11:108082203-108082225 AAGAAAGGAAAGAGGGAGGAAGG - Intronic
1088339984 11:108753520-108753542 CACGATGGACAGAGGGAGAACGG - Intronic
1088415223 11:109581234-109581256 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1088426706 11:109712737-109712759 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1088506509 11:110532684-110532706 CAGAAGGCAAAGGGGGAGTGAGG - Intergenic
1088763192 11:112951190-112951212 CAGAAAGCACAGAGGAAGAGTGG + Intergenic
1088972579 11:114786901-114786923 CAGAGTGCAATGTGGGTGAATGG - Intergenic
1089115016 11:116087846-116087868 AAGAAAGGAGAGAGGGAGAAGGG - Intergenic
1089553951 11:119304503-119304525 CAGACTGTGAAGCGGGAGAAAGG - Exonic
1089643135 11:119860706-119860728 CAGAAGGAAAACAGGGAGACAGG - Intergenic
1089768180 11:120783686-120783708 CAAAATGCATAGAGGGACGAGGG - Intronic
1089896499 11:121935505-121935527 CAGAAGGCAAAAAGGGAGAGAGG + Intergenic
1090070246 11:123538079-123538101 AAGAATAGAAAGAGGGAGACAGG - Intronic
1090087107 11:123660105-123660127 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1090306959 11:125699487-125699509 CAGAAGGCAAAGGGGGAGCAGGG - Intergenic
1091009130 11:131982345-131982367 AAGAATGTAAAGAGAAAGAAGGG + Intronic
1091345781 11:134853065-134853087 CACAGTGCAAAGAGGGAACAAGG + Intergenic
1091362382 11:134987708-134987730 AAGGAAGCAAAGAGGGAGGAAGG + Intergenic
1091494881 12:963946-963968 CTGAATGAAATGAGTGAGAAGGG + Intronic
1091658398 12:2362754-2362776 CAGACTGTAATGAGGGAGAATGG + Intronic
1091967506 12:4757094-4757116 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1092517242 12:9227397-9227419 CAGAAGGCTAAAAGGGAGCAAGG + Intergenic
1092530297 12:9338534-9338556 CAGAATGGAAAAGGGGAGGAAGG + Intergenic
1093006741 12:14059388-14059410 CGGAAGGCAAAGGGGGAGCAAGG + Intergenic
1093205567 12:16244610-16244632 AAAAATGAAGAGAGGGAGAAGGG + Exonic
1093207900 12:16272500-16272522 CAGAAAGTAAACAGTGAGAATGG + Intronic
1093262105 12:16950898-16950920 CAAAATGCAAACTGGGGGAAGGG - Intergenic
1093501584 12:19818235-19818257 CACAAAGAAATGAGGGAGAAAGG - Intergenic
1093764619 12:22948625-22948647 CAGAATGTAAAGCTGGATAAGGG + Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1095226586 12:39685358-39685380 CAGAAGGCAAAGGGGGAGCAAGG + Intronic
1095872728 12:47048425-47048447 CAGAAGGCAAAGGAGGAGCAAGG + Intergenic
1095919271 12:47513251-47513273 CAGAAAGCAAAGAAGAAGCAAGG - Intergenic
1096344423 12:50833123-50833145 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1096565821 12:52477950-52477972 CAGAAGGAAGAGAGAGAGAAGGG - Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1096963726 12:55607158-55607180 AAGCAGGCAAAAAGGGAGAATGG + Intergenic
1096985796 12:55756163-55756185 CAGACAGAAAAGAGGGAAAAGGG + Exonic
1097018172 12:56001927-56001949 CAGAATGGAAGATGGGAGAAAGG + Exonic
1097326330 12:58281472-58281494 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097428498 12:59474514-59474536 CAGAAAGGAAAGAGAGAAAAAGG + Intergenic
1097655359 12:62354949-62354971 CAGAATGCAAAGGGTCATAAAGG + Intronic
1097811205 12:64021126-64021148 CAGAATGGAAACAGGGAAGAAGG + Intronic
1098140193 12:67443162-67443184 CAGAATGCAAAGGAGAAGCAAGG - Intergenic
1098374033 12:69793385-69793407 CAAAATGCACAGTGGTAGAATGG - Intronic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1098940658 12:76531119-76531141 CAGAAGGCAAAGGGGAAGCAGGG + Intronic
1099050974 12:77781291-77781313 CAGAATTCCAAAAGGGAGGAGGG - Intergenic
1099147432 12:79064240-79064262 GAGAAAGGAAAGAGGGAGTAAGG + Intronic
1099246408 12:80198022-80198044 CAGAAAACAAAGAGGAAGAAAGG - Intergenic
1099314067 12:81063101-81063123 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1099363292 12:81734420-81734442 AAGAATACAAAGGGGGAGAGAGG + Intronic
1099383192 12:81980763-81980785 CAGAAAGCAAAGGGGAAGCAAGG - Intergenic
1099582620 12:84470583-84470605 CAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1099585896 12:84513316-84513338 CAGTATGGAAAGGGGGAAAAGGG - Intergenic
1099790010 12:87321951-87321973 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1100067346 12:90665087-90665109 CAGCAGGCAAAGAGAGAGATTGG - Intergenic
1100095220 12:91025748-91025770 AAGAATGAAAAGATGCAGAATGG + Intergenic
1100159559 12:91842685-91842707 CAGAAGGTAAAGGGGAAGAAAGG - Intergenic
1100176146 12:92033144-92033166 CAGAATTGAAAAAGGGAGAAGGG + Intronic
1100352798 12:93800623-93800645 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1100471250 12:94895214-94895236 CAGAAGGGAGAGAGGGAGCAAGG - Intergenic
1100740705 12:97588742-97588764 CAGAAGGAAAGGAGAGAGAACGG + Intergenic
1101416081 12:104509220-104509242 CAGCAGGCAAAGAGAGAGATTGG - Intronic
1101660350 12:106759761-106759783 CAGTTAGGAAAGAGGGAGAAGGG - Intronic
1101713042 12:107286504-107286526 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
1101829069 12:108243056-108243078 GTGAATGCAAAGGGGAAGAATGG - Intronic
1102393299 12:112567117-112567139 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1102528810 12:113531256-113531278 CAGCAGGCAAAGAGAGAGATTGG - Intergenic
1102744336 12:115237133-115237155 CAGAATCCATTGATGGAGAACGG + Intergenic
1102756593 12:115346523-115346545 AAGAATGGAGGGAGGGAGAAAGG + Intergenic
1103365070 12:120376213-120376235 GAGAATGCAAAGAGGTTTAAGGG - Intergenic
1104158415 12:126155060-126155082 AAGGAGGAAAAGAGGGAGAAAGG + Intergenic
1104342716 12:127966570-127966592 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
1104342990 12:127968469-127968491 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
1104925356 12:132311228-132311250 GACATTTCAAAGAGGGAGAAAGG + Intronic
1105529081 13:21201940-21201962 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
1105790977 13:23798763-23798785 CAGAAGGCAAAGGGGGAGAGTGG - Intronic
1106443714 13:29803610-29803632 CAGAAAAAAAAAAGGGAGAAGGG + Intronic
1106532564 13:30607466-30607488 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1106910341 13:34456422-34456444 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1107169326 13:37321239-37321261 GAGAGTGGAGAGAGGGAGAAGGG + Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1107825287 13:44323961-44323983 CAGCTTGCAAAGAGGGAAGAGGG - Intergenic
1108334400 13:49424160-49424182 CAGCATGAAAAGAGGGGTAATGG + Intronic
1108480711 13:50867465-50867487 AAGAAAGGAAGGAGGGAGAAAGG - Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108686009 13:52819065-52819087 AAGAAAGAAAAGAAGGAGAAGGG - Intergenic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1109033458 13:57224226-57224248 AAGAATGAAAGGAGGGAGAAAGG + Intergenic
1109062757 13:57639131-57639153 CAGAAGGCACAGAGTAAGAAAGG - Intronic
1109342381 13:61077276-61077298 CAGAAGGCAAAGGGGGAGCGAGG - Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109642862 13:65213098-65213120 AAGGATGGAAAGAGGGAGGAAGG + Intergenic
1109656579 13:65399163-65399185 CAAAATGCAGAGAGTGTGAAAGG + Intergenic
1109718493 13:66247071-66247093 CAGAAGGCAAAGAGGAAGGAAGG - Intergenic
1109880767 13:68471736-68471758 CAGAAGGCAAAGATGGACAAAGG - Intergenic
1109888507 13:68575450-68575472 CAGAAACAAAAGATGGAGAAGGG - Intergenic
1109909715 13:68893304-68893326 GAGAGGGTAAAGAGGGAGAAAGG - Intergenic
1110169654 13:72485387-72485409 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1110186866 13:72685225-72685247 CAGAAAGCAAAGAGGAAGCGAGG - Intergenic
1110512936 13:76374447-76374469 CAGAATGCAAAAAGGGAAGTTGG - Intergenic
1110547937 13:76777337-76777359 CAGAATGAAATGGGGAAGAAAGG + Intergenic
1110734464 13:78919713-78919735 CAGAAGGCAAAGGGGGAGAAAGG - Intergenic
1111116683 13:83787523-83787545 CAGAATGAAACGAGAGAGAAAGG - Intergenic
1111189443 13:84789346-84789368 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1111234463 13:85390541-85390563 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111442818 13:88303395-88303417 CAGAAGTCAAAGAGGGAGTGAGG - Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1111808689 13:93070197-93070219 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1112301877 13:98238549-98238571 CAGAAGGCAAAGGAGGAGAAAGG + Intronic
1112423530 13:99275695-99275717 CAGAAAACAAAGAGGTAAAAAGG - Intronic
1112509831 13:99998978-99999000 CAGAAAGGAAAAATGGAGAAAGG - Intergenic
1112883127 13:104133971-104133993 CAGAGTGTAAAGAAGGAGATGGG + Intergenic
1113035574 13:106044318-106044340 AAGAATGCAAACAGGTAAAATGG - Intergenic
1113110144 13:106814205-106814227 CAGAAAGAAAAGAGGGAGGGAGG + Intergenic
1113257323 13:108521000-108521022 AAGGAGGGAAAGAGGGAGAAAGG - Intergenic
1113334835 13:109367781-109367803 CTAAATGCACACAGGGAGAATGG + Intergenic
1113576080 13:111396214-111396236 CAGCATGCACCGAGGGAGGAGGG + Intergenic
1114139226 14:19892699-19892721 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1114159443 14:20147297-20147319 AAGAATGCAAATAGGAAAAATGG + Intergenic
1114521320 14:23338992-23339014 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1114688921 14:24562268-24562290 CAGAAGGCAAACAGGGAGCAAGG - Intergenic
1114689202 14:24564389-24564411 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1114775892 14:25480906-25480928 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1115303461 14:31910896-31910918 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1115344193 14:32324794-32324816 GAGAATGCAGAGATGGAAAAAGG + Intergenic
1115443836 14:33466680-33466702 TGGAAGGCAAAGAGGGAGAGAGG + Intronic
1115811771 14:37117619-37117641 GGGAATACAAAGAGGGAGAGGGG + Intronic
1115904331 14:38190042-38190064 CAGAATTCCAAAAGGGAGAAAGG - Intergenic
1116249806 14:42466239-42466261 CAGAAAGCAGAGAGAGAGAGAGG + Intergenic
1116302161 14:43196629-43196651 GAGCATGAAAAGTGGGAGAAGGG + Intergenic
1116428202 14:44815967-44815989 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1116603277 14:46956075-46956097 CAGAAAGCAAAAATGGCGAAAGG + Intronic
1116647048 14:47541547-47541569 GAGAATGTAAAGAGGAAAAAGGG - Intronic
1116790225 14:49332034-49332056 TAGAATGAAGGGAGGGAGAAAGG - Intergenic
1116974122 14:51096260-51096282 AAGAAGGGAAAGAGGGAGAGAGG + Intergenic
1116975231 14:51108575-51108597 CAGGATCTAAAGAGGGAAAAGGG + Intergenic
1116982370 14:51185200-51185222 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1117084445 14:52184999-52185021 CAGAAGGCAAAGGGGGAGTGAGG + Intergenic
1117225023 14:53648350-53648372 CAGAAGGAGAAGAGAGAGAATGG + Intergenic
1117261015 14:54033420-54033442 CAAAATGCAAGGTGGCAGAAGGG - Intergenic
1117304221 14:54458327-54458349 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117841117 14:59861296-59861318 CAGCAGGCAAAGAGAGAGATTGG - Intronic
1117896589 14:60493998-60494020 CACAATGAAAAGAGGGACACTGG + Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118180025 14:63483442-63483464 CAGAATCACAAGAGGAAGAAGGG + Intronic
1118299936 14:64606245-64606267 GAGAATGCAGATAGGGAAAAAGG + Intergenic
1118354336 14:65000091-65000113 CAGAATGCCAAGGGGAAGATGGG + Intronic
1118472295 14:66085779-66085801 CAGCATGCAAAGAGAGAAAAAGG + Intergenic
1118474977 14:66108327-66108349 CAGAAAGAAAAGAGGTAGAGAGG + Intergenic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1119434739 14:74590839-74590861 CAGAAGGGAAAGAGTGGGAAGGG + Intronic
1119530807 14:75359803-75359825 CAAATTGTGAAGAGGGAGAAGGG + Intergenic
1120453962 14:84707919-84707941 CAGAAGGCAAAGTGGAAGCAAGG + Intergenic
1120492554 14:85195283-85195305 CAGAAGGCAAAGGGCGAGCAGGG - Intergenic
1120696507 14:87650754-87650776 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1120782052 14:88494184-88494206 CAGGCTGCAATGAGGGAGCAAGG + Intronic
1120906677 14:89626750-89626772 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1121060742 14:90907073-90907095 CTGGATGTTAAGAGGGAGAAAGG - Intronic
1121381909 14:93479252-93479274 AAGAATGGAGGGAGGGAGAAAGG - Intronic
1121500415 14:94431453-94431475 CAGAAGGCAAAGGGGGAGCAAGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121681295 14:95794814-95794836 CAGAATGCACTGAGGGATCAAGG + Intergenic
1121915328 14:97832895-97832917 CAGAAGGCGAAGAGGCAGAGGGG + Intergenic
1121986106 14:98507649-98507671 GAGAAGAAAAAGAGGGAGAAGGG + Intergenic
1122298464 14:100718624-100718646 CAGAAGGAAAAGAGAGAGAAAGG - Intergenic
1122317580 14:100835160-100835182 GGGAAGGCAGAGAGGGAGAAGGG - Intergenic
1124041751 15:26111787-26111809 TAGAATGTAAATAGGGAGAAAGG + Intergenic
1124047033 15:26159990-26160012 CAGGATTCAAAGACTGAGAAGGG + Intergenic
1124370163 15:29099981-29100003 CAGAATCCAAAGATCCAGAAGGG - Intronic
1124442135 15:29693736-29693758 CAGAAGGAAAAGAGAGAAAAGGG + Intergenic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1125002438 15:34785479-34785501 CAGAAGGCAAAGGGGGAGTGAGG - Intergenic
1125056538 15:35364864-35364886 CAGAAAGACTAGAGGGAGAATGG - Intronic
1125065941 15:35486442-35486464 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1125190093 15:36981817-36981839 CAGAATGAAAAGGCAGAGAATGG + Intronic
1125270044 15:37928895-37928917 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1125923058 15:43537969-43537991 CAGAAACAGAAGAGGGAGAAGGG + Intronic
1126570406 15:50144450-50144472 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1127940396 15:63689461-63689483 CAGAATGCCAAGAGAGGAAATGG + Intronic
1128383194 15:67128260-67128282 CATACTGCAAACAGGGAGAGCGG + Intronic
1128449567 15:67797062-67797084 CACAATGAAGAAAGGGAGAATGG + Intronic
1128673008 15:69588333-69588355 CAAAATGCAAAGAGAAAAAAAGG - Intergenic
1129373133 15:75110332-75110354 GAGAAGGCAAGGAGGCAGAACGG - Intronic
1129452747 15:75659915-75659937 CAGAAAGAAAAGAGAGAGGAGGG - Exonic
1129560304 15:76559433-76559455 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1130192154 15:81747664-81747686 CAGAATGCCAAGAGGAAGCAGGG - Intergenic
1130685007 15:86029559-86029581 CAGAATGCAAAGATAAAAAAAGG - Intergenic
1130837954 15:87670271-87670293 CAGAACTCAAAGATGTAGAAAGG - Intergenic
1131220712 15:90581834-90581856 CAGAATGCAGTGGGGGTGAAAGG + Intronic
1131529522 15:93179838-93179860 CAGACAGGGAAGAGGGAGAAAGG + Intergenic
1131567768 15:93502469-93502491 CAGAATTCAAATAGGAGGAAGGG - Intergenic
1131688866 15:94804862-94804884 CAGAAGGCCAAGAGGGAGACAGG + Intergenic
1131773332 15:95765211-95765233 CAGAAGGCAAAGAAGAAGCAAGG + Intergenic
1132206187 15:99987756-99987778 GAGAAGGCAGAGAGGGAAAACGG + Intronic
1132770189 16:1557858-1557880 AAGAAGGCAAACAGGGAGAAAGG + Intronic
1132907458 16:2290194-2290216 GAGAATCCAGTGAGGGAGAAGGG - Intronic
1133425128 16:5681730-5681752 CGTAATGCAAAGAACGAGAAGGG + Intergenic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1133967713 16:10543669-10543691 CAAAATGGAAATAGAGAGAAAGG + Intronic
1134332456 16:13263502-13263524 CAGAAGGCAAAGAGGTAGCAGGG - Intergenic
1135147541 16:19975771-19975793 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1135531642 16:23259724-23259746 GAGAAGGGAAAGAGGGAAAAGGG + Intergenic
1135592113 16:23712202-23712224 CAGCATGGCAGGAGGGAGAACGG + Intronic
1135640251 16:24113556-24113578 AAGAATGAAAAGAGAGAGGAAGG - Intronic
1135940317 16:26816731-26816753 CAGGATGGACAGAGGGAGAGGGG - Intergenic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1137488818 16:48913723-48913745 CAGAATGCAAAGGGAGAGGTAGG + Intergenic
1137552265 16:49445712-49445734 TAGAAAGCAGAGAGGGAGAGAGG - Intergenic
1137840056 16:51632474-51632496 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1137859341 16:51830547-51830569 AAGAATGAGAAGAAGGAGAAGGG - Intergenic
1138314995 16:56062289-56062311 GAAGATGGAAAGAGGGAGAATGG + Intergenic
1138600533 16:58051510-58051532 AAGAAGGGAAAGAAGGAGAAAGG + Intergenic
1138945956 16:61850192-61850214 CAGAAGGTGAAGAGGGAGCAAGG + Intronic
1139066302 16:63319532-63319554 ACGAAAGAAAAGAGGGAGAAAGG - Intergenic
1139412649 16:66776676-66776698 TAGATTGAACAGAGGGAGAATGG + Intronic
1139986506 16:70902842-70902864 CAGAAGGAAAAGAGAGAGAGTGG - Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1141017125 16:80461126-80461148 CAGAATCCAGAGAGAGAGAGAGG + Intergenic
1141882891 16:86871658-86871680 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1143287919 17:5805025-5805047 CAGAAGGCAGAGAGAGAGAGAGG + Intronic
1143591292 17:7886908-7886930 CAGAAAGCCAAGAGGGAAAGGGG - Intronic
1143935920 17:10483915-10483937 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1145024419 17:19457239-19457261 CAGAATTCCAACAGGGAGAAGGG + Intergenic
1146226286 17:31069340-31069362 CACAATGCTAACAGGCAGAACGG - Intergenic
1146604378 17:34245856-34245878 AAGAAAGGAAAGAGAGAGAAGGG + Intergenic
1146681131 17:34809154-34809176 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1146778366 17:35643349-35643371 CAGTAAGCAGAGAGGAAGAAAGG - Intronic
1146845607 17:36179846-36179868 CAAAAGGCAAAGAGAGAGACAGG + Intronic
1146873824 17:36391691-36391713 CAAAAGGCAAAGAGAGAGACAGG + Intronic
1146881181 17:36442781-36442803 CAAAAGGCAAAGAGAGAGACAGG + Intergenic
1147065566 17:37921180-37921202 CAAAAGGCAAAGAGAGAGACAGG - Intergenic
1147303760 17:39549514-39549536 AAGAATGGAGAGAGGGAGGAAGG - Intronic
1147943658 17:44067763-44067785 GAGAGGGCAAAAAGGGAGAAGGG - Intergenic
1147997981 17:44371686-44371708 AAAAAAGAAAAGAGGGAGAAAGG - Intergenic
1148660617 17:49328645-49328667 CAGAATGCAAAGGGGGAAGCAGG - Intronic
1148979043 17:51555285-51555307 AAGAATGTAGAAAGGGAGAAAGG - Intergenic
1149199888 17:54172304-54172326 CAGAATAGAAAGAGTCAGAAGGG - Intergenic
1149458762 17:56810615-56810637 CAAAAGGCAAAGAGCCAGAAGGG + Intronic
1149587319 17:57800652-57800674 CAGAAGGTAAAGAGGGAGGGAGG - Intergenic
1150011476 17:61508594-61508616 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1150543619 17:66129982-66130004 AAGAAGGGAAAGAGGGGGAAGGG + Intronic
1150574090 17:66414367-66414389 CAGAAGGCAAAGCGGGAGGGAGG - Intronic
1150843919 17:68635402-68635424 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1151146156 17:72043291-72043313 CAGAGTGGAAATAGGGAGAGAGG - Intergenic
1151205743 17:72505454-72505476 CAGAAGGCAAAGGAGGAGAAAGG + Intergenic
1151550833 17:74821719-74821741 AGGAAGGCAAGGAGGGAGAACGG - Intronic
1152270064 17:79319339-79319361 GAGAAAGGAAAGAGGCAGAACGG + Intronic
1152831420 17:82499368-82499390 CAGAAAGCAAAGATGCAGAAGGG - Intergenic
1153138779 18:1948003-1948025 CAGAATGCAAAGGGGAAGCAAGG + Intergenic
1153504235 18:5779776-5779798 GATAATGCAAGGAGGCAGAATGG + Intergenic
1153604447 18:6817726-6817748 CACATTCCAAGGAGGGAGAATGG + Intronic
1154396099 18:13990772-13990794 CAGGAGGCAAAGGGGGAGCAAGG - Intergenic
1154493105 18:14936365-14936387 AAGCAAGCAAAGAGGGAGGAAGG - Intergenic
1155394539 18:25373050-25373072 CAGAAGGGAAAGATTGAGAAAGG - Intergenic
1155609865 18:27654332-27654354 CAGAAGGCAATGTGGTAGAAAGG + Intergenic
1155733431 18:29191195-29191217 CAGGGTGGAAAGAGGGTGAAGGG - Intergenic
1156052022 18:32948597-32948619 CAGATTGCAAAGAAGTAAAATGG - Intronic
1156070753 18:33204938-33204960 CAGGAAACAAGGAGGGAGAAAGG + Intronic
1156524963 18:37758275-37758297 CTGAAGGCAAAGGGGGAGCAGGG + Intergenic
1156665989 18:39407751-39407773 CAAAATGAAAACAGGAAGAAAGG - Intergenic
1156821358 18:41376845-41376867 ATGAATGTAAACAGGGAGAATGG + Intergenic
1156985054 18:43341301-43341323 TAGGATGGAGAGAGGGAGAAGGG + Intergenic
1157060266 18:44279916-44279938 TAGAGGGCAATGAGGGAGAAAGG + Intergenic
1157257813 18:46154037-46154059 GAGAATTCAAAGATGGAGGAAGG + Intergenic
1157330348 18:46699677-46699699 GTGAAAGAAAAGAGGGAGAAAGG - Intronic
1157332579 18:46714444-46714466 AAGAAGGAGAAGAGGGAGAATGG + Intronic
1157532843 18:48436564-48436586 CAGATTGCCAGGATGGAGAAAGG + Intergenic
1157708281 18:49827722-49827744 CAGAAGGAAAAGAGCAAGAAGGG + Intronic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158485216 18:57860145-57860167 CAGAAAGAGAAGAGAGAGAAAGG - Intergenic
1158493500 18:57931726-57931748 AAGAAAAGAAAGAGGGAGAAGGG - Intergenic
1158508910 18:58072337-58072359 CAGAATACAAGTAGTGAGAATGG - Intronic
1158509051 18:58074204-58074226 CAGAATACAAGTAGTGAGAATGG - Intronic
1159089217 18:63828303-63828325 CAGAAGACAAAGAGGGAGTGAGG - Intergenic
1159104124 18:63986219-63986241 TAGAAAGAAAAAAGGGAGAAAGG - Intronic
1159265630 18:66074762-66074784 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1159335631 18:67061874-67061896 CAGAATGCAAAGACAGATTATGG + Intergenic
1159583948 18:70265074-70265096 CTGAATTCTAAGAAGGAGAAAGG - Intergenic
1159693847 18:71528133-71528155 CAGTATGGAAAGAGAGAAAACGG - Intergenic
1159697221 18:71575255-71575277 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
1159762777 18:72449231-72449253 CAGAAAGGAAAGAGGGAGATTGG - Intergenic
1160006783 18:75074111-75074133 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1160615209 18:80121168-80121190 AAGGAAGCAGAGAGGGAGAAAGG - Intronic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1162641616 19:12014639-12014661 GAGAAGTCACAGAGGGAGAATGG - Intergenic
1162826287 19:13254337-13254359 AAGAAAGAAATGAGGGAGAAGGG - Intronic
1163093286 19:15036139-15036161 AAGAAGGAAAAAAGGGAGAAAGG + Intergenic
1163990829 19:20997909-20997931 CAGAAGGCAAAAGGGAAGAAAGG + Intergenic
1164411402 19:28008828-28008850 CAGTATGCAAAGAGCCAGCAGGG + Intergenic
1164442209 19:28287858-28287880 GAGAATGGAATGAGAGAGAAGGG + Intergenic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1164613616 19:29650907-29650929 CTGAATTCCAAGAGGGAGGAGGG + Intergenic
1164843728 19:31414155-31414177 CAGAATGCACAGAGAGAGATGGG + Intergenic
1164854537 19:31510995-31511017 CAAAATGCAAAGAGAAAGGAGGG + Intergenic
1164934626 19:32201366-32201388 GAGCCTGCAAGGAGGGAGAAAGG + Intergenic
1165283078 19:34814648-34814670 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1165964757 19:39567039-39567061 AGGAATGGAATGAGGGAGAAAGG + Intergenic
1165991286 19:39816145-39816167 CAGAGTGGAAAATGGGAGAAGGG + Intergenic
1166146473 19:40840255-40840277 CAGAAAGCAAAGAGGGAGTAAGG - Intronic
1166150519 19:40870868-40870890 CAGAAAGCAAAGAGGGAGTAAGG - Intronic
1166328694 19:42066481-42066503 AAAAAAGCAAAGAGAGAGAAGGG + Intronic
1166426239 19:42680898-42680920 AGGAAGGCAAAGAGGGAGCAAGG - Intronic
1166432386 19:42738619-42738641 CATAATGCAGAGAGGGACACAGG + Intronic
1166435505 19:42763807-42763829 CATAATGCAGAGAGGGACACAGG + Intronic
1166449513 19:42886233-42886255 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166455256 19:42935295-42935317 CATAATGCAGAGAGGGACACAGG + Intronic
1166460811 19:42986526-42986548 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166465042 19:43024582-43024604 CATAATGCAGAGAGGGACACAGG + Intronic
1166471176 19:43080772-43080794 CATAATGCAGAGAGGGACACAGG + Intronic
1166478106 19:43146516-43146538 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166482328 19:43184673-43184695 CATAATGCAGAGAGGGACACAGG + Intronic
1166681194 19:44768177-44768199 CAGACTCCAAAGATGGAGGAAGG + Intergenic
1166725222 19:45022955-45022977 CATAGTGCAAAGAGACAGAAAGG + Intronic
1167101926 19:47409047-47409069 GGGAATGGAGAGAGGGAGAAGGG - Intronic
1167402504 19:49282290-49282312 CAGAAGGCAAAGGGGAAGAAAGG + Intergenic
1167408198 19:49328239-49328261 CAGAAGGCAAAGGGGAAAAAAGG + Intergenic
1167424256 19:49421992-49422014 CAGAAAGCCAAAAGGGTGAAAGG + Intergenic
1167464876 19:49645439-49645461 AAGAATGCAGAGAGGGGGCAGGG - Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
925079932 2:1056040-1056062 CAGAGTGGACACAGGGAGAAGGG + Intronic
925166725 2:1720136-1720158 AAGAATGCAGAGAGAGAGAGAGG + Intronic
925178272 2:1799950-1799972 CAGAAGGTAAAGAGGAAGCAAGG - Intronic
925205547 2:2002908-2002930 CAGAAGGTAAAGAAGGAGCAAGG - Intronic
925218272 2:2116210-2116232 CAGAAGGCAAACAAGGACAAAGG - Intronic
925231504 2:2237169-2237191 CAGAAAGGAAAGAGTGAGATGGG - Intronic
925236360 2:2281221-2281243 CAGAAGGCAAAGCTGAAGAAAGG - Intronic
925242487 2:2344132-2344154 CAGACTGCAAAGGGAGAGAAGGG + Intergenic
925480189 2:4261879-4261901 AAGAAGGGAAAGAGGTAGAAAGG + Intergenic
925660242 2:6194592-6194614 CAGAATGCAAAGGGGAAGCAAGG - Intergenic
926037420 2:9646413-9646435 CAGCATGCAATGAGAGAGCAAGG - Intergenic
926539899 2:14163013-14163035 CAGAAGGCAAAGGAGGAGAAAGG + Intergenic
926647380 2:15304295-15304317 CAGAAGGCAAAGGGGAAGAAAGG - Intronic
926653421 2:15371205-15371227 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
926763958 2:16306023-16306045 CAGAAGGACAAGAGGAAGAAGGG - Intergenic
926862333 2:17322185-17322207 CAGAAGGCAAAGGAGGAGAAAGG - Intergenic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
926989958 2:18668035-18668057 CAGAAGGCAAACGAGGAGAAAGG - Intergenic
927454515 2:23238025-23238047 AAGAATGCAAAGTGGCAGACAGG + Intergenic
927468391 2:23353869-23353891 CAGGATCCAAGGAGGGAGCATGG + Intergenic
927649604 2:24904107-24904129 CAAAATGCAAAAAGGAAGGAAGG + Intronic
927939115 2:27092712-27092734 CAGGAAGCAAGGAAGGAGAAAGG - Intronic
928415175 2:31085889-31085911 CAGAAGGCAAAGGAGGAGCAAGG + Intronic
928498610 2:31862984-31863006 AAGAAAGAAAAGAGGGAAAAAGG + Intergenic
928605551 2:32942412-32942434 CAGAAAGCAATGAATGAGAAAGG - Intergenic
928771595 2:34708358-34708380 CAGAAGGCAAAGGGGAAGAAAGG - Intergenic
928790852 2:34950910-34950932 CAAAAGGCGAGGAGGGAGAAAGG + Intergenic
929612642 2:43283146-43283168 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
929705001 2:44201280-44201302 CAGCATGCAAGGATGGAGAGTGG + Exonic
929785541 2:44988229-44988251 CAGAAGGCAAAGTGGGAGTAAGG + Intergenic
930333384 2:50015310-50015332 AAGAATGCTAGGAGGGAAAAAGG + Intronic
931952911 2:67385187-67385209 CAGAAGGCCAAGGGGGAAAAAGG - Intergenic
931984019 2:67724216-67724238 CAGTCTGCAAAGAGAGAAAAAGG + Intergenic
932458423 2:71864940-71864962 AAGAAAGGAAGGAGGGAGAAAGG - Intergenic
932489440 2:72111126-72111148 GAGACTCAAAAGAGGGAGAAGGG - Intergenic
933192973 2:79357527-79357549 CAGATAGAAAAGAGAGAGAATGG + Intronic
933415304 2:81979879-81979901 CAGAAAGCAAAGAGTAAAAAGGG - Intergenic
933472656 2:82746649-82746671 CAGAAAGCAGCGTGGGAGAAGGG - Intergenic
933798833 2:85943496-85943518 CAGAAGGCAAAGGAGGAGAAAGG + Intergenic
933933724 2:87182003-87182025 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
934042588 2:88141010-88141032 AAGAAAGAAAAGAGGGAGGAGGG - Intergenic
934965805 2:98720846-98720868 CAGAAGGAAAGGAGAGAGAAAGG + Intronic
935167868 2:100585423-100585445 CAGAAGGCAAAGGGGGAGTGAGG - Intergenic
935197425 2:100825882-100825904 AAGAATGCAAAGGTGAAGAAGGG + Intronic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
936014636 2:108948574-108948596 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
936262979 2:110978261-110978283 CAGAAGGCAGAAGGGGAGAAAGG + Intronic
936359386 2:111783441-111783463 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
936481198 2:112886375-112886397 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
936502654 2:113078342-113078364 CAGAAGTCAGGGAGGGAGAAGGG - Intergenic
936679823 2:114757248-114757270 AAGAAAGGGAAGAGGGAGAAAGG + Intronic
937071946 2:119070755-119070777 CAGAAGACAAAGAGAGAAAAGGG - Intergenic
937260140 2:120580199-120580221 AAGAAGGCAAGCAGGGAGAAGGG - Intergenic
937444090 2:121941968-121941990 AAGAAGGGAAAGAGGCAGAAAGG - Intergenic
937596009 2:123674298-123674320 CAGTCTGCAAACATGGAGAAAGG + Intergenic
937759013 2:125577168-125577190 AAGAAAGAAAAGAGGGAGAGAGG + Intergenic
937811851 2:126208119-126208141 CAGAAGGTAAAGAGGAAGCAAGG - Intergenic
937862924 2:126725462-126725484 CAGAAGGCAAAGAGACAGAAAGG + Intergenic
937935114 2:127237776-127237798 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
937950441 2:127383026-127383048 CATAAGGCAAAGTGGGAGCAAGG + Intronic
938122632 2:128644715-128644737 GGGAAGGCAGAGAGGGAGAAAGG - Intergenic
938805756 2:134805980-134806002 CAGAAAGGAAAGAGAGAGACAGG - Intergenic
938810945 2:134852328-134852350 CAGAATGGAAGCAGGGAGATGGG + Intronic
938925110 2:136032156-136032178 CAGACTACATACAGGGAGAAAGG - Intergenic
938973796 2:136456502-136456524 CAGAATGGGAAGGGGGAAAAGGG + Intergenic
939089555 2:137763161-137763183 TAGGATGCAAGGTGGGAGAATGG + Intergenic
939114560 2:138045485-138045507 CAGTCTGAAAAGAGGGAGAGTGG - Intergenic
939121956 2:138127641-138127663 AAGAAGGGAAGGAGGGAGAAAGG - Intergenic
939254505 2:139724804-139724826 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
939255133 2:139733617-139733639 TAGAAGGCAAAGTGGGAGCAAGG + Intergenic
939264425 2:139853011-139853033 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
939451798 2:142384004-142384026 AAGAAGGAAAAGAAGGAGAAAGG - Intergenic
939803798 2:146748038-146748060 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
939820939 2:146956047-146956069 CAGAATACAAAGCTGGAAAAGGG + Intergenic
939887946 2:147701684-147701706 CAGAAAGCAAAGAAGAAGCAAGG + Intergenic
940026195 2:149211043-149211065 CAGAAGGCAAAGAGGGAATGAGG + Intronic
940113227 2:150178614-150178636 GAGCAAGCAAAGAGGCAGAAAGG + Intergenic
940610280 2:155981302-155981324 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
940642999 2:156366818-156366840 CAGGATGCACAGAGTGAGAGAGG + Intergenic
940804238 2:158168102-158168124 TAAAATGCAAACAGGGAAAATGG + Intergenic
940812636 2:158262626-158262648 CAGAAGGTAAAGGGGAAGAAAGG + Intronic
