ID: 1133522598

View in Genome Browser
Species Human (GRCh38)
Location 16:6573733-6573755
Sequence CGGGCGCGAAGCCCGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133522592_1133522598 5 Left 1133522592 16:6573705-6573727 CCGAAAGAGACACTTGGTAGAGA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1133522598 16:6573733-6573755 CGGGCGCGAAGCCCGGCTGCGGG 0: 1
1: 0
2: 1
3: 14
4: 139
1133522591_1133522598 6 Left 1133522591 16:6573704-6573726 CCCGAAAGAGACACTTGGTAGAG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1133522598 16:6573733-6573755 CGGGCGCGAAGCCCGGCTGCGGG 0: 1
1: 0
2: 1
3: 14
4: 139
1133522590_1133522598 9 Left 1133522590 16:6573701-6573723 CCTCCCGAAAGAGACACTTGGTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1133522598 16:6573733-6573755 CGGGCGCGAAGCCCGGCTGCGGG 0: 1
1: 0
2: 1
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133522598 Original CRISPR CGGGCGCGAAGCCCGGCTGC GGG Intronic