ID: 1133520819

View in Genome Browser
Species Human (GRCh38)
Location 16:6554921-6554943
Sequence CCAGCTGGAGAATTTGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133520815_1133520819 -3 Left 1133520815 16:6554901-6554923 CCCAGAGTATGCTTTTTCTGCCA 0: 1
1: 0
2: 3
3: 14
4: 255
Right 1133520819 16:6554921-6554943 CCAGCTGGAGAATTTGACCTAGG 0: 1
1: 0
2: 1
3: 12
4: 160
1133520816_1133520819 -4 Left 1133520816 16:6554902-6554924 CCAGAGTATGCTTTTTCTGCCAG 0: 1
1: 0
2: 2
3: 5
4: 164
Right 1133520819 16:6554921-6554943 CCAGCTGGAGAATTTGACCTAGG 0: 1
1: 0
2: 1
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133520819 Original CRISPR CCAGCTGGAGAATTTGACCT AGG Intronic
900097062 1:944087-944109 CAAGCAGGAGAATGGGACCTTGG + Exonic
902412325 1:16218636-16218658 ACACCTGGAGAATTTGGCCCAGG + Intergenic
902822963 1:18954752-18954774 CCAGCTGGGGAATCTGGGCTAGG + Intronic
902983658 1:20142561-20142583 CCAGGGGGAGAATGTGTCCTGGG + Intronic
906512007 1:46415379-46415401 CCAGCAGGAGAATTAGGGCTGGG - Intergenic
909744926 1:79082872-79082894 CCAGCATGAGTATTTGTCCTAGG - Intergenic
910246961 1:85149226-85149248 TAAGCTGGAGAATATGACTTGGG - Intergenic
910672666 1:89788876-89788898 CCAACTGGACCATTTGACCTTGG + Intronic
911584147 1:99671039-99671061 CCAACTGATGAATTTGAACTAGG + Intronic
914346753 1:146806621-146806643 CCACCTGGTGAATTTCTCCTGGG - Intergenic
915445980 1:155975320-155975342 CTGGCTGTGGAATTTGACCTTGG - Intronic
917418117 1:174832753-174832775 CAAGCTGGAGAAAGGGACCTGGG - Intronic
917578275 1:176347041-176347063 CCAGCTTGAGAATCAGAGCTGGG - Intergenic
917929139 1:179811948-179811970 CCAGCTGGAGACCTGGACTTGGG + Intronic
920543675 1:206798235-206798257 CCAGGTGAAGAATGTGAACTAGG - Intergenic
921755994 1:218856230-218856252 ACAACTGGAGAATTTGCCTTGGG + Intergenic
922183792 1:223256787-223256809 CCTGCTGGAAATTTTGATCTGGG - Intronic
922332253 1:224587506-224587528 CCTGATAGAGAATTTGACCTTGG + Intronic
924471817 1:244349433-244349455 TCAGCTGGGGAATAGGACCTTGG + Intergenic
1063523510 10:6761838-6761860 CCAGAAGAACAATTTGACCTTGG + Intergenic
1064221861 10:13447934-13447956 CCTGCTGTAGAATTTGCACTTGG + Intronic
1070373576 10:75808230-75808252 CCAGCTGGAAGATGTCACCTGGG + Intronic
1074412605 10:113241441-113241463 CCACCAAGAGAGTTTGACCTTGG + Intergenic
1075823175 10:125331349-125331371 CCAGATGGCCACTTTGACCTTGG - Intergenic
1075898940 10:126022565-126022587 CCAGCTGCACATTTTGACCCTGG + Intronic
1076327364 10:129636220-129636242 CCAGCCGGAGATACTGACCTTGG + Intronic
1077178907 11:1203587-1203609 GCAGTTGGAGAACTGGACCTGGG - Intergenic
1082955187 11:58863372-58863394 GCAACTGGAGAAATGGACCTAGG + Intronic
1085900615 11:80695703-80695725 GCACCAGGAGAATTTCACCTTGG + Intergenic
1088410939 11:109533821-109533843 ACAGTTGGAGAAGTTAACCTTGG - Intergenic
1090260235 11:125314177-125314199 CCAGTTGGAGAATTTGGGGTTGG + Intronic
1092759148 12:11793619-11793641 CCAGCTGTAGAGTCCGACCTGGG - Intronic
1094342705 12:29430705-29430727 AGAGCTGGAGAATTTGTCCCAGG + Intronic
1097108140 12:56637076-56637098 CCAGCTGGGGCTTTTGTCCTGGG - Intergenic
1097889322 12:64761120-64761142 CCAGCTTGAAAAATTGGCCTAGG - Intergenic
1100192019 12:92203110-92203132 GCAGAGGGAGAAGTTGACCTGGG + Intergenic
