ID: 1133523544

View in Genome Browser
Species Human (GRCh38)
Location 16:6581724-6581746
Sequence CTGTGTTTATGGAGGTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133523541_1133523544 -3 Left 1133523541 16:6581704-6581726 CCTTAATGAGGGACTCACAGCTG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG 0: 1
1: 0
2: 0
3: 12
4: 180
1133523537_1133523544 19 Left 1133523537 16:6581682-6581704 CCCTCATGGGTTCTGCTTAGCTC 0: 1
1: 0
2: 1
3: 13
4: 119
Right 1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG 0: 1
1: 0
2: 0
3: 12
4: 180
1133523538_1133523544 18 Left 1133523538 16:6581683-6581705 CCTCATGGGTTCTGCTTAGCTCC 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG 0: 1
1: 0
2: 0
3: 12
4: 180
1133523536_1133523544 22 Left 1133523536 16:6581679-6581701 CCTCCCTCATGGGTTCTGCTTAG 0: 1
1: 0
2: 0
3: 19
4: 137
Right 1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG 0: 1
1: 0
2: 0
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133523544 Original CRISPR CTGTGTTTATGGAGGTCACC TGG Intronic
901734044 1:11300930-11300952 GTGTGTTTCTGCAGGTGACCTGG - Intergenic
902414235 1:16229736-16229758 CTGTGGTGATGGAGGTCCCGGGG + Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904209156 1:28874579-28874601 CTGAGTTTAAGGAGTTTACCAGG + Intergenic
910685620 1:89913141-89913163 TTGTCTTTATGAAGGTTACCAGG + Intronic
910688357 1:89940816-89940838 CCCTGTTTCTTGAGGTCACCAGG - Intergenic
911983667 1:104596972-104596994 ATGTATTCATGGAGGTCACAGGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
915479887 1:156177296-156177318 CTGTGTTTCTGGAGGGTCCCTGG - Exonic
916436478 1:164782343-164782365 CTCTGTCTATGGCTGTCACCTGG + Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
917740925 1:177961464-177961486 ATTTGCTTATGTAGGTCACCTGG - Intronic
921033431 1:211353884-211353906 CTGTGTTGAGGGAGGATACCAGG + Intronic
922506254 1:226127704-226127726 CTGTGTTTTTGTAAGTCCCCAGG - Intergenic
922918802 1:229283228-229283250 CAGTGTCAGTGGAGGTCACCAGG - Intronic
923012950 1:230103573-230103595 CTGTGTCTGTGGGGCTCACCAGG + Intronic
924659145 1:246000607-246000629 CTGTGTGTATGGTGGTGTCCAGG - Intronic
1062980245 10:1716205-1716227 GTGTGTTTTTGGAGCTCAGCAGG - Intronic
1063232648 10:4080870-4080892 CTGGGTTGAAGGAGGTCATCAGG - Intergenic
1063845035 10:10118355-10118377 CTGTATTGATGGTTGTCACCTGG + Intergenic
1063877194 10:10492668-10492690 TTTTGTTTATGGTGGTCACTTGG - Intergenic
1064323630 10:14329092-14329114 ATGAGTTTATGGAGGTGACTTGG - Intronic
1065088623 10:22206572-22206594 CTGGGTTGGTGGAGGTCACTAGG - Intergenic
1068481838 10:57599617-57599639 CTGTGGTTATGTTAGTCACCAGG - Intergenic
1069042314 10:63708704-63708726 CTATGTTTACAGAGGTCACCGGG + Intergenic
1070751516 10:78966768-78966790 CTGTGCTCACTGAGGTCACCGGG - Intergenic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1075734981 10:124658999-124659021 CTGTGTCTGTGGTGGTAACCTGG + Intronic
