ID: 1133526780

View in Genome Browser
Species Human (GRCh38)
Location 16:6613290-6613312
Sequence AAGGGTAAACTTGGGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 331}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133526780 Original CRISPR AAGGGTAAACTTGGGAAGGA TGG Intronic
901088735 1:6627735-6627757 GATGGTAAAATTGAGAAGGAAGG - Intronic
902171713 1:14616793-14616815 CAGGATACACTTGGGAAGGCTGG + Intronic
902312693 1:15593808-15593830 AACGGGAAAATTGGGCAGGAGGG - Intergenic
902400070 1:16152748-16152770 AAGGGTTAACCTGGCATGGAGGG + Intronic
902930869 1:19730628-19730650 AAGGGGCACCTTGGGAAGGGTGG + Intronic
904794276 1:33047077-33047099 AAGGCCAGGCTTGGGAAGGAAGG - Intronic
904807643 1:33143055-33143077 AAGGCCAGGCTTGGGAAGGAAGG - Intergenic
905441026 1:37996692-37996714 CAGGGTATAATGGGGAAGGAAGG - Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
905952508 1:41964098-41964120 AAAGGAAAACTTGTGGAGGAGGG + Intronic
906842353 1:49153016-49153038 AAGGGGAGAGGTGGGAAGGAAGG + Intronic
907381284 1:54092516-54092538 AGGGTTACACATGGGAAGGAAGG + Intronic
907598421 1:55742510-55742532 AAGGGTAAAGTTGGGGTGCAAGG - Intergenic
907767578 1:57425250-57425272 AACGGTAAACTTTTTAAGGAAGG - Intronic
910119447 1:83769405-83769427 AAAGGTAAAATTATGAAGGAAGG - Intergenic
911053336 1:93690908-93690930 AAGGGGGAACTTGGGAAAAAGGG + Intronic
911113118 1:94213102-94213124 TAAGGTTAACTTGGGAAGGAAGG - Intronic
911337408 1:96597476-96597498 AAGTGTAAATTTGTCAAGGAAGG - Intergenic
912058373 1:105633000-105633022 AAAGGAAAACTTGATAAGGAAGG + Intergenic
914958313 1:152184500-152184522 AAGAGGAAACATGGGAACGATGG + Intergenic
915355947 1:155255242-155255264 GAGGGTAAAAGCGGGAAGGATGG + Exonic
918164192 1:181928840-181928862 AAGAGGAACCATGGGAAGGAAGG + Intergenic
918625654 1:186653484-186653506 CATGGTAAACTAGGGAAGGGAGG + Intergenic
918949548 1:191118964-191118986 AAGGGCAAACTTAGAAAGGGTGG + Intergenic
920211302 1:204330803-204330825 CAGGGTGATCTAGGGAAGGAGGG - Intronic
921103582 1:211953154-211953176 ATGGGTAAACTTTGGAGAGATGG + Intronic
921591927 1:217014094-217014116 AAAAGTAAATTTTGGAAGGAGGG - Intronic
922336040 1:224618565-224618587 GAGGGGAAACTCGGGGAGGAAGG + Intronic
922874589 1:228930287-228930309 ATGGGGAAACTTGGAAATGATGG + Intergenic
924095532 1:240547101-240547123 AAGGGTATTCTTGGCAAGAAGGG + Intronic
924205108 1:241704200-241704222 AGGGGTGAGGTTGGGAAGGAAGG - Intronic
924865521 1:247975329-247975351 AAAGGTAAACATGAGAAAGAGGG - Intronic
1066346315 10:34590386-34590408 AAGGGAAAAGTTGGGAAGTAGGG - Intronic
1067792254 10:49297150-49297172 AAACGTAAGCTGGGGAAGGAAGG + Intergenic
1069146864 10:64903427-64903449 TAGTGAAAAATTGGGAAGGAAGG + Intergenic
1069943819 10:71972801-71972823 AAGGGGAAAAGGGGGAAGGAGGG - Intronic
1070605484 10:77895265-77895287 AAGGGAAATCCTGGGGAGGAAGG - Intronic
1072067021 10:91881188-91881210 AAAGGTAAACTTCACAAGGATGG - Intergenic
1072902883 10:99425175-99425197 AAAGGTAAACAAGGGAAGAAGGG + Intronic
1073058771 10:100720113-100720135 AAGGGTATAATTAGGAAGGGAGG + Intergenic
1073132728 10:101200687-101200709 AAGGCTAAAAGTGGGAAAGACGG + Intergenic
1073216254 10:101838392-101838414 AAAGCTAAACTGGGGAAGGTGGG - Intronic
1074580967 10:114719055-114719077 TAGGGTAAACCTGGCAAGAATGG + Intergenic
1074982011 10:118627265-118627287 CAGGGAAAACTTGGAAAGGCAGG + Intergenic
1075981449 10:126743726-126743748 AGTGGTAAACTTGGTAAGGCAGG + Intergenic
1076602777 10:131669775-131669797 CAGTGGAAACTTGGGAAGGCAGG + Intergenic
1077870296 11:6256962-6256984 AAGTGTTAACTAGGTAAGGAAGG + Intergenic
1078123595 11:8536095-8536117 AAGGGTGAACGTGGGGAGGAGGG + Intronic
1078151631 11:8764627-8764649 AGGGGTGTACTTGGGATGGAGGG - Intronic
1078322428 11:10348684-10348706 AAGGGGAACCTGGGGAAAGAGGG - Intronic
1079817213 11:25076632-25076654 AAGGGAAAAAGAGGGAAGGAAGG + Intronic
1080352046 11:31396533-31396555 AAGGGGAAACATAGGAAGCAGGG - Intronic
1080493301 11:32791472-32791494 CAAGGTAAACTTGGGAAATACGG - Intronic
1080816849 11:35766394-35766416 AAGGGTAAATTGGGAAAGGTAGG + Intronic
1084636677 11:70397908-70397930 AAGAGTAAACAAGGTAAGGAGGG - Intergenic
1085307424 11:75495902-75495924 AAAGGCAAACTGGGGAAGGCAGG - Intronic
1085583822 11:77681413-77681435 AAGGGGAAAGTAAGGAAGGAGGG - Intronic
1086892801 11:92277878-92277900 AAAGGTAAACTTGGGCAACATGG + Intergenic
1089269704 11:117293652-117293674 TATGGTAAACTTGGAAAGGAAGG - Intronic
1090320313 11:125837456-125837478 TAGGTTAAACTTGGGGAGGTGGG - Intronic
1090440141 11:126718583-126718605 GAGGGCAAACTGGGGAAGGAAGG + Intronic
1090649546 11:128794083-128794105 AAGGGGAAACTTGGTAGAGATGG - Intronic
1092878308 12:12867692-12867714 AAGGGTAAATTTGGGGCTGAGGG - Intergenic
1093772881 12:23037886-23037908 AGGAGCAAACTTAGGAAGGAAGG - Intergenic
1094053714 12:26247246-26247268 TAGGGCAATATTGGGAAGGATGG + Intronic
1094095125 12:26695056-26695078 AAGGGTAAAATTTTGAATGATGG + Intronic
1097374299 12:58822214-58822236 AAGGGTAGATTTGGGGAGAATGG - Intergenic
1098076532 12:66737985-66738007 AAGGATTCACGTGGGAAGGAGGG + Intronic
1098574363 12:72024264-72024286 AAGGGTAAATAAGGAAAGGATGG + Intronic
1100166189 12:91920774-91920796 GAGGGTGAAATTGGGGAGGAGGG - Intergenic
1100791181 12:98131896-98131918 ATGGTTAAACTTAGTAAGGAAGG - