ID: 1133522596

View in Genome Browser
Species Human (GRCh38)
Location 16:6573726-6573748
Sequence GAAGGCACGGGCGCGAAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133522591_1133522596 -1 Left 1133522591 16:6573704-6573726 CCCGAAAGAGACACTTGGTAGAG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1133522596 16:6573726-6573748 GAAGGCACGGGCGCGAAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1133522590_1133522596 2 Left 1133522590 16:6573701-6573723 CCTCCCGAAAGAGACACTTGGTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1133522596 16:6573726-6573748 GAAGGCACGGGCGCGAAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1133522592_1133522596 -2 Left 1133522592 16:6573705-6573727 CCGAAAGAGACACTTGGTAGAGA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1133522596 16:6573726-6573748 GAAGGCACGGGCGCGAAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133522596 Original CRISPR GAAGGCACGGGCGCGAAGCC CGG Intronic