1076532738 10:131155530-131155552 CTGTCTTTATGGAGTTCAAACGG + Intronic
1077611814 11:3647985-3648007 ATGTGTTTGTGCAGGTCACAGGG - Intronic
1077766770 11:5166059-5166081 ATGTGTATATGCAGGTCACAGGG + Intronic
1078431337 11:11290830-11290852 CAGAGTCTATGGAGGTCACAAGG - Intronic
1083723612 11:64617048-64617070 CTGTGTTTATGGACTTCAGGGGG + Intronic
1085614218 11:77982857-77982879 CAGTTTCTAAGGAGGTCACCAGG + Intronic
1087154998 11:94893919-94893941 CTGTGTTTGTGGAAGCCATCAGG + Intergenic
1090189188 11:124757441-124757463 CTGTGTTCAAGGAAGTCAGCTGG - Intronic
1092414431 12:8279363-8279385 ATGTGTACATGCAGGTCACCGGG + Intergenic
1093529738 12:20146755-20146777 CTGTGTTTATGAAGGCCTACAGG - Intergenic
1093965688 12:25322610-25322632 TTGTGTTTAGGGAGGCCACTGGG + Intergenic
1097005617 12:55915330-55915352 CTGTATTTGTGGAGATAACCAGG - Intronic
1101684954 12:107009810-107009832 CTTTGTTTATGGGGGACACTTGG + Intronic
1102227586 12:111239894-111239916 CTGTCTTTGTGGAGGACCCCAGG - Intronic
1103479450 12:121241603-121241625 CTGTTCTTAGGGAGGTCACTGGG + Intronic
1107295934 13:38907545-38907567 CTGTGTGTATGGAGTTTACATGG + Intergenic
1109929492 13:69196724-69196746 ATGTGTACATGCAGGTCACCGGG - Intergenic
1113078830 13:106494843-106494865 CTGTGTGTATGGAGGTCTGTGGG - Intronic
1113294844 13:108947576-108947598 CTGTGTTTATGCTGGACACAAGG + Intronic
1115620829 14:35138594-35138616 AGGTGTTTATGGAGGTCAGTTGG - Intronic
1117139865 14:52778207-52778229 CAGTATTTATGGAGGTCACTCGG + Exonic
1117191095 14:53292701-53292723 CTGGGTCCATGGAGGTCTCCTGG + Intergenic
1117593375 14:57300151-57300173 CTCTGTTTAAGAAGGTCTCCTGG + Intergenic
1117912171 14:60647160-60647182 CTGTGTTTACTCAGGTCACTGGG - Intronic
1119331448 14:73797347-73797369 CTGTGTGTACAGATGTCACCTGG + Intergenic
1122255274 14:100471700-100471722 CTGTATTGATTGAGGACACCAGG - Intronic
1122502004 14:102207019-102207041 CTGTTTATAGGTAGGTCACCAGG + Intronic
1124466043 15:29940896-29940918 CTGTGGTTATGGTGGTCATCGGG - Intronic
1125089389 15:35772733-35772755 CTATGTTTATTGAGGGCACTGGG + Intergenic
1125883741 15:43213581-43213603 GGGTCTTTATGGCGGTCACCAGG + Intronic
1127687003 15:61355978-61356000 CTCTTTTTCTGGAGCTCACCTGG - Intergenic
1128997797 15:72309604-72309626 CAGTGGTGATGGAGGACACCTGG + Intronic
1129076964 15:73005295-73005317 CTGTTTTAATGAAGGTGACCAGG + Intergenic
1131300841 15:91198501-91198523 GTGTGTGTTTGGAGGTCTCCTGG + Intronic
1131417028 15:92269077-92269099 CTGTGTTTATCAAGCTCTCCAGG - Intergenic
1131589443 15:93732096-93732118 CTGTGTCTTTGGAGGTCAGGGGG + Intergenic
1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG + Intronic
1136605096 16:31328209-31328231 CTGTCTACATGGTGGTCACCAGG + Exonic
1140206475 16:72937605-72937627 CTGTACTCATGGAAGTCACCTGG - Intronic
1142752028 17:1994672-1994694 TTGTGTTGACCGAGGTCACCGGG - Intronic
