ID: 1133519946

View in Genome Browser
Species Human (GRCh38)
Location 16:6547271-6547293
Sequence TATAAATCACCAGCCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133519946 Original CRISPR TATAAATCACCAGCCGGGGC TGG (reversed) Intronic
901340199 1:8491143-8491165 TAAAAATAACCAGCTGGGCCAGG + Intronic
902857521 1:19219700-19219722 TGCAAAACACCAGCCGGGACAGG + Intronic
903390721 1:22961900-22961922 TATAAAACATCAGCCGGGCATGG - Intronic
905472916 1:38206881-38206903 TATAAACCCCCTGCAGGGGCAGG - Intergenic
911282311 1:95945165-95945187 TAGAAATCACTAGACTGGGCCGG - Intergenic
913556634 1:119973794-119973816 AAGAAAGCACCAGCCTGGGCTGG + Intronic
917300934 1:173573588-173573610 GATAAATCATCAGCTGGGGGAGG - Intronic
921219369 1:212962272-212962294 TATAAAATACCAGAAGGGGCAGG - Intronic
923546729 1:234928769-234928791 TGTAAATCAGCTGCCGGGGCAGG + Intergenic
1064632115 10:17327288-17327310 CATAAAGAACCAGCTGGGGCTGG + Intronic
1064809279 10:19176668-19176690 TATAAATTAGCACCCAGGGCCGG - Intronic
1065209048 10:23385090-23385112 TATAAATAGCCAGCTGAGGCTGG - Intergenic
1071494079 10:86155796-86155818 CATGAATCTCTAGCCGGGGCTGG + Intronic
1074377162 10:112950160-112950182 CATAAATAAACAGCCGGGGTGGG - Intergenic
1078274823 11:9833708-9833730 TATAAATCACCAGCTGGGCACGG - Intronic
1083104527 11:60345228-60345250 TATAAAATACCACCAGGGGCAGG - Intronic
1091121818 11:133063856-133063878 TAATAATCACCAACCGGGGCTGG - Intronic
1093837315 12:23850111-23850133 TATAAATCACAACCCGTTGCTGG - Intronic
1097733403 12:63154203-63154225 TATAAATCACCAGGAGAGGGTGG - Intergenic
1102123331 12:110460537-110460559 TCAAAATCACCATCAGGGGCTGG + Intronic
1102407843 12:112689490-112689512 TACAAATCAGCAGCCTGGGTTGG - Intronic
1103929755 12:124443789-124443811 TAGAAAGCACCAGCCGGGTGCGG - Intronic
1110109822 13:71732287-71732309 TAAAAATCACCAACTGGGCCAGG + Intronic
1113113566 13:106850408-106850430 TATAAATTACCAGCCTAGGCCGG + Intergenic
1113315799 13:109177810-109177832 TATAAATTAGAAGTCGGGGCTGG - Intronic
1119550440 14:75507614-75507636 TATAAAAAACTAGCCGGGCCTGG + Intergenic
1124364312 15:29061480-29061502 TAGAAAGCACCAGCTGGGTCAGG - Intronic
1127667616 15:61164279-61164301 CATAAATTACCAGCAGCGGCTGG + Intronic
1127972360 15:63971563-63971585 TGTAAAACACCAGCGGGGGGAGG + Intronic
1128188376 15:65664981-65665003 TCTAAATCAGCAGCCTGGGATGG + Intronic
1129686435 15:77688661-77688683 TATAAATAACCAACCGTGGCGGG - Intronic
1131827074 15:96330590-96330612 TATAAGGCAGCAGCCGGGGTTGG - Intronic
1132511369 16:343403-343425 TAAAAATAACCAGCCGGGGCCGG + Intronic
1133519946 16:6547271-6547293 TATAAATCACCAGCCGGGGCTGG - Intronic
1140508665 16:75491658-75491680 AATAAATTACCAGCCGGGCACGG - Intronic
1141878790 16:86844613-86844635 TAGAAGTCACCAGCCGGGCGCGG - Intergenic
1142576374 17:911207-911229 TAAAAATCCCAAGCAGGGGCAGG - Exonic
1142715871 17:1746721-1746743 TAAGAATCACCAGGAGGGGCCGG - Intronic
1148107208 17:45125170-45125192 TATAAAACATCAGCCGGGCATGG + Intronic
1150563527 17:66316850-66316872 TAAAAATCAGCAGCCGGGCGTGG + Intronic
1151562374 17:74877621-74877643 TATAAATAGCCAGCCAGGGGCGG - Exonic
1151621548 17:75248489-75248511 AAAAAATCACCAGCTGGGCCGGG + Intronic
1153443444 18:5146655-5146677 TCTAGATCACCAGGCGGGGAGGG - Intronic
1159249717 18:65859025-65859047 TGAAAATGCCCAGCCGGGGCAGG + Exonic
1160031638 18:75266721-75266743 TATAGATCACCTGCAGGAGCTGG + Intronic
1165194605 19:34091877-34091899 AATGAATCACCAGCCGGGCATGG + Intergenic
1165315552 19:35053343-35053365 TTTGAAACACCAGCTGGGGCAGG - Intronic
1165896695 19:39145732-39145754 CATAGATCAGCAGCTGGGGCAGG + Intronic
1167886913 19:52507751-52507773 TATAAATCACTAGTCCTGGCTGG + Intronic
928481742 2:31690691-31690713 TATAAAATACCATCAGGGGCCGG - Intergenic
929757999 2:44784195-44784217 TATAAATTACCAGCCAGGTGTGG + Intergenic
931445519 2:62324036-62324058 AGAAAATCACCAGCCAGGGCTGG - Intergenic
932552244 2:72783616-72783638 TAGAAATGACCAACAGGGGCTGG - Intronic
933646384 2:84816044-84816066 TATAAAACAGGAGCCCGGGCAGG + Exonic
935245572 2:101216312-101216334 TAAAAATGAACAGCCAGGGCTGG + Intronic
938740454 2:134226818-134226840 ACTAAAACACCAGCAGGGGCTGG + Intronic
939613370 2:144335702-144335724 CATAAAACACCAGCAGGGACAGG - Intergenic
941161736 2:162043512-162043534 TACAAATCTCCAACCGTGGCTGG + Intronic
941862859 2:170302407-170302429 TTGAAATGACCAGCTGGGGCTGG + Intronic
942852007 2:180498589-180498611 AAAAAATCACCAGCCGGGCACGG + Intergenic
1172491341 20:35340933-35340955 GATAAAATACCAGCCGGGGGTGG + Intronic
1175450736 20:59064481-59064503 TATAAACAAACAGCCTGGGCTGG - Intergenic
1178480884 21:32978479-32978501 TGTAAAACACAAGCCCGGGCCGG - Intergenic
1182078272 22:27510181-27510203 TTTTAAGCACCAGCAGGGGCAGG - Intergenic
954204253 3:49046213-49046235 TAGAAAATAACAGCCGGGGCCGG - Intronic
955941423 3:64150040-64150062 GAGAAATAACCAGCTGGGGCGGG + Intronic
968418762 4:464781-464803 TAAAAAGCAGCAGCTGGGGCTGG + Intronic
968553406 4:1235792-1235814 TACAAATCACCATCTGGTGCGGG - Intronic
972828632 4:42788739-42788761 TATAAAGAAATAGCCGGGGCTGG - Intergenic
973175021 4:47195068-47195090 TATAAATCAATATCCTGGGCCGG + Intronic
974188977 4:58478054-58478076 TGTAAAGCATCAGCCAGGGCTGG - Intergenic
977509877 4:97949947-97949969 TCTAAATCACCAGCAAGGCCAGG + Intronic
981106962 4:140892424-140892446 TATACTTCACCAGCCTGTGCTGG + Intronic
985775984 5:1842434-1842456 TATAAATCACGGGCCGGGCGTGG - Intergenic
989583742 5:43058006-43058028 TATAAATTACCGGCCGGGCGCGG - Intergenic
991121087 5:63015241-63015263 TATAAATCACAGGCCGGGCGTGG + Intergenic
991720157 5:69487968-69487990 AATAAAAACCCAGCCGGGGCCGG + Intergenic
996405502 5:123099069-123099091 TTAAAATCACCAGACGGGGCGGG - Intronic
997642957 5:135461742-135461764 CATAAATCACCAACTGGGCCTGG + Intergenic
1003291287 6:4780421-4780443 TACAAAACATTAGCCGGGGCGGG - Intronic
1008930988 6:56939732-56939754 TATAAATAAGCAGCCGGGCGTGG + Intronic
1013659202 6:112277459-112277481 TAGAAACCACTAGCCAGGGCTGG - Intergenic
1015613068 6:135046560-135046582 TAAAAATCACCATCCTAGGCTGG + Intronic
1017797954 6:157864737-157864759 TAAAAAACACCAGCCGGGCATGG + Intronic
1018315295 6:162550554-162550576 TGTAAGTCACCAGGCGAGGCTGG + Intronic
1022643602 7:32210849-32210871 TAAAAATGACCAGCAGGGGGAGG + Intronic
1024096278 7:45985302-45985324 CACAAAGCACCAGCAGGGGCAGG + Intergenic
1024458776 7:49638333-49638355 CACAAATCACCAGCAGGGGCTGG - Intergenic
1024680100 7:51677448-51677470 TATAAATGGCCAGCAGGGACAGG + Intergenic
1026320353 7:69262501-69262523 GATAAATGACCAGCAGGGGAAGG - Intergenic
1029521215 7:101063891-101063913 TATAAAGCAACACCTGGGGCTGG - Intergenic
1029597352 7:101544989-101545011 TATAAGCCACCATCCTGGGCTGG - Intronic
1033540378 7:142350450-142350472 TATAAATCAGCAGCTGAGCCTGG + Intergenic
1036201460 8:6774286-6774308 TATAAATATCCAGCCATGGCAGG - Intergenic
1036757115 8:11477895-11477917 TATGAAGCAGCAGCCGTGGCTGG + Intergenic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1045168626 8:99637573-99637595 TATAAATAACCAGCAGTGGCAGG - Intronic
1045571129 8:103370669-103370691 TATAAAAAATTAGCCGGGGCCGG + Intergenic
1046032723 8:108803023-108803045 TATAAATAACTAGCTGAGGCTGG - Intergenic
1055287174 9:74741276-74741298 AATGAAACACCAGCTGGGGCTGG - Intronic
1198538429 X:137610209-137610231 TATAAATTACCAGTCTGGCCAGG - Intergenic
1199836229 X:151594261-151594283 TATAAATTATCAGCCGGGCACGG - Intronic