ID: 1133522590

View in Genome Browser
Species Human (GRCh38)
Location 16:6573701-6573723
Sequence TACCAAGTGTCTCTTTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133522590_1133522598 9 Left 1133522590 16:6573701-6573723 CCTCCCGAAAGAGACACTTGGTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1133522598 16:6573733-6573755 CGGGCGCGAAGCCCGGCTGCGGG 0: 1
1: 0
2: 1
3: 14
4: 139
1133522590_1133522597 8 Left 1133522590 16:6573701-6573723 CCTCCCGAAAGAGACACTTGGTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1133522597 16:6573732-6573754 ACGGGCGCGAAGCCCGGCTGCGG 0: 1
1: 1
2: 0
3: 2
4: 71
1133522590_1133522600 18 Left 1133522590 16:6573701-6573723 CCTCCCGAAAGAGACACTTGGTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1133522600 16:6573742-6573764 AGCCCGGCTGCGGGAGAGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 172
1133522590_1133522596 2 Left 1133522590 16:6573701-6573723 CCTCCCGAAAGAGACACTTGGTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1133522596 16:6573726-6573748 GAAGGCACGGGCGCGAAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1133522590_1133522595 -10 Left 1133522590 16:6573701-6573723 CCTCCCGAAAGAGACACTTGGTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1133522595 16:6573714-6573736 ACACTTGGTAGAGAAGGCACGGG 0: 1
1: 0
2: 1
3: 14
4: 164
1133522590_1133522599 17 Left 1133522590 16:6573701-6573723 CCTCCCGAAAGAGACACTTGGTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1133522599 16:6573741-6573763 AAGCCCGGCTGCGGGAGAGCTGG 0: 1
1: 0
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133522590 Original CRISPR TACCAAGTGTCTCTTTCGGG AGG (reversed) Intronic