1143592432 17:7893732-7893754 CTGGAATTATGGAGGTCACAGGG - Intronic
1144511601 17:15881834-15881856 CTGTGTTTCTGGAAGACACAAGG - Intergenic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1147788123 17:42995050-42995072 CTGTGTTTGTTGAGGGCACGGGG - Intergenic
1149076273 17:52598603-52598625 CTATGTGTATGCAGGGCACCTGG - Intergenic
1152681404 17:81670226-81670248 ATGTCTTTCTGAAGGTCACCTGG - Exonic
1153510760 18:5849342-5849364 ATATTTTTATGGAGGCCACCAGG - Intergenic
1153667566 18:7379789-7379811 CTTTGTTTATGGGAGGCACCTGG + Intergenic
1154030887 18:10753391-10753413 CTCTGTTTCTGGAGGTCCTCAGG + Intronic
1154277452 18:12974719-12974741 ATGTGTTTATATAGGTTACCGGG + Intronic
1155381506 18:25227124-25227146 ATGTGTTTTTGGAGGTCTTCCGG + Exonic
1158457585 18:57621730-57621752 CTGTGTCCTTGGAGGTGACCAGG - Exonic
1158697540 18:59716245-59716267 CTGTGGCCATGGAGCTCACCAGG - Intergenic
1159893568 18:73975310-73975332 CACTGCTGATGGAGGTCACCCGG - Intergenic
1161513847 19:4685625-4685647 CTTTGTATATGGAGGCCCCCAGG - Exonic
1167563647 19:50242136-50242158 GGGTGTTTCTGGACGTCACCAGG - Intronic
1168070310 19:53946519-53946541 CTGTGTATATTGAAGCCACCTGG + Intergenic
1168070411 19:53947186-53947208 CTGTGTATATTGAAGCCACCTGG + Intergenic
1168120300 19:54248265-54248287 CTGTGTTTGTGGATGGCACTGGG + Intronic
1168123955 19:54272553-54272575 CTGTGTTTGTGGATGGCACTGGG + Intronic
1168178409 19:54642981-54643003 CTGTGTTTGTGGATGGCACTGGG - Intronic
925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG + Intronic
925970874 2:9105764-9105786 ATGAGTTTATCCAGGTCACCAGG - Intergenic
926708840 2:15859033-15859055 CTGTGCTTTTAGAGGTCACCTGG - Intergenic
928483409 2:31706486-31706508 CTGTCTTTGTGGAGGACACTTGG - Intergenic
937566776 2:123302076-123302098 CTGTATTTATTGAGGTAATCAGG - Intergenic
938671293 2:133588975-133588997 CAGTGGTTGTGGAGGTCACATGG + Intergenic
940836682 2:158529622-158529644 CTGTGTTGATGTAAGTCACTAGG - Intronic
941373166 2:164692909-164692931 TTGTGTTTCTGGAAGTCACATGG + Intronic
941936262 2:170983328-170983350 ATGTGTACATGCAGGTCACCGGG + Intergenic
945996420 2:216440572-216440594 CTGTGTTTATGAAGGTGTCTTGG + Intronic
946781402 2:223195447-223195469 ATGTGTTCATGCAGGTCACAGGG + Intronic
947115991 2:226771196-226771218 CTGTGTTTATCAAGGTCAGAAGG + Intronic
947711903 2:232321303-232321325 CTGACTGTATGGAGCTCACCAGG + Intronic
948078438 2:235185538-235185560 CTGTGATTCTGGAGGTTGCCTGG - Intergenic
1170960234 20:21019190-21019212 CTGTTTTGATGCAGGTTACCTGG + Intergenic
1171157637 20:22890918-22890940 CTTTGTTTATGGAAGTCACTTGG - Intergenic
1171297412 20:24030482-24030504 CTGTCTCCATTGAGGTCACCAGG + Intergenic
1176131144 20:63497368-63497390 CTGTGGTGAGGGAGGTGACCTGG - Intronic
1178831389 21:36059979-36060001 CTGTGTCTGTGGCGGTCACCGGG - Exonic
1181688785 22:24546729-24546751 CTTGGTTTATGGAGCTCACTGGG - Intronic