941361071 2:164551979-164552001 CAGAAGACAAAGCGGGAGCAGGG + Intronic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
942135243 2:172919000-172919022 CAGAAGGCAAATGGGGAGACAGG - Intronic
942201217 2:173573286-173573308 CAGAAAGCAGAGAGAGAGAGTGG - Intergenic
942687818 2:178552304-178552326 AAGAATGCCAAGAAGGAGCATGG - Exonic
943082452 2:183271496-183271518 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
943487644 2:188507047-188507069 AAGAATGCAAAGTGGGTGGATGG - Intronic
943557653 2:189425846-189425868 CAGAAGGCAAAGGGGGAGTGAGG - Intergenic
943825028 2:192379257-192379279 CAAAATGGAAAGAAAGAGAAAGG - Intergenic
943907510 2:193518284-193518306 CAAACTGCAAAGAAGGAGAGGGG - Intergenic
944039568 2:195338520-195338542 GAGAAAGAAAAGAGGGAAAAAGG - Intergenic
944072287 2:195685582-195685604 TAGAAAGTGAAGAGGGAGAAAGG - Intronic
944223955 2:197330983-197331005 CAGAAGGCAAAGAGAAAGCAAGG + Intergenic
944224855 2:197339488-197339510 CAGAGAGCAGAGAGGGACAAAGG + Intergenic
944273249 2:197805563-197805585 CAGAACGCAAAGACGCAGAGCGG - Intronic
944439615 2:199728630-199728652 GACAATGCAAAGTGGGAGAGAGG + Intergenic
944546227 2:200801664-200801686 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
944817572 2:203393913-203393935 GAGGATGAAAAGAGGAAGAAAGG - Intronic
944867010 2:203872173-203872195 AAGAAGGGAGAGAGGGAGAAGGG - Intronic
944941392 2:204632219-204632241 CAGAAGGCAAAAGGGGAGCAAGG - Intronic
945358015 2:208861350-208861372 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
946201387 2:218072753-218072775 CAGAGTGCACAGGGGCAGAATGG - Intronic
946461056 2:219869375-219869397 CAGAAGGCAAAGGGGAAGTAAGG + Intergenic
946640164 2:221775370-221775392 GAGAATGCAGAGAGGGAGAGAGG - Intergenic
946985626 2:225269578-225269600 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
947236685 2:227948789-227948811 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
947514544 2:230790582-230790604 CAGAAACAAAACAGGGAGAAAGG - Intronic
947941019 2:234054939-234054961 AAAAATGCAAAGAGGTTGAAAGG - Intronic
948219583 2:236259075-236259097 GAGAACACAGAGAGGGAGAAAGG - Intronic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
1169010162 20:2243865-2243887 CAAAATCCATAAAGGGAGAAGGG + Intergenic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1169314421 20:4576612-4576634 CAGCAGGCAAAGAGAGAGATTGG - Intergenic
1169681063 20:8214429-8214451 CAGAAGGCAAAGGGGGAGGAGGG - Intronic
1169770069 20:9190418-9190440 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1169872942 20:10266757-10266779 CAAAATGTAAAGAGTGAAAATGG + Intronic
1170018201 20:11806745-11806767 CAGGAGGAAAAGAGTGAGAAGGG - Intergenic
1170148084 20:13199360-13199382 GAGAAAGGAAGGAGGGAGAAAGG - Intergenic
1170148088 20:13199375-13199397 GAGGACGGAAAGAGGGAGAAAGG - Intergenic
1170445763 20:16425935-16425957 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1170491960 20:16886365-16886387 AGGTATGCAAAGAGGGAGGAAGG + Intergenic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1171135148 20:22688853-22688875 CAGCATGCACAGATGGGGAAAGG - Intergenic
1171235797 20:23523669-23523691 CAAAATGCAAAGAGGGAAGAGGG + Intergenic
1172265247 20:33606515-33606537 CAGCAAGCCAGGAGGGAGAAGGG - Intronic
1173065507 20:39706755-39706777 CAGAAGGCAAAGAGGGCAAGAGG - Intergenic
1173098181 20:40058676-40058698 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1173266225 20:41484839-41484861 CAGAAGATAAAAAGGGAGAAAGG + Intronic
1173348289 20:42221458-42221480 CAGAAAGCAAAGGGGAAGCAAGG + Intronic
1174580583 20:51568683-51568705 CAGCAGGCAAAGAGAGAGATTGG - Intergenic
1174641765 20:52050442-52050464 CAGAAGGAGAAGAGGAAGAAGGG - Intergenic
1174651246 20:52127546-52127568 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1175462066 20:59159296-59159318 CAGCATCCAAACAGGGAGAGGGG - Intergenic
1175503088 20:59464062-59464084 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1175585104 20:60132930-60132952 CAGAATGGAAAGTGTGAGGAAGG + Intergenic
1175856738 20:62124790-62124812 CAGCATGCACAGAGGGACAGTGG - Intronic
1177544128 21:22534641-22534663 CAGAATGCAGAGAGAAAAAAAGG - Intergenic
1178024164 21:28446147-28446169 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1178067603 21:28923035-28923057 CAAAAAGCAAAGAGAAAGAATGG + Intergenic
1178246197 21:30955056-30955078 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1178451639 21:32707064-32707086 CAGTATGAAAAAAGGGAGAAAGG - Intronic
1178514587 21:33236134-33236156 AAGATTGCAAAGAGGAAGAGAGG + Intronic
1178740326 21:35194025-35194047 CGGAAGGCAAAGAGGAAGGAAGG + Intronic
1178784184 21:35637268-35637290 CAGCATCTAAAGAGGGAGAAAGG + Intronic
1178862012 21:36297503-36297525 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1179085395 21:38212211-38212233 CAGAAAGCAAAGGGGAAGCAAGG - Intronic
1179088497 21:38242000-38242022 CAGAGGGCAAAAAGGGAGCAAGG - Intronic
1179142510 21:38738542-38738564 CAGAAGGCAAAGGAGGAGAAAGG - Intergenic
1179227815 21:39471089-39471111 CAGAATGGACAGAAGAAGAAAGG - Intronic
1179415565 21:41195591-41195613 CAGGATTGAAACAGGGAGAATGG - Intronic
1179988880 21:44935539-44935561 CAGAATGCAGAGAGGGGGCTAGG - Intronic
1180234615 21:46450305-46450327 CAGAAGACAAAGGGGGAGCAAGG - Intergenic
1181020414 22:20098747-20098769 CAGCATGCACACAGAGAGAAAGG - Intronic
1182148423 22:28011870-28011892 CAGAGGGCAAAGATGGAGACTGG - Intronic
1183214939 22:36473533-36473555 CAGAAAGAAAAGAGGAAGGAAGG + Intronic
1183312472 22:37118111-37118133 CAGAAGGCAAAGGAGGAGTAAGG + Intergenic
1184451630 22:44586064-44586086 CAGGATGGAGGGAGGGAGAATGG - Intergenic
1185016918 22:48349658-48349680 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1203290071 22_KI270735v1_random:28094-28116 GAGAATGGTAAGAGGGAGGAGGG - Intergenic
949151387 3:772158-772180 GACAATGCACAGTGGGAGAAAGG + Intergenic
949359863 3:3220335-3220357 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
950024532 3:9811070-9811092 CAGCAGCCAAAGAGGGAGAAAGG - Intronic
950741405 3:15055037-15055059 CAGAAGGCAAAGGGGGAGCAAGG + Intronic
950766128 3:15274407-15274429 CAGAAGGCAAAGGGGGAACAGGG + Intronic
950903846 3:16520058-16520080 CAGACTGCAGGGAGGGAGAAAGG + Intergenic
950913347 3:16617397-16617419 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
951061859 3:18218139-18218161 CGGAAAGGAAAGAGGAAGAAAGG + Intronic
951394579 3:22149802-22149824 AGGATAGCAAAGAGGGAGAAAGG - Intronic
951458174 3:22917013-22917035 TAGAAAGCAATGAGGGAAAAGGG + Intergenic
952130831 3:30360400-30360422 CAGAATGTAAAGAGGCTGAGAGG + Intergenic
952947732 3:38490891-38490913 CAGAATTCAAAGAGGAACACAGG - Exonic
952991141 3:38832016-38832038 GAGAAGGCAAAGACAGAGAAAGG + Intergenic
953222972 3:40989989-40990011 AAGAATGCAAAGAATGGGAATGG - Intergenic
953624687 3:44561222-44561244 CAGAAGGCAAAGAGGAAGGAAGG + Intronic
954404801 3:50339669-50339691 CAGAATGCAAAGAATGAACAAGG - Intronic
954603427 3:51890628-51890650 CTGATTGCAAAGAGAGAGAGTGG - Intergenic
955217304 3:56994994-56995016 CAGAAGGCAAAGAGGAGGCATGG - Intronic
955403608 3:58611100-58611122 CAGAAGGCAAAGGGAAAGAAAGG - Intronic
955539048 3:59954769-59954791 CAGAATGCTAGGAGGGACCAGGG + Intronic
955586134 3:60480109-60480131 CAGAAGGCAAAGAGAAAGCAAGG + Intronic
955823547 3:62921606-62921628 CAGAAGGCAAAGGGGAAGTAAGG - Intergenic
956105703 3:65815939-65815961 CAGAATTCAAAGGAGGACAAAGG + Intronic
956354780 3:68378875-68378897 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
956647350 3:71469289-71469311 CAGATTTCAAAGAAGGAAAAAGG + Intronic
956661364 3:71601577-71601599 CTGACTGCAATGAGGGAGGAAGG + Intergenic
956969701 3:74508262-74508284 CAGAAGGCAAAGAAGCAGCAAGG - Intronic
957416951 3:79917517-79917539 AAGAATGGAGGGAGGGAGAAAGG + Intergenic
957544864 3:81624121-81624143 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
957594001 3:82236992-82237014 AAGGATGCAAAGATGGAGAAAGG + Intergenic
957971025 3:87382318-87382340 CATAATTCAAAGAGGAAGAAAGG - Intergenic
957982471 3:87526853-87526875 CAGTAGGTAAAGAGGAAGAAAGG - Intergenic
958175613 3:89992052-89992074 CAGAAGGAAGAGAGAGAGAAAGG - Intergenic
958582013 3:96039016-96039038 CAGAAGGGAAAGAGGAAAAAGGG + Intergenic
958672311 3:97220525-97220547 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
958735701 3:98007231-98007253 CTGACTGAAATGAGGGAGAAGGG + Intronic
959134571 3:102400788-102400810 AAAAATACAAAGAGGAAGAATGG + Intronic
959143531 3:102515669-102515691 CAGAAAGCAAAGGGGAAGCAAGG - Intergenic
959241400 3:103799884-103799906 AAGAATGCAAAGGGAGATAAGGG - Intergenic
959435465 3:106309925-106309947 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
959502923 3:107127247-107127269 CAGAATGAAAGGGTGGAGAAAGG - Intergenic
959561594 3:107788802-107788824 CAGAATGGAAAGAGAGAAACTGG + Intronic
959678161 3:109060826-109060848 CAGAAGGCAAAAAGGAAGCAAGG + Intronic
959685503 3:109141367-109141389 CAGAAGGCAAAGAGGGTGAAAGG - Intergenic
959741976 3:109730978-109731000 CAGAAGGCAAAAAAGGAGAAAGG + Intergenic
959879575 3:111428103-111428125 CAGAAGGCAAAGTGGGACCAAGG - Intronic
960255242 3:115504885-115504907 CGGAATGCAAAGGAGGAGAAAGG - Intergenic
960355899 3:116652920-116652942 CAGAAAGCAAAGGGGAAGAAAGG + Intronic
960481067 3:118190619-118190641 CAGAAAGCAAAAAGGAAGAAAGG - Intergenic
961336497 3:126183214-126183236 CAGAAGCCCAAGAGAGAGAAGGG + Intronic
961957441 3:130818564-130818586 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
962033400 3:131625089-131625111 CAAGGTGCAAAGAGAGAGAAAGG - Intronic
962694082 3:137930463-137930485 CAGAAAGCAGGAAGGGAGAAAGG + Intergenic
962779109 3:138694460-138694482 CAAAATTTAAAGAGGGAAAAAGG - Intronic
962888271 3:139648245-139648267 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