1100935640 12:99661938-99661960 GGAGCTGGAGCATTTGTCCTGGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103023033 12:117551839-117551861 CCAGCAGGAGAATTTGATAAGGG - Intronic
1103948117 12:124538241-124538263 CCCTCTGGACAATGTGACCTTGG - Intronic
1104754055 12:131258049-131258071 CCAGCTGCAGTATTTGTGCTGGG + Intergenic
1105050777 12:133048830-133048852 TCACCTGGAGAATCTGAACTTGG - Exonic
1105826780 13:24129947-24129969 CCGGGTGGAGAAATTCACCTGGG + Intronic
1106929483 13:34648375-34648397 CCAACTTGAGAATTTTACTTGGG - Intergenic
1112809494 13:103201090-103201112 CCAGGGGTACAATTTGACCTAGG + Intergenic
1114531923 14:23401889-23401911 CCAGCTTGACACTTTGATCTGGG + Intronic
1117036813 14:51738935-51738957 CCAGGTGGAGCAATTGACTTGGG - Intergenic
1120522173 14:85536188-85536210 CCTGCTGGAGAGTTTGATTTAGG + Intronic
1120542009 14:85762311-85762333 GCAGATGGAGAAACTGACCTGGG + Intergenic
1121864641 14:97351260-97351282 GCAGCTGCAGAAGTTGACCCTGG + Intergenic
1122339410 14:101018613-101018635 CCTCCTGGAGAAATTGGCCTGGG - Intergenic
1128875052 15:71194887-71194909 CCAGTTGGAGAAGCTGCCCTGGG + Intronic
1129370686 15:75092423-75092445 CCAGATGGAGAATTTGTGCTAGG + Intronic
1129746384 15:78024374-78024396 CCAGCTGGAGAGGTTCAGCTTGG - Exonic
1129940758 15:79494962-79494984 CCAGATGGAGGAATTAACCTTGG + Intergenic
1130847566 15:87761620-87761642 CTAACTGCAGAATGTGACCTTGG - Intergenic
1132147955 15:99439586-99439608 CCAGCTGGAGAAGGTGGCCCCGG - Intergenic
1133520819 16:6554921-6554943 CCAGCTGGAGAATTTGACCTAGG + Intronic
1136096802 16:27962796-27962818 CCAGCTGTAGGATTTGACCTTGG - Intronic
1137225421 16:46501500-46501522 CAAGCTGCAGAATTTTCCCTAGG + Intergenic
1138780695 16:59781537-59781559 CAAGCTGCAGAATTTAGCCTTGG + Intergenic
1139987228 16:70908649-70908671 CCACCTGGTGAATTTCTCCTGGG + Exonic
1141233738 16:82196216-82196238 TCAGCTGAAGAATTTGTCCCTGG - Intergenic
1142211250 16:88809664-88809686 CCAGCTGGAGATGTTGGGCTGGG + Exonic
1143318693 17:6053433-6053455 CCAGGTGGAAAATGTGGCCTTGG - Intronic
1145851743 17:28105762-28105784 CCAGCTGGAGAAATGGAGGTAGG - Intronic
1146108854 17:30068762-30068784 CCGGCTGGAGAAGTTGCCCTTGG - Intronic
1149775607 17:59354558-59354580 CCAGCTGGCTGATTTGACCTAGG + Intronic
1150174682 17:63039455-63039477 GCAGCTGGAGGATTTTACGTAGG + Intronic
1151130708 17:71893676-71893698 CCAGCCTAAGAATTTGACCATGG - Intergenic
1152190474 17:78884672-78884694 CCAGCTGGAGGACTTGGCCTGGG + Intronic
1153443228 18:5144336-5144358 ACAGAGGAAGAATTTGACCTTGG - Intergenic
1155165894 18:23232236-23232258 CCAGATGGAGAATGTTACTTAGG - Intronic
1155188744 18:23410960-23410982 CCAGCTGAAGAATTAGAGGTGGG - Intronic
1155939421 18:31788956-31788978 CCAGGTAGAGAAATTGACTTGGG + Intergenic
1156566232 18:38194432-38194454 CCATCTGGACAATTTGACATAGG - Intergenic
1156765718 18:40652525-40652547 CCAGATGTTCAATTTGACCTGGG - Intergenic
1157174127 18:45435621-45435643 CCAGCTGAAGAGTTTGCCTTTGG + Intronic
1157517821 18:48323398-48323420 ACAGCTGGAGAAATTGAGCATGG + Intronic
1158845190 18:61434609-61434631 CCTGCTGCAAAATTTGTCCTGGG + Intronic
1162179240 19:8855998-8856020 CCAGCTGCAGAACTTCACCCTGG - Exonic
1162926647 19:13933552-13933574 TAAGCTGGAGATTTTGACTTGGG + Intronic