1181735538 22:24878550-24878572 CTGTTTTTCTGGATGTCTCCTGG + Intronic
1184550124 22:45200017-45200039 GTGTGCTGAAGGAGGTCACCTGG + Exonic
1185100263 22:48836557-48836579 CTGTGTTGATGGGGGACCCCAGG - Intronic
949523693 3:4881590-4881612 CTGAGTATATGGAGGTTCCCTGG + Intronic
950113633 3:10436389-10436411 CTGTGTTTAATGATGTCACGTGG + Intronic
950494360 3:13324726-13324748 CTGTGTTTGCAGAGGTTACCTGG - Intronic
953564040 3:44015903-44015925 GTGGGTTTATGGAGGTAACTGGG - Intergenic
953835296 3:46338188-46338210 CTGTGTTTCCTGAGGTCTCCTGG - Intergenic
954360777 3:50121709-50121731 CTGTGTTGTTGGTGGCCACCAGG + Intergenic
956588698 3:70890459-70890481 CTGTGTTTATGGAGATCAGGTGG - Intergenic
960100676 3:113739370-113739392 CTATCTTTTTGGAGGTCAACTGG + Intronic
960188423 3:114672989-114673011 CTGTGTGTATGGAAATCACTTGG - Intronic
960458753 3:117906660-117906682 CTGTGTTTGTGCAGCTCATCTGG - Intergenic
963002614 3:140696446-140696468 CAGTATTATTGGAGGTCACCTGG - Intronic
963743823 3:149106206-149106228 CTGTATTTGTGGGGGTAACCAGG - Intergenic
964409454 3:156382801-156382823 CTCTGCTTATGGTGGTCACTTGG - Intronic
965325951 3:167304322-167304344 CTGTTTATATAGATGTCACCTGG + Intronic
969515274 4:7644288-7644310 CTGGCTTTATGGAAGTTACCAGG - Intronic
972039162 4:34569666-34569688 ATGTTCTTATGTAGGTCACCTGG - Intergenic
972209106 4:36815408-36815430 CTGAGTAGATGGATGTCACCAGG - Intergenic
976931394 4:90570559-90570581 CCATGTTGAAGGAGGTCACCAGG - Intronic
977839759 4:101688487-101688509 CTGTGGTTATGGAGTTCCTCAGG + Intronic
979370537 4:119880747-119880769 ATGTGTTATTGGAGGTCAACAGG + Intergenic
979638922 4:122989493-122989515 CTGAGTTCATGGATGCCACCTGG + Intronic
981594265 4:146401472-146401494 GTGTGGTTATGCAGGTCTCCTGG - Intronic
984475459 4:180229227-180229249 CTGTGTTGACCAAGGTCACCTGG - Intergenic
985359204 4:189154747-189154769 CTGATTTCCTGGAGGTCACCAGG - Intergenic
986428656 5:7659881-7659903 CTGTGTTTACACAGGTCATCTGG - Intronic
986740866 5:10704051-10704073 CTGTGGAGATGAAGGTCACCAGG - Intronic
988410993 5:30885471-30885493 CTGTGTTTATGTAATTCACTAGG - Intergenic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
991666006 5:69000605-69000627 CTGTGTTTATGGGGGTAGACTGG - Intergenic
992785933 5:80170676-80170698 CTGTGTTTATGGAGAAAACTTGG - Intronic
992828497 5:80571543-80571565 CTGTTTGTTTGGAGGTTACCAGG + Intergenic
994102634 5:95910631-95910653 CTGTGTTCCTAGGGGTCACCTGG - Intronic
996731674 5:126723168-126723190 CTCTGGTTATGGATGTCCCCAGG - Intergenic
1001199131 5:169699913-169699935 CTGTCTTTCTGGAGATCACTGGG - Intronic
1004686397 6:17950222-17950244 TTGTATTTATGGAGATCAACAGG - Intronic
1005317845 6:24621438-24621460 CTGTGTCTCTGGATGTCCCCTGG - Intronic
1008623785 6:53298174-53298196 CCATGTATATGGAGGTCACAGGG + Intronic
1008765646 6:54910496-54910518 CTGCCTTTCTGGTGGTCACCAGG + Intronic
1012931788 6:105325159-105325181 TTGTGTTTGTGGGGGGCACCGGG - Intronic