963155341 3:142090508-142090530 CAGAAGACAAAGAAAGAGAATGG - Intronic
963311828 3:143718222-143718244 AAGATTGCAAAGAGGAAAAAGGG - Intronic
963522939 3:146378907-146378929 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
963634426 3:147776609-147776631 CAGAGTAGAAATAGGGAGAATGG - Intergenic
963810632 3:149773133-149773155 CAGAAAGGAAAGAAAGAGAAAGG - Intronic
963843771 3:150134127-150134149 TAGAAGGCAAAGGAGGAGAAAGG - Intergenic
964002390 3:151790933-151790955 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
964032112 3:152150780-152150802 CAGATTGCAAGGAGGAAGGAAGG - Intergenic
964275638 3:155005756-155005778 CAGAAGGCAAAGTGGAAGCAAGG - Intergenic
964275885 3:155008631-155008653 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
964299231 3:155269802-155269824 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
964696997 3:159520170-159520192 GAGAATGCAAAGACGGAGGTAGG + Intronic
964902904 3:161681425-161681447 CAGAATTCCAAAAGGGGGAAGGG - Intergenic
965127681 3:164650622-164650644 CAGCAGGCAAAGAGAGAGATTGG - Intergenic
965367155 3:167815029-167815051 CAGAATGCAAAGGGGTATGAAGG - Intronic
965369489 3:167843007-167843029 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
965950617 3:174303795-174303817 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
965957485 3:174388866-174388888 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
966088306 3:176098430-176098452 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
966547358 3:181165514-181165536 CAGAAGGAAAAGAGAGAGAAAGG - Intergenic
966721326 3:183064950-183064972 CAGTTTGCACAGAGAGAGAAAGG - Intronic
966761235 3:183420710-183420732 CAGAAGGCAAAGGGGAAGTAAGG + Intronic
967458513 3:189718397-189718419 CAGAAGGCAAAGGGGAAGGAAGG + Intronic
967521146 3:190434412-190434434 CAGCAGGCAAAGAGAGAGTAAGG - Intronic
967844983 3:194036005-194036027 CAAAAGGCAAAGAGAGAAAAGGG + Intergenic
968446888 4:656710-656732 CCAAATGCAGAGAGGGAGAGAGG + Intronic
968530375 4:1087860-1087882 CAGAAGGCAAAGGGGGAGCAAGG - Intronic
968530672 4:1089825-1089847 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
968805870 4:2772074-2772096 GAGAATGCAGGGAGGGAGCAGGG + Intergenic
968824084 4:2880038-2880060 CACAATGCAATGAGAGAGAAAGG - Intronic
969897581 4:10319650-10319672 CAGGATGCAGAAAGTGAGAAAGG + Intergenic
969904812 4:10383961-10383983 CAGAAGGCAAGGAGGAACAAAGG - Intergenic
969986351 4:11215146-11215168 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
969996821 4:11321686-11321708 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
970059063 4:12009657-12009679 AAGAATGGAAGGAGGGAGAGAGG - Intergenic
970087091 4:12361993-12362015 CAGAAGGCAAAGAGCAAGCAAGG + Intergenic
970155902 4:13141595-13141617 TAGAAGGCAAAGGAGGAGAAAGG + Intergenic
970215152 4:13751167-13751189 CAGATCACAAAGAAGGAGAAGGG + Intergenic
970297182 4:14642277-14642299 AAGGAGGCAAAGAGGGAGGAAGG + Intergenic
970577578 4:17443241-17443263 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
970670753 4:18394157-18394179 CAGAAGGCAAAGGAGGAGCAAGG - Intergenic
970712442 4:18879034-18879056 CAGAATGCAAAGGGGAAGCAAGG + Intergenic
970790570 4:19853615-19853637 CAGAAGGCAAGGCGGGAGCAAGG + Intergenic
971208088 4:24589487-24589509 GAGGATTCAAAGAGGGAGACTGG - Intergenic
971218339 4:24682412-24682434 CAGAATGAAAAGAGAGAGGGAGG - Intergenic
971248759 4:24954068-24954090 CAGAAGGAGAAGAGAGAGAAAGG + Intronic
971276071 4:25198160-25198182 CAGAAGGCGAAGGGGAAGAAAGG - Intronic
971643953 4:29172029-29172051 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
971734383 4:30427450-30427472 CAGAAGGCAAAGAGGGAACAAGG + Intergenic
971968076 4:33588332-33588354 AAGAAAGGAAAGAGGGAGAGAGG + Intergenic
972033764 4:34494655-34494677 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
972107178 4:35503710-35503732 CAGAAGGGAAAGGGGAAGAAAGG - Intergenic
972295047 4:37729454-37729476 CAGGAGGTCAAGAGGGAGAATGG + Intergenic
972316819 4:37934478-37934500 CAGATTGGAAGGAGGGAGAAAGG + Intronic
972491091 4:39587775-39587797 AAGAAAGGAAAGAGGGAGGAAGG + Intronic
973048058 4:45560873-45560895 CAGAATGTAAAGATTAAGAATGG - Intergenic
973726502 4:53782299-53782321 CAGCAGGCAAAGAGGGAGGATGG - Intronic
973756908 4:54083868-54083890 CAGAAAGCAAAGAGTGTGAGTGG - Intronic
973832075 4:54771698-54771720 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
973979281 4:56293620-56293642 CAGAAGGCAAAGAGGGAGTGAGG + Intronic
974309506 4:60186979-60187001 CAGAAAGTGAAGAGAGAGAACGG + Intergenic
974703904 4:65487032-65487054 CAGAAGGCAAAGAAGGAGTGAGG - Intronic
974806246 4:66883739-66883761 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
975002457 4:69241315-69241337 CTGAATTCAAAAAGGGAGGAGGG + Intergenic
975007440 4:69308458-69308480 CTGAATTCAAAAAGGGAGGAGGG - Intronic
975010562 4:69345297-69345319 CTGAATTCAAAAAGGGAGGAGGG + Intronic
975491601 4:74995269-74995291 CAGAGTACAAATAGGCAGAAAGG + Intronic
975504319 4:75121704-75121726 AAGAATGAAAAGAGAGTGAAGGG + Intergenic
975724230 4:77276443-77276465 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
975974138 4:80075660-80075682 CAGTTGGCAAAGAGTGAGAAGGG - Intronic
976164081 4:82235104-82235126 CGGAAGGCAAAGGGGAAGAAAGG - Intergenic
976282830 4:83342081-83342103 CAGAAGGCAAAGAGGGAGCGAGG + Intergenic
976551702 4:86403640-86403662 CAGAAGACAAAGGGGGAGCAAGG + Intronic
976986944 4:91313350-91313372 AAGAATGCAAACAAAGAGAAGGG - Intronic
977016238 4:91695887-91695909 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
977064066 4:92291210-92291232 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
977393018 4:96437392-96437414 TAGAAGGCAAAGAGGAAGCAAGG + Intergenic
977638064 4:99323468-99323490 CACAATGAAAAGACGGAGTAGGG - Intergenic
977652265 4:99484605-99484627 CAGAATACTGAGAGGGAGCATGG - Intergenic
978013672 4:103719089-103719111 CAGAGAGGAAAGAGGGAGAAGGG - Intronic
978121947 4:105090625-105090647 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
978492193 4:109321371-109321393 AAGAAGGCAAAGGGGAAGAAAGG + Intergenic
978591708 4:110330801-110330823 CAGGAGACAAAGGGGGAGAAGGG - Intergenic
978667249 4:111199091-111199113 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979211036 4:118103392-118103414 CAGAATTGAGAGAGGAAGAAGGG + Intronic
979399691 4:120233367-120233389 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
979703187 4:123690420-123690442 CAGAAGGCAGAGGGGGAGCAAGG + Intergenic
980064252 4:128166403-128166425 CAGAATGAAAGGAGGGAGACAGG - Intronic
980080745 4:128341336-128341358 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
980192389 4:129541642-129541664 CAGAATGTAAGGCTGGAGAAGGG + Intergenic
980338785 4:131513638-131513660 CAGAATGCAAAGGAGAAGCAAGG - Intergenic
980492023 4:133540737-133540759 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
980628235 4:135404140-135404162 AAAAATGCAAAAAGGGAGACTGG + Intergenic
980730572 4:136818978-136819000 CAGGAAGCAAAGAGGCAGCATGG - Intergenic
980731256 4:136826675-136826697 CAGAGTGCAGAGAGGTAGGAGGG - Intergenic
980795858 4:137681684-137681706 TAGAAAGCAAAAAGAGAGAAAGG - Intergenic
980841015 4:138261526-138261548 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
981147852 4:141346791-141346813 CTGTATGTTAAGAGGGAGAAAGG - Intergenic
981678108 4:147362907-147362929 CAGCAAGCAAAGAGGGAGATGGG + Intergenic
981768056 4:148274578-148274600 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
981832480 4:149018247-149018269 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
981864355 4:149397544-149397566 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
982346622 4:154367294-154367316 CAGGGTGGAAGGAGGGAGAACGG + Intronic
982400397 4:154960612-154960634 CAGAATGCAAATAGGAGCAATGG - Intergenic
982490759 4:156026378-156026400 CAGTAGGCAAAGTGGGAGCAGGG - Intergenic
982622990 4:157730002-157730024 CAGAATGCAGAGAGCACGAAGGG - Intergenic
982660434 4:158200262-158200284 GAGAAAGCAAGGAGGGAGGAGGG - Intergenic
983269894 4:165549141-165549163 CAACATGCAAAGAAGGCGAATGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983576241 4:169264484-169264506 CAACAGGGAAAGAGGGAGAAAGG + Intronic
983667917 4:170202948-170202970 CGGAGTGCAAAGAGGAAGCAAGG - Intergenic
983709182 4:170693426-170693448 CAGAAAGCAAAGGGGAAGCAAGG + Intergenic
983901471 4:173139886-173139908 CAGAATGCAAAGGAGGTCAAGGG - Intergenic
983917828 4:173311510-173311532 TGGAATGCAAAGGGGGAGCAAGG + Intronic
984050737 4:174861907-174861929 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
984355814 4:178655592-178655614 TAGAATGCAAAGGGGAAGCAAGG - Intergenic
984419051 4:179496477-179496499 CAGAAGGCAAAGGGGAAGAAGGG + Intergenic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
985465039 4:190186489-190186511 CAGATTGCAAAAAGAGAGAGAGG - Intergenic
986071736 5:4291854-4291876 CACAATGCAAGCAGGGAGCATGG + Intergenic
986203005 5:5596292-5596314 CAGAAGGCAAAGAGGGAGAAAGG - Intergenic
986210337 5:5665640-5665662 CAGACAGCAAGGAGGGAGGAAGG + Intergenic
986373756 5:7108897-7108919 CAGAATGCAAATGGGGACAGTGG + Intergenic
986449898 5:7853307-7853329 CAGAAAGCAAAGGGGAAGCAAGG - Intronic
986596646 5:9429714-9429736 CAGAATGAAAAGACTGAGCAAGG + Intronic
986900326 5:12422733-12422755 CAGAAGGCAAAGCGGCAGCAAGG - Intergenic
986991965 5:13564714-13564736 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
987289424 5:16494584-16494606 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
987308131 5:16657630-16657652 GAGAATGTGAATAGGGAGAAAGG + Intergenic
987396739 5:17431559-17431581 GAAAATGGAAAGAGGAAGAAAGG - Intergenic
987543320 5:19283126-19283148 CAGAAGGCAAAGAGGGAATGAGG + Intergenic
