ID: 1133522591

View in Genome Browser
Species Human (GRCh38)
Location 16:6573704-6573726
Sequence CTCTACCAAGTGTCTCTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133522591_1133522596 -1 Left 1133522591 16:6573704-6573726 CCCGAAAGAGACACTTGGTAGAG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1133522596 16:6573726-6573748 GAAGGCACGGGCGCGAAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1133522591_1133522597 5 Left 1133522591 16:6573704-6573726 CCCGAAAGAGACACTTGGTAGAG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1133522597 16:6573732-6573754 ACGGGCGCGAAGCCCGGCTGCGG 0: 1
1: 1
2: 0
3: 2
4: 71
1133522591_1133522599 14 Left 1133522591 16:6573704-6573726 CCCGAAAGAGACACTTGGTAGAG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1133522599 16:6573741-6573763 AAGCCCGGCTGCGGGAGAGCTGG 0: 1
1: 0
2: 0
3: 15
4: 167
1133522591_1133522598 6 Left 1133522591 16:6573704-6573726 CCCGAAAGAGACACTTGGTAGAG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1133522598 16:6573733-6573755 CGGGCGCGAAGCCCGGCTGCGGG 0: 1
1: 0
2: 1
3: 14
4: 139
1133522591_1133522600 15 Left 1133522591 16:6573704-6573726 CCCGAAAGAGACACTTGGTAGAG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1133522600 16:6573742-6573764 AGCCCGGCTGCGGGAGAGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133522591 Original CRISPR CTCTACCAAGTGTCTCTTTC GGG (reversed) Intronic