1015655518 6:135514068-135514090 CTCTGTTAATAGAGGTCACTGGG - Intergenic
1016295614 6:142570596-142570618 CTGTGTGCTTGGAGCTCACCAGG + Intergenic
1019637619 7:2084489-2084511 CTGTGCTCACGGAGGTCCCCAGG + Intronic
1019728899 7:2619323-2619345 CAATGTGTATGGAGGTCGCCTGG - Intergenic
1020941390 7:14542868-14542890 CTGTGTTTACGGAGATCCCAGGG + Intronic
1021855898 7:24855331-24855353 TTGTTTTTCTGTAGGTCACCTGG - Intronic
1023703168 7:42912155-42912177 CCATGTTTATTGAGGGCACCTGG + Intronic
1023828232 7:44024152-44024174 CATTGTTTCTGGAGGCCACCTGG - Intergenic
1024536648 7:50440391-50440413 AGGTGTTTCTGGAGGTCACAAGG - Intergenic
1024538420 7:50457674-50457696 CTGTGTTTTTGGGGCCCACCAGG - Intronic
1024549497 7:50550414-50550436 CTCCCTTTATGGTGGTCACCTGG + Intronic
1029756534 7:102577598-102577620 CATTGTTTCTGGAGGCCACCTGG - Intronic
1029774476 7:102676667-102676689 CATTGTTTCTGGAGGCCACCTGG - Intergenic
1031267230 7:119596573-119596595 TTGTGTTCATGGTGGTCATCTGG - Intergenic
1032774025 7:135091065-135091087 ATGTGTTGATGGAGGTTACTGGG + Intronic
1033858966 7:145600878-145600900 CTGGCTTTATGGAGGTCAGAAGG - Intergenic
1034643230 7:152621396-152621418 CTGCATTTAATGAGGTCACCTGG + Intergenic
1035153708 7:156895267-156895289 CTGGGGTGATGGAGGTGACCAGG - Intergenic
1036663434 8:10723034-10723056 CTGTGTTTATGGATGTCCTGTGG - Intergenic
1039229205 8:35424639-35424661 CTGTGTTTATGAAGCTCTTCAGG + Intronic
1040773900 8:51015587-51015609 TTGTGTTGATGGAAGTGACCTGG - Intergenic
1043818099 8:84828465-84828487 CAGTATTTATGGAGGTCACTGGG + Intronic
1045410546 8:101912985-101913007 CTTTATTTCTGGAAGTCACCTGG - Intronic
1049256337 8:141615920-141615942 ATGTGTCCCTGGAGGTCACCAGG + Intergenic
1050959594 9:11711457-11711479 ATGTGTTTATGGAAATCACACGG - Intergenic
1053047287 9:34930448-34930470 CTGTCTTTATTTAGGACACCAGG - Intergenic
1057481508 9:95448473-95448495 CAGTGATTCAGGAGGTCACCAGG - Intronic
1062557798 9:137123496-137123518 CTGTGTTTTTGGGGGTCAGATGG + Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187213885 X:17255621-17255643 CTCTGTTTATGGTGGTCCCCTGG - Intergenic
1188574304 X:31627914-31627936 CTCTTTTTATGGAGTTCACTAGG - Intronic
1189104599 X:38222382-38222404 CCTTGTTTATGTGGGTCACCTGG + Intronic
1189317527 X:40066466-40066488 CCGTGTTTATGAAGCCCACCGGG - Intronic
1189570587 X:42291813-42291835 CTGTTTGTATGAAGATCACCTGG - Intergenic
1194779100 X:98000940-98000962 GTGAGTTTATCAAGGTCACCTGG + Intergenic
1195389130 X:104342766-104342788 CCGTGTCTGGGGAGGTCACCAGG + Intergenic
1198677357 X:139145085-139145107 CTGGGTTAATGGAGGACAGCTGG + Intronic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1202251527 Y:22878337-22878359 CTGTGTACATGGAGGCCACACGG - Intergenic
1202404515 Y:24512086-24512108 CTGTGTACATGGAGGCCACACGG - Intergenic
1202466264 Y:25157996-25158018 CTGTGTACATGGAGGCCACACGG + Intergenic