987843224 5:23247325-23247347 CAGAAGGCGAAGAGGAAGCAAGG - Intergenic
987893924 5:23919784-23919806 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
987966911 5:24889339-24889361 CAGAAGGTAAAGGGGGAGAAAGG - Intergenic
988230169 5:28466425-28466447 TAGAAGGCAAAGAGGAAGCAAGG - Intergenic
988355011 5:30162421-30162443 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
988874052 5:35424398-35424420 GAGAATGACAAGAGTGAGAATGG - Intergenic
989213435 5:38880067-38880089 CAGTCTGCAGAGAGTGAGAAAGG + Intronic
989574590 5:42978709-42978731 GACGGTGCAAAGAGGGAGAAGGG - Intergenic
990266426 5:54081671-54081693 CAGAAGGCGAAGAGGAAGCAAGG - Intronic
990484452 5:56243868-56243890 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
990623636 5:57587522-57587544 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
990947880 5:61268485-61268507 CAGAAAGGAAAAAGGGAGAAAGG - Intergenic
991226856 5:64283700-64283722 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
991559141 5:67930663-67930685 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
991763810 5:69952316-69952338 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991783515 5:70165823-70165845 CAGAATTTCAAGATGGAGAAAGG - Intergenic
991843041 5:70827384-70827406 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991875960 5:71166153-71166175 CAGAATTTCAAGATGGAGAAAGG - Intergenic
993039196 5:82793054-82793076 CAGAACGCAAAGAGGAAGCAAGG - Intergenic
993040124 5:82804904-82804926 CAGAATGAAAAAAAGGAGAGGGG + Intergenic
993226788 5:85176665-85176687 CAGAAAGCAAAGGGGAAGCAAGG + Intergenic
993312786 5:86357669-86357691 CTGCATGAAAAGAGGGAGAGTGG - Intergenic
993453250 5:88098076-88098098 CAGAAAGCAAAGGGGAAGAAAGG - Intergenic
993699286 5:91099311-91099333 GAGGAGGCAAAGAGGGAGAAAGG - Intronic
993763319 5:91823722-91823744 CAGTATCTAAAGAGGCAGAAAGG - Intergenic
994271833 5:97786749-97786771 GAGGATGCTAAGAGGGATAAAGG + Intergenic
994426177 5:99590343-99590365 CAGCATGGAAAGAGAGTGAATGG - Intergenic
994455718 5:100004829-100004851 CAGAAGGCAAAGGGGAAGTAAGG - Intergenic
995004434 5:107174008-107174030 CAGCAGGCAAAGAGAGAGATTGG + Intergenic
995151411 5:108851278-108851300 CAGCAGGCAAAGAGAGAGATTGG + Intronic
995286608 5:110396116-110396138 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
995288413 5:110419193-110419215 AAGAAAGCAAAGATGGAGGAAGG + Intronic
995311545 5:110717815-110717837 CAGAAAGCAAAGGGGAAGCAAGG - Intronic
995594347 5:113731725-113731747 CTGAATTCTAAAAGGGAGAAGGG + Intergenic
995908203 5:117152539-117152561 GAGAAGGAAAAGAAGGAGAAAGG - Intergenic
996435141 5:123425626-123425648 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
996605373 5:125314618-125314640 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
996606643 5:125330618-125330640 CTGGATGTAAAGTGGGAGAAGGG + Intergenic
996930030 5:128875141-128875163 CAGAAGGCAAAGAGGGAAGCCGG - Intronic
997007553 5:129836474-129836496 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997759617 5:136432733-136432755 GAGGCTGCAAAGAAGGAGAAAGG + Intergenic
998435064 5:142101094-142101116 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998577229 5:143329172-143329194 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
998970547 5:147586734-147586756 AAGAAAGAAAAGAGGGAGAGAGG - Intronic
999023774 5:148201573-148201595 TAGAATGGAAAGAGGGAGGAAGG + Intergenic
999030937 5:148290324-148290346 CAAAAGGCAAAGGGGGAGAGAGG + Intergenic
999065649 5:148683075-148683097 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
999071797 5:148750812-148750834 CAGAGTGCAGAGATGGGGAAAGG + Intergenic
999418039 5:151416992-151417014 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
999969415 5:156844418-156844440 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1000067641 5:157708872-157708894 AAGGATGAGAAGAGGGAGAAAGG + Intergenic
1000111715 5:158114380-158114402 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1000789836 5:165592254-165592276 CAAAATAAAAAGAGGAAGAAAGG + Intergenic
1000964034 5:167633677-167633699 AAAAAAGAAAAGAGGGAGAAAGG - Intronic
1001393813 5:171402819-171402841 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1001948453 5:175798973-175798995 CAGAATGAATTGAGGTAGAAAGG - Intronic
1002463688 5:179390802-179390824 AAGAAAGCAAAGAGAGAGAATGG + Intergenic
1002850340 6:989559-989581 CAGAAGGCAAGGAGGGAGCAAGG + Intergenic
1003380407 6:5619805-5619827 AAGAATGAAGAGAGGGAGACAGG - Intronic
1003402880 6:5805433-5805455 CAGAAGGCAAAGAGGAAGCAGGG - Intergenic
1003459886 6:6320017-6320039 CACAGTGCTAAGGGGGAGAAGGG + Intronic
1003905736 6:10698054-10698076 AAGTTTGCAAGGAGGGAGAAAGG + Intronic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1004588889 6:17029864-17029886 CAGAATGGAAAGGTGGAGGAAGG + Intergenic
1005159596 6:22843595-22843617 CAGAGGGCAAAGAGGAAGGAGGG - Intergenic
1005272941 6:24185760-24185782 CAGTCTGCAAAGAAGGAAAAGGG + Intronic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1006236614 6:32638889-32638911 CTGAAAGGGAAGAGGGAGAAAGG - Intronic
1006246581 6:32742464-32742486 CTGAAAGGGAAGAGGGAGAAAGG - Intronic
1006248188 6:32758395-32758417 CAGAAGGAAAAGAGGGAGTGAGG - Intronic
1007009481 6:38401292-38401314 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1007057338 6:38900577-38900599 CACAATGCCAAGTGGGAGCAAGG - Intronic
1007717136 6:43863969-43863991 CAGAAGGGAGGGAGGGAGAAGGG - Intergenic
1007869703 6:45020007-45020029 CAGATTTCAAAGAGTAAGAAAGG + Intronic
1008048848 6:46879512-46879534 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1008226660 6:48927204-48927226 CAGAAGGCAATGAGGAAGAAAGG - Intergenic
1008540601 6:52543705-52543727 CAGAAAGCAAAAAGAGAGGAGGG + Intronic
1008871650 6:56279218-56279240 CAGAAGACAAAGGGGGAGCAAGG - Intronic
1009642068 6:66350661-66350683 CAGAAGGCAAAGGGGAAAAAAGG + Intergenic
1009661599 6:66619654-66619676 CGGAATGCAAAGAGAAAGCAAGG + Intergenic
1009714993 6:67379840-67379862 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1009791321 6:68404719-68404741 CAGAAAGCAAAAAGGAAGCAAGG + Intergenic
1009880388 6:69559946-69559968 AGGAATGAAAAGAGGAAGAAAGG - Intergenic
1010034404 6:71307165-71307187 TAGAGTTCAGAGAGGGAGAAGGG + Exonic
1010136114 6:72555255-72555277 CCGACTGAAGAGAGGGAGAAAGG - Intergenic
1010366490 6:75058129-75058151 CAGAAGGCAAGGAGGAAGCAAGG + Intergenic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1010688124 6:78876250-78876272 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1011022945 6:82834559-82834581 CAGAAGGCAAAGGGAGAGCAAGG + Intergenic
1011255557 6:85417267-85417289 GAGAAAGAACAGAGGGAGAAGGG + Intergenic
1011278767 6:85655988-85656010 CAGAATGCAGAGTGGGCAAAAGG + Intergenic
1011385651 6:86795546-86795568 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1011498872 6:87966076-87966098 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1011749917 6:90445013-90445035 CAGAATAGAAAGAGAGACAAAGG + Intergenic
1011855762 6:91688565-91688587 TAGAAAGCAAGGAGGGCGAAGGG - Intergenic
1011955824 6:93024646-93024668 CAGAAAGCAAAGGGGAAGCAAGG + Intergenic
1011956048 6:93026612-93026634 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1012039215 6:94183922-94183944 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1012253003 6:97000044-97000066 AAGAATGCAAAGATGGCCAATGG + Intronic
1012319285 6:97822942-97822964 AAGAAAGAAAAGAAGGAGAAAGG + Intergenic
1012433847 6:99193733-99193755 CAGACTGCAGATAGGGACAATGG + Intergenic
1012494280 6:99817222-99817244 CAGCATGGAAAGAGGGAAAAAGG - Intergenic
1012602725 6:101117622-101117644 CACAATGCAAAGTGGCAGGAAGG + Intergenic
1012653366 6:101784764-101784786 CAGAAGGCAAAGGGGAAGAAAGG - Intronic
1012752950 6:103185662-103185684 CAGAAAGGAAAGAAAGAGAAAGG + Intergenic
1012798598 6:103795997-103796019 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013093995 6:106927664-106927686 CAGAAGGCAAAGAAGAACAATGG - Intergenic
1013133899 6:107261414-107261436 CAGAAGGCAAAGTGGGAGCAGGG - Intronic
1013773570 6:113653382-113653404 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013812406 6:114059688-114059710 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
1013904287 6:115197580-115197602 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1014177768 6:118349012-118349034 CAGAAGGAAGAGAGGGAGAGAGG - Intergenic
1014187156 6:118447894-118447916 CGGAATGCAAAGGAGGAGAAAGG + Intergenic
1014217125 6:118763033-118763055 CAGAATGGAAGGAGGGAAAGAGG + Intergenic
1014395607 6:120924500-120924522 CAGGATTCAAAGAGTGAAAAGGG + Intergenic
1014420675 6:121241016-121241038 CAAGAAGAAAAGAGGGAGAAAGG + Intronic
1014491877 6:122072341-122072363 AAGAATGGAAAGAGAAAGAATGG - Intergenic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1014815561 6:125931934-125931956 CAGAAGGCAAAGGGGAAGCAAGG - Exonic
1015035701 6:128651597-128651619 CAGAAGGCAAAGGGGAAGTAAGG - Intergenic
1015270177 6:131329661-131329683 AAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1015421785 6:133019382-133019404 CAGAAGGCAAAGTGGGAGTGAGG + Intergenic
1015871229 6:137778493-137778515 AAGGATGCAAAGAGAGAAAACGG - Intergenic
1015972684 6:138758579-138758601 CAGAAGGGAGAGAGGGAGCAGGG - Intronic
1016021502 6:139240969-139240991 AAGAAAGGAAGGAGGGAGAAGGG - Exonic
1016082663 6:139875129-139875151 AGGAATGGAAAGAGGGAGAAAGG - Intergenic
1016289389 6:142511301-142511323 AAGAAAGGAAAGAGGGAGACAGG - Intergenic
1016567187 6:145469121-145469143 CAGAAGGCAAAGGGGAAGAAAGG + Intergenic
1016632417 6:146248515-146248537 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1016810502 6:148256697-148256719 TTGACTGCAAAGAGGCAGAAGGG + Intergenic
