ID: 1133522597

View in Genome Browser
Species Human (GRCh38)
Location 16:6573732-6573754
Sequence ACGGGCGCGAAGCCCGGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133522590_1133522597 8 Left 1133522590 16:6573701-6573723 CCTCCCGAAAGAGACACTTGGTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1133522597 16:6573732-6573754 ACGGGCGCGAAGCCCGGCTGCGG 0: 1
1: 1
2: 0
3: 2
4: 71
1133522592_1133522597 4 Left 1133522592 16:6573705-6573727 CCGAAAGAGACACTTGGTAGAGA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1133522597 16:6573732-6573754 ACGGGCGCGAAGCCCGGCTGCGG 0: 1
1: 1
2: 0
3: 2
4: 71
1133522591_1133522597 5 Left 1133522591 16:6573704-6573726 CCCGAAAGAGACACTTGGTAGAG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1133522597 16:6573732-6573754 ACGGGCGCGAAGCCCGGCTGCGG 0: 1
1: 1
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133522597 Original CRISPR ACGGGCGCGAAGCCCGGCTG CGG Intronic