ID: 1133522597 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:6573732-6573754 |
Sequence | ACGGGCGCGAAGCCCGGCTG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 75 | |||
Summary | {0: 1, 1: 1, 2: 0, 3: 2, 4: 71} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1133522590_1133522597 | 8 | Left | 1133522590 | 16:6573701-6573723 | CCTCCCGAAAGAGACACTTGGTA | 0: 1 1: 0 2: 0 3: 8 4: 69 |
||
Right | 1133522597 | 16:6573732-6573754 | ACGGGCGCGAAGCCCGGCTGCGG | 0: 1 1: 1 2: 0 3: 2 4: 71 |
||||
1133522592_1133522597 | 4 | Left | 1133522592 | 16:6573705-6573727 | CCGAAAGAGACACTTGGTAGAGA | 0: 1 1: 0 2: 0 3: 13 4: 160 |
||
Right | 1133522597 | 16:6573732-6573754 | ACGGGCGCGAAGCCCGGCTGCGG | 0: 1 1: 1 2: 0 3: 2 4: 71 |
||||
1133522591_1133522597 | 5 | Left | 1133522591 | 16:6573704-6573726 | CCCGAAAGAGACACTTGGTAGAG | 0: 1 1: 0 2: 1 3: 11 4: 143 |
||
Right | 1133522597 | 16:6573732-6573754 | ACGGGCGCGAAGCCCGGCTGCGG | 0: 1 1: 1 2: 0 3: 2 4: 71 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1133522597 | Original CRISPR | ACGGGCGCGAAGCCCGGCTG CGG | Intronic | ||