1016821343 6:148349082-148349104 CACAGAGCAAAGAGGGACAAAGG + Intronic
1016839001 6:148507168-148507190 CAGAAGACAGAGTGGGAGAAGGG + Intronic
1016980758 6:149851910-149851932 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1017069231 6:150559381-150559403 CAGAATGGAAAAGGGAAGAAGGG + Intergenic
1017284789 6:152662038-152662060 CAGAATGCGAAGGGGAAGCAAGG - Intergenic
1017523269 6:155220571-155220593 CAGAAAGGAAAGGGGAAGAAGGG - Intronic
1017807350 6:157957125-157957147 CATATAGCAAAGAGGGAAAAGGG - Intergenic
1017807548 6:157958798-157958820 CAGAAATAAAGGAGGGAGAAAGG - Intergenic
1018674012 6:166203391-166203413 GAGGATGCATAGAGGTAGAAGGG - Intergenic
1018930773 6:168239061-168239083 AAGAATGCAAAGAGACAGAGTGG + Intergenic
1019127938 6:169853701-169853723 CAGAATGCAAAAAGGGGAGAAGG - Intergenic
1019784680 7:2967725-2967747 GAGAACTCAAAGAGGGACAATGG - Intronic
1019838119 7:3411131-3411153 CGGAAGACCAAGAGGGAGAAGGG + Intronic
1019885488 7:3900746-3900768 GAGCATGCAAAGAGGGAAAGAGG - Intronic
1019915655 7:4130564-4130586 CACAATGCAAACAGTGAGACGGG - Intronic
1019981080 7:4622710-4622732 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1020047748 7:5055735-5055757 CAGAAGGCAAGGAGGTAGTAGGG - Intronic
1020484716 7:8706895-8706917 CAGAATGGTGAGAGTGAGAAGGG + Intronic
1020622666 7:10536549-10536571 CAGAATAAAAAGAGAAAGAAGGG + Intergenic
1020729983 7:11868520-11868542 CAGAAGGCAAAAGGGAAGAAAGG - Intergenic
1020732426 7:11898421-11898443 CAGAATGCAAAGTAAGAAAAGGG - Intergenic
1020918974 7:14237333-14237355 AAGGAAGGAAAGAGGGAGAAAGG - Intronic
1021029807 7:15717578-15717600 GAGAAGGCAAAGGGGGAAAAGGG + Intergenic
1021338982 7:19439784-19439806 CAAAAGGCAAAGAGGAAGCAGGG - Intergenic
1021494360 7:21258071-21258093 GAGAATGGAAAGGGGGAGGAAGG + Intergenic
1021526838 7:21597532-21597554 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1022221770 7:28320913-28320935 CGTAATGCAGAGAGGCAGAATGG + Intronic
1022352443 7:29578513-29578535 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1022492693 7:30832843-30832865 AAGAAAGTTAAGAGGGAGAAAGG - Intronic
1023701937 7:42900913-42900935 AAAAAAGGAAAGAGGGAGAAAGG + Intergenic
1024311433 7:47973109-47973131 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1024330422 7:48149253-48149275 AAGAATGCATGGAGGGAGAGAGG - Intergenic
1024361300 7:48471799-48471821 CAGAAGGCAATGAAGGAGAGGGG - Intronic
1024485230 7:49910138-49910160 CAGAGTTCAGGGAGGGAGAAGGG + Intronic
1024533763 7:50413252-50413274 CATAATGCAAAAAAGGAGAATGG + Intergenic
1024562579 7:50656735-50656757 GAGAATGCAGAGGTGGAGAAAGG + Intronic
1024805260 7:53132039-53132061 GAGAATGGAAAAAGGGAGGAAGG - Intergenic
1025858158 7:65302445-65302467 AAGAATGCAACAAGGGAGCATGG - Intergenic
1026064016 7:67053345-67053367 CCAAATGAAAAGAGGGAGAGAGG - Intronic
1026714332 7:72774099-72774121 CCAAATGAAAAGAGGGAGAGAGG + Intronic
1027507825 7:79040249-79040271 CAGAAGGCAAAGGGGAAGCATGG - Intronic
1027610865 7:80358969-80358991 AAGAATGAAAGGAGGGAGAGAGG - Intergenic
1027645364 7:80790702-80790724 CAGAAAGTAAAGATGGAGAAGGG - Intronic
1027659071 7:80967229-80967251 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1027740034 7:81989868-81989890 AAGACAGCAAAAAGGGAGAAGGG + Intronic
1028623636 7:92852224-92852246 CAGAAAACAAAGAGGGAGATGGG + Intergenic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029116849 7:98242004-98242026 CTGGATGCAAAGAGAGAGAGGGG - Intronic
1029501177 7:100931028-100931050 CAAATTACAAAGAGGGACAAAGG - Intergenic
1029915049 7:104200028-104200050 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1030019869 7:105262798-105262820 CAGAATGCTAACAAGGAAAAAGG + Intronic
1030639402 7:111987282-111987304 CAGAATGAAAAGGGGAAGGAAGG - Intronic
1030703981 7:112672136-112672158 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1030729708 7:112972069-112972091 CAGAAGGCAAAGGGGGAGCAAGG - Intergenic
1030746348 7:113171179-113171201 CAGAAGGCAAAGGGAGAGCAAGG - Intergenic
1030764294 7:113389871-113389893 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1031255084 7:119436577-119436599 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1031567831 7:123321733-123321755 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1031626713 7:124000709-124000731 CAGAAAGAAGAGAGGGAGAGAGG + Intergenic
1031642020 7:124176197-124176219 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1031785358 7:126024219-126024241 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1031806946 7:126318110-126318132 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1031903382 7:127434546-127434568 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1032579173 7:133088171-133088193 AAGAAGGAAAAGAGGGAGAGAGG + Intergenic
1032847697 7:135765927-135765949 CATATTGGACAGAGGGAGAAAGG + Intergenic
1033359274 7:140626619-140626641 CAGGAAGGCAAGAGGGAGAAAGG - Intronic
1033804138 7:144935747-144935769 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1033843318 7:145401976-145401998 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1033910841 7:146261112-146261134 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1034000031 7:147401799-147401821 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1034043288 7:147901577-147901599 CAGAATGTAAAAAGACAGAAAGG - Intronic
1034278744 7:149837301-149837323 CAGAAGGCAGAGGGGCAGAAGGG + Intergenic
1034689136 7:152999990-153000012 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1034701655 7:153101569-153101591 CAGAAGGCAAAGCGGGAACAGGG - Intergenic
1035120594 7:156563615-156563637 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1035333820 7:158113132-158113154 AAGAATTCCAAGAAGGAGAAGGG + Intronic
1035389196 7:158494477-158494499 CAGGAACCAAAGAGGGAGGAGGG + Intronic
1036676200 8:10835760-10835782 AAGAATGGAAAGAGGAAGAAAGG + Intronic
1036731079 8:11265355-11265377 CAGAAGGCAAAAGGGGAGCAAGG - Intergenic
1036749267 8:11433654-11433676 CAGAATGCCAAGGTGGTGAAGGG + Intronic
1037098928 8:15018939-15018961 CAGAAGGTGAAGAGGAAGAAGGG + Intronic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037363912 8:18102716-18102738 CAGAAGGCAAAGGGGGAGTAGGG - Intergenic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1037672661 8:21028623-21028645 CAGAAAGGAAAGAGGGAGAAGGG + Intergenic
1037679872 8:21088370-21088392 CAGAAGGCAAAGACTGAAAATGG - Intergenic
1038713646 8:29972465-29972487 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1038774609 8:30517351-30517373 CAGAATGAAAAGAAGGATAAGGG - Intronic
1039098502 8:33913859-33913881 CAGAAGGCAAATGGGGAGCAAGG - Intergenic
1039832102 8:41223616-41223638 CAGAGAGCCAAGAGGGAGGAAGG + Intergenic
1040556055 8:48478340-48478362 CAGAAGGCAAGGAGGGGCAAGGG + Intergenic
1040798038 8:51308552-51308574 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1041034384 8:53773664-53773686 CAGAAAACAAAGAGCAAGAAAGG + Intronic
1041326415 8:56670891-56670913 CGGAAGGCAAAGGAGGAGAAAGG - Intergenic
1041540773 8:58982389-58982411 AAGAATGAAAAGATGGAGATAGG - Intronic
1041543092 8:59009128-59009150 TAGAAAGGAAAGAAGGAGAAGGG - Intronic
1041708968 8:60876018-60876040 CAGAAGCCAGACAGGGAGAAAGG - Intergenic
1041780884 8:61577645-61577667 CAGAAGGCAAAGAGGAATCAAGG + Intronic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1041958383 8:63582779-63582801 CAGAATGCATAGTGGGGGAAGGG + Intergenic
1042442555 8:68845114-68845136 TGGAATGCAAAGAGAGAGAGAGG - Intergenic
1042460543 8:69060387-69060409 GAGAGAGGAAAGAGGGAGAAGGG - Intergenic
1043198909 8:77338296-77338318 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1043209368 8:77491701-77491723 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1043806035 8:84672638-84672660 CAGAAGGCAAAGGAGGAGCAAGG + Intronic
1043922021 8:85994216-85994238 CAGAATACAAAGAGAGAATAGGG + Intronic
1044009199 8:86971210-86971232 CAGAAGGCAAAGGGGAAGGAAGG + Intronic
1044055817 8:87568811-87568833 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1044157195 8:88862311-88862333 CAGAAGGCAAAGTGGGAGTGAGG + Intergenic
1044192090 8:89331228-89331250 CAGAAGGCAAAGGAGGAGAAAGG + Intergenic
1044237919 8:89853565-89853587 CAGAGAGTAAAGAGAGAGAAGGG + Intergenic
1044357749 8:91244385-91244407 AAGAATGAAAAGAGGGAAAGAGG - Intronic
1044894907 8:96881312-96881334 CAGAAGGCAAAGGGGGAGTGAGG + Intronic
1045200763 8:99978479-99978501 AAGAAAGAAAAGAGGGAGGAGGG - Intronic
1046061813 8:109149316-109149338 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1046520985 8:115325651-115325673 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1046587355 8:116163837-116163859 GAGAAGGCAAAGAGATAGAAAGG - Intergenic
1046599111 8:116297068-116297090 GACCATGCAAAGAGGGAGACAGG - Intergenic
1046647745 8:116804448-116804470 CAGAAGGCAAAGGGGAAGTAAGG - Intronic
1046789702 8:118307866-118307888 AAGACTGGAAAGAAGGAGAAAGG + Intronic
1046806200 8:118481446-118481468 AAGAAGGAAAAGAGGGAGGAAGG + Intronic
1047107951 8:121755574-121755596 CAGAAAGCAAAGGGGAAGCAAGG - Intergenic
1047184535 8:122620056-122620078 CAGAATGAAAGAAGGGAGAAGGG - Intergenic
1047260243 8:123251218-123251240 CAGAAGGCGAAGGGGAAGAAGGG - Intronic
1047415150 8:124658618-124658640 CAGAATGCAAAGAGGGAGCTAGG + Intronic
1047610300 8:126514575-126514597 CAAAAGGCAAAGGGGGAGTAGGG + Intergenic
1047691584 8:127360337-127360359 CAGAAGGCAAAGGGGAAGCAGGG + Intergenic
1047785566 8:128151024-128151046 CAGAATGAAAAGAGAGGGAAAGG - Intergenic
1047923510 8:129658824-129658846 CAGAAGGCAAAGGGAAAGAAGGG + Intergenic
1047979006 8:130160380-130160402 CAGAATGTGTAAAGGGAGAAAGG - Intronic
1048367755 8:133753291-133753313 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1048670998 8:136719618-136719640 CAGAGTGCAGATAGGGAAAAGGG + Intergenic
1049181680 8:141226189-141226211 CAGAGGGGAAAGATGGAGAAAGG - Intronic
1049552223 8:143265703-143265725 CAGAAGGCAAAGTGGGAGCCAGG + Intronic
1049637972 8:143699425-143699447 CACCATGCAAAGAGGGGAAAGGG + Intronic
1050119910 9:2297661-2297683 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1050273403 9:3970951-3970973 TGGAAGGAAAAGAGGGAGAAAGG + Intronic
1050333147 9:4565467-4565489 CAGAAGGCAAAGGGGAAGCAAGG + Intronic
1050876205 9:10640065-10640087 CAGAAGGAAGAGAGAGAGAAGGG + Intergenic
1050991301 9:12155853-12155875 CAGAATGCCTAGAGGGCCAATGG - Intergenic
1051132731 9:13880818-13880840 AAGAAAGCAAAGAGGGGCAAGGG - Intergenic
1051184411 9:14443230-14443252 GAGACTGCCAAGAAGGAGAACGG - Intergenic
1051255309 9:15207068-15207090 CAGGAGGCAAAGAGGAAGCAAGG - Intronic
1051457189 9:17272050-17272072 CAGAAAGGAAAGAGAGAGGAAGG - Intronic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1051931310 9:22389565-22389587 CAAGATGCAAATATGGAGAAAGG + Intergenic
1051960240 9:22751648-22751670 CAGAATGCAGGGTGGGAGAGAGG + Intergenic
1052053818 9:23881741-23881763 CAGAAGGCAAAGGAGGAGCAGGG + Intergenic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052305150 9:27000131-27000153 CAGAGTGCAAGGATGGTGAATGG - Intronic
1052349873 9:27447647-27447669 CAGTGTGCAAAGAAGCAGAAAGG - Intronic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1052945750 9:34166900-34166922 CATAAGGCAAAGGGGGAGCAGGG + Intergenic
1053126064 9:35581707-35581729 CAGAAGGCAAAGGGGAAGTAAGG - Intergenic
1053399867 9:37809532-37809554 CAGAATAAAAAGAGGGACATAGG + Intronic
1053442150 9:38125504-38125526 TGGAAAGAAAAGAGGGAGAAGGG - Intergenic
1054784694 9:69199719-69199741 AAGAAGGAAAGGAGGGAGAAAGG - Intronic
1054799381 9:69332004-69332026 CAGAATTCACAGACGGGGAAAGG - Intronic
1054955447 9:70904485-70904507 AAGAGTGCAAAGAAGGAGGAGGG + Intronic
1055345487 9:75332336-75332358 CAATAGGCAAAGGGGGAGAAAGG + Intergenic
1055429706 9:76231149-76231171 CAGAAGGCAAAGGGGAGGAAAGG + Intronic
1056075171 9:83030917-83030939 GAGAGTGAAAAGAGGGAGAAAGG - Intronic
1056127391 9:83549088-83549110 CAGGTTACAAGGAGGGAGAAGGG - Intergenic
1056289221 9:85125925-85125947 CTGAATTCAAAAAGGGAGGAGGG - Intergenic
1056326212 9:85480881-85480903 AAGAATGGAATGAGGGAGAAAGG + Intergenic
1056435840 9:86575512-86575534 CAGAAAGCAAAGAAGAAGCAAGG + Intergenic
1056472035 9:86915052-86915074 GAGAATGGAAAGAGGAAGGAAGG + Intergenic
1056665251 9:88576584-88576606 GAGAAGGGGAAGAGGGAGAATGG + Intronic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1057002133 9:91519692-91519714 AAGAAAGGAAAGAAGGAGAAAGG + Intergenic
1057096450 9:92314712-92314734 CAACATGCAAAGAAGGCGAATGG - Exonic
1057233450 9:93339534-93339556 CAGAAGGCAAAGGGGAAGCAAGG - Intronic
1057979780 9:99649639-99649661 CAGAAGGCATTGAGAGAGAATGG + Intergenic
1058397716 9:104574169-104574191 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1058510409 9:105711917-105711939 CAGAAAAAAAAGAGAGAGAAGGG - Intronic
1058590506 9:106559897-106559919 CAGAAGGCAAACAGGTAGAATGG - Intergenic
1058595627 9:106612368-106612390 GAGCCTGCAAAGATGGAGAATGG - Intergenic
1058805717 9:108589490-108589512 GAAAATGTAAAGATGGAGAAGGG + Intergenic
1059499835 9:114742623-114742645 CAGAAAGAAATGAGAGAGAATGG + Intergenic
1059769120 9:117411502-117411524 CAGAAACAAAAGAGGCAGAATGG + Intronic
1061359378 9:130131502-130131524 GGGAGTGCGAAGAGGGAGAACGG - Intronic
1061429469 9:130522217-130522239 CAGAAGGCAAAGAGGAAGAAAGG + Intergenic
1185766850 X:2732562-2732584 AAGAATGAAAAGAGAGAGAGAGG - Intronic
1185779841 X:2834710-2834732 CAGAAGACAAAGAAGGTGAAGGG - Intronic
1185824851 X:3240446-3240468 AAGGAAGCAAAGAGGGGGAAGGG - Intergenic
1186122791 X:6381798-6381820 CAGAATCCAGAGATGTAGAAGGG - Intergenic
1186188187 X:7042097-7042119 ATAAATGAAAAGAGGGAGAAGGG - Intergenic
1186261529 X:7785209-7785231 CAGAAGGCAAAGCAGGAGAAAGG + Intergenic
1186262210 X:7791618-7791640 CAGAAGGCAAAGGAGAAGAAAGG + Intergenic
1186934198 X:14429114-14429136 CACAATGGAATGAGGGAGATTGG + Intergenic
1187021616 X:15388359-15388381 CAGCATGGTAAGAGGCAGAAGGG + Intronic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1187437434 X:19285514-19285536 CAGAAGGCGAAGAGGAAGCAAGG - Intergenic
1187574636 X:20541464-20541486 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1187739323 X:22338388-22338410 GAGAATTGAAAGAGGTAGAATGG + Intergenic
1188505373 X:30876947-30876969 CAGAAGGAAAAGAGACAGAATGG + Intronic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1188669120 X:32861595-32861617 AAGAATGAAAAGAAGGAGAGTGG + Intronic
1188713784 X:33434924-33434946 AAGAATATAAAGAGGGAAAACGG + Intergenic
1188747627 X:33865867-33865889 CAGAAGGCAAAGGGGAAGAAAGG - Intergenic
1188787050 X:34359961-34359983 GAGATTGCAAAGTGGGAGGAAGG - Intergenic
1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG + Intergenic
1189188081 X:39071140-39071162 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1189227176 X:39422571-39422593 CAGAAGGCAAAGGGGAAAAAGGG + Intergenic
1189255168 X:39632397-39632419 CAGAAGGCAAAAAGGCAAAAGGG + Intergenic
1189429345 X:40933152-40933174 CTGAAGGGAAAGGGGGAGAAGGG - Intergenic
1189432376 X:40959057-40959079 TAGAATGCTGAGAGGGAGAATGG - Intergenic
1189903485 X:45733647-45733669 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1189957018 X:46286439-46286461 CAGAAGGCAAAGGGGAAGAAAGG - Intergenic
1189974703 X:46449158-46449180 CAAAATGCAAATTGTGAGAAAGG + Intronic
1190122837 X:47676711-47676733 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1190167698 X:48086741-48086763 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1190191245 X:48279005-48279027 AAGAATGGAAAGAGAGAGAAAGG + Intergenic
1190360313 X:49643151-49643173 CAGAATTCTAAAAGGGAGGAGGG - Intergenic
1190722287 X:53159678-53159700 CTGAGTGCAAAGATGGAGAGAGG - Intergenic
1191607284 X:63076623-63076645 AAGACAGCAAAGAGGGAGTAGGG + Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1192000077 X:67140494-67140516 GAGAATGGAAAGGAGGAGAATGG - Intergenic
1192057069 X:67783920-67783942 CAGAGAGCAAGGAGGGAGAGTGG - Intergenic
1192136013 X:68601207-68601229 CAGAAGGAGAAGAGAGAGAAAGG + Intergenic
1192295455 X:69842865-69842887 CAGAAGGCAAAGGTGGAGCAGGG - Intronic
1192682106 X:73263033-73263055 GAGAATGCTAAGACTGAGAAGGG - Intergenic
1193050791 X:77097097-77097119 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1193102937 X:77636416-77636438 CAGAAAGCAAAGGGGGAGTGAGG - Intronic
1194063031 X:89227909-89227931 CAGAGTGCCAAGTGGGAGAGGGG - Intergenic
1194092608 X:89597821-89597843 CAGAAGGCAAAGGGGCAGCAAGG + Intergenic
1194273967 X:91857131-91857153 CACAAGGCAAAGGAGGAGAAAGG + Intronic
1194391003 X:93318028-93318050 CAGAATGGACGGAGGGAGATGGG - Intergenic
1194779706 X:98009972-98009994 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1194786486 X:98090876-98090898 GTGAAAGCAAAGATGGAGAAGGG + Intergenic
1194839095 X:98716152-98716174 CAGAAGGCAAAGGTGGAGCAAGG - Intergenic
1194933611 X:99919258-99919280 CAGATTGCAAATAGTGAGTATGG - Intergenic
1195127805 X:101825342-101825364 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1195178189 X:102331235-102331257 CAGAAGGCAAAGGGGAAGTAAGG - Intergenic
1195180675 X:102355856-102355878 CAGAAGGCAAAGGGGAAGTAAGG + Intergenic
1195375892 X:104227891-104227913 CAGCAGGCAAAGAGAGAGAGAGG - Intergenic
1195443688 X:104925875-104925897 GAGCATGCAAATAGGAAGAAAGG + Intronic
1197074918 X:122342610-122342632 TAGAATGCAAAGGGGGAGCAAGG + Intergenic
1197118739 X:122865271-122865293 CAGAAGGCAAAGGGTGAGCAAGG + Intergenic
1197288486 X:124625663-124625685 CAGAAGGCAAAGGGGGAGGAAGG + Intronic
1197607461 X:128600770-128600792 TAGAAAGCTAACAGGGAGAAGGG + Intergenic
1197636752 X:128923334-128923356 CAGAATGCCAAGGGAGTGAAGGG + Intergenic
1197665278 X:129216601-129216623 CAGAAGGCGAAGGGGAAGAAAGG + Intergenic
1197835154 X:130686385-130686407 CAGAAGGCAAAGATGGAGCGAGG - Intronic
1197852700 X:130880174-130880196 AAGAATGGAAAGAGAAAGAAGGG + Intronic
1198026420 X:132712127-132712149 CAGAAAGCAGAGAGGTTGAATGG - Intronic
1198085072 X:133274933-133274955 CACACTGCAGAGAGGCAGAAAGG + Intergenic
1198116474 X:133549665-133549687 GAGAAAGAAGAGAGGGAGAAGGG - Intronic
1198361480 X:135899957-135899979 GAGTATTCAAAAAGGGAGAAAGG - Intronic
1198470770 X:136944570-136944592 CAAAATGTAAAGAGGAATAAAGG - Intergenic
1198497008 X:137203258-137203280 CAGAAGGCAAAGGGGAAGCAAGG + Intergenic
1198517058 X:137420251-137420273 CAGAATGCTTTGAGGGTGAATGG + Intergenic
1198610674 X:138396244-138396266 CAGAAGGCAAAGCAGGAGCAGGG - Intergenic
1198693429 X:139308538-139308560 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1198752215 X:139947189-139947211 CAGAATGCAGAGAAGGCGACAGG - Intergenic
1199065999 X:143418798-143418820 CAGCATTCAAATGGGGAGAAGGG + Intergenic
1199112696 X:143954278-143954300 CAGAAGGCAACGGGGAAGAAAGG - Intergenic
1199378471 X:147139976-147139998 ACGAATGCAAAAAAGGAGAAAGG - Intergenic
1199583024 X:149379364-149379386 CAGAATACAAATGGGTAGAATGG - Intergenic
1199881310 X:151975572-151975594 GAGAAGGCACAGAGGGGGAAGGG + Intergenic
1200413004 Y:2879920-2879942 AAGTAGGCAAAGAGGGAGAGGGG + Intronic
1200445255 Y:3253924-3253946 CAGAAGGCAAAGGGGCAGCAAGG + Intergenic
1200591204 Y:5078548-5078570 CACAAGGCAAAGGAGGAGAAAGG + Intronic
1200716844 Y:6556584-6556606 CAGAGTGCCAAGTGGGAGAGGGG - Intergenic
1201122291 Y:10882369-10882391 TAGAATGCAAAGAAGTGGAATGG - Intergenic
1201290207 Y:12415281-12415303 CAGAAGACAAAGAAGGTGAAGGG + Intergenic
1201412268 Y:13711905-13711927 CAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1201940628 Y:19455162-19455184 CAGAAGGTAAAGAGTGAGATGGG + Intergenic