1164189586 19:22901855-22901877 CCAGCTGGAGCCTTAGACGTGGG - Intergenic
1164492968 19:28731176-28731198 CCTGCTGGAAAACTTGACCTGGG + Intergenic
1165397784 19:35576570-35576592 CCCCCTGGAGCATTTGAACTAGG - Intergenic
1166585854 19:43948211-43948233 CTAGGTGGAGAATTTGTCGTGGG + Intergenic
925288582 2:2731371-2731393 CCAGCTGGAGTCTTGGTCCTTGG + Intergenic
926120872 2:10240653-10240675 CCACCTGGAGATGTTGACCCAGG - Intergenic
929542643 2:42834208-42834230 CTAGCTGGAGGCTTTGAGCTGGG + Intergenic
929832465 2:45358173-45358195 CCAGCTGGAGAAGTGGCCCTTGG - Intergenic
930945970 2:57075962-57075984 CCATCTGGAGACTTTTGCCTGGG - Intergenic
931726752 2:65118809-65118831 ACACATGGAGAATTTTACCTTGG - Intronic
932001918 2:67893044-67893066 CCAGCAGGAGAAACTGACTTGGG - Intergenic
932278313 2:70468277-70468299 CCAGGTGGAGATATCGACCTGGG + Intronic
934554002 2:95277973-95277995 CATGCTGGAGAAGTTGGCCTCGG - Exonic
935175185 2:100642838-100642860 CGAGCTGGAACATTTGCCCTGGG + Intergenic
946014201 2:216590956-216590978 CCAGCTGGAGAAGTTCACCCAGG + Intergenic
946519617 2:220450736-220450758 CCAGCTGGAAAATGAGTCCTTGG - Intergenic
946611317 2:221461126-221461148 CCCGCTTGAGATTCTGACCTTGG + Intronic
948382301 2:237559303-237559325 CCAGCTGGAGACCTAGACCCAGG + Intergenic
949024113 2:241757254-241757276 ACATCTGGAGGATTTGACATAGG + Intronic
949028015 2:241775288-241775310 AGAGCTGGGGACTTTGACCTGGG + Intergenic
1168829111 20:834571-834593 CCAGGTGGAGCAGCTGACCTAGG + Intronic
1170157704 20:13283800-13283822 CCAGTTAGAGAATTTCAACTGGG - Intronic
1170977912 20:21183897-21183919 GCAGCTGGAGAATTTTTCCCTGG + Intronic
1172015942 20:31872934-31872956 CCAACAGGAAAATTTAACCTGGG + Intronic
1173219843 20:41123240-41123262 CCAGCGGGAGAAGTTTGCCTGGG + Exonic
1177890169 21:26795374-26795396 CTACCTGTAGAATTTGACATGGG - Intergenic
1178400916 21:32283878-32283900 CCAGCTGGTGACTGTGACCCTGG - Intergenic
1178487988 21:33030869-33030891 CCAGCTGGAGGCCTTGACCACGG + Intergenic
1181943793 22:26499349-26499371 CGAGCTGGAGAAGATGACCGAGG - Exonic
1182164867 22:28163044-28163066 CCAGCTCATGACTTTGACCTGGG + Intronic
949574289 3:5323706-5323728 CTAGCTGGAGAATATGATGTGGG + Intergenic
950477859 3:13225085-13225107 CCTGCATGAGAATTTGATCTCGG - Intergenic
954671861 3:52295348-52295370 CCAGCTGGAGGATTTCACCATGG + Intergenic
960021757 3:112963745-112963767 CCAGCTGCAGAAATTTGCCTAGG + Intronic
961520867 3:127466732-127466754 CCTGCTGGTGAAGTTGGCCTCGG - Intergenic
961786698 3:129351858-129351880 CCTGCATGAGAATTTGATCTTGG + Intergenic
962258850 3:133890306-133890328 CCAGCTGGATCATGTAACCTTGG - Intronic
964373293 3:156024095-156024117 TAAGCTGGATAATTTGACTTTGG + Intergenic
969071320 4:4541809-4541831 CCGGCTGGAGAAGTCGCCCTTGG + Exonic
969116718 4:4874768-4874790 CCAGCTGACAAATTTGACCCAGG - Intergenic
973846770 4:54920882-54920904 ACAGCTGGGGAATGTGAACTAGG - Intergenic
977575629 4:98671077-98671099 CCAGCTGAAGAGTATTACCTGGG - Intergenic
981267300 4:142801954-142801976 TTGGCTGGAGAAATTGACCTAGG + Intronic
982400004 4:154955386-154955408 CCAGCTGAAAAAATTTACCTAGG - Intergenic
982913779 4:161179312-161179334 ACTGCTGGGGAATTTGAGCTTGG - Intergenic
983808835 4:172031181-172031203 CAACTTGGAGAATTTCACCTGGG + Intronic
991185929 5:63807363-63807385 CCAGCTGATGAGTATGACCTTGG + Intergenic
992270996 5:75062777-75062799 CCATGTGGACATTTTGACCTTGG - Intergenic
992331853 5:75725189-75725211 CAAGATGGAGACTATGACCTGGG - Intergenic
995455680 5:112349323-112349345 CCAACTGGAGAAGTGAACCTTGG + Intronic
997384886 5:133464742-133464764 CCAGCTGCAGGATTTGATCGGGG + Intronic
997715140 5:136036917-136036939 CCAGAAGGAGAATTTCACCTTGG + Intronic
1000860401 5:166450292-166450314 GCTGCTGGAGAGTTTGAACTGGG - Intergenic
1001355073 5:171012375-171012397 ACAGCTATAGAATTTTACCTTGG - Intronic
1001861442 5:175059119-175059141 CCTCCTGGAAGATTTGACCTTGG - Intergenic
1002189687 5:177472233-177472255 CCAGGTGGGGACTCTGACCTGGG - Exonic
1004590783 6:17049737-17049759 CCCTCTGGAGAATGTGACCAGGG - Intergenic
1006265895 6:32923234-32923256 CCAGGTGGATAATTTGAGGTAGG + Intergenic
1008653122 6:53583832-53583854 CCACCTGGTGAATTTGGGCTTGG + Intronic
1009994907 6:70886957-70886979 CCAGCTTGGGACTTTGTCCTTGG - Intronic
1010951196 6:82039045-82039067 CCACCTTGGGAATTTGAGCTGGG + Intergenic
1013230780 6:108160189-108160211 GCAGCTGCAGCATTTGACTTGGG + Intronic
1018717390 6:166544020-166544042 CAACCTGGTGAATTTGAGCTTGG - Intronic
1020577116 7:9947290-9947312 CCAGCTGATGAAAATGACCTGGG + Intergenic
1023127026 7:36964923-36964945 CCAGTTGGAGAACTTGTACTAGG - Intronic
1027785256 7:82572555-82572577 CCAGCAGGAGAGTCTGACCCAGG + Intergenic
1029208479 7:98884777-98884799 CCAGTTGGAAAATTGTACCTAGG + Intronic
1030780817 7:113597505-113597527 CAAGATGAAGAATTTCACCTGGG - Intergenic
1031159288 7:118146602-118146624 TCAGCTGAAGAATAAGACCTGGG + Intergenic
1031944468 7:127825008-127825030 CCAGCTGGAGAATTATATGTAGG + Intronic
1032705876 7:134421016-134421038 CCAGCTGGAGAACTTGTCAAAGG + Intergenic
1032949209 7:136888163-136888185 TAAGCAGGAGAATTTTACCTGGG + Intronic
1034102028 7:148458246-148458268 TCAGCTCCAGAATTTGACTTTGG - Intergenic
1035277665 7:157757829-157757851 CCAGCTGCTGAACTTAACCTGGG + Intronic
1035403226 7:158581853-158581875 GCAGCTGGAAAACTGGACCTCGG - Intronic
1035453854 7:158996702-158996724 CCTGCTGGAGAATTTCACTGAGG + Intergenic
1036391324 8:8326961-8326983 CCAGAAGGAGCATTCGACCTAGG - Intronic
1038755880 8:30340272-30340294 CCAGCTAGAGAATTCTGCCTAGG + Intergenic
1041437161 8:57854929-57854951 CTAGCTGGAGAACTTGTCATGGG - Intergenic
1042699787 8:71599700-71599722 CCATCTGGAGAAAGTGCCCTAGG + Intergenic
1042836976 8:73087869-73087891 CCAGCTGGAGAATCAGAGATTGG + Intronic
1045449523 8:102307997-102308019 CAAGCTGGAGAAATTTACTTGGG - Intronic
1049248794 8:141577221-141577243 CCACCTGGAGAAGGTGGCCTTGG - Intergenic
1049860283 8:144893630-144893652 CCTGCATGCGAATTTGACCTTGG + Intronic
1052550556 9:29942047-29942069 CCTGCTGGAGGAATTGAACTGGG + Intergenic
1055082090 9:72277389-72277411 CCACCTGCAGATTCTGACCTTGG - Intergenic
1057970799 9:99555464-99555486 CCAGCTGGACACTAAGACCTGGG - Intergenic
1058551490 9:106120112-106120134 CCTGCTGGAGTTTATGACCTAGG + Intergenic
1061608010 9:131726128-131726150 TCTGCGTGAGAATTTGACCTTGG - Intronic
1192765592 X:74136832-74136854 TCAGCTGGAGAATTTCCCTTTGG - Intergenic
1198227387 X:134658125-134658147 CCAGCTGGGAAATGTGACATGGG - Intronic
1199927754 X:152486525-152486547 TGAGCTTGAGAATTTGAGCTAGG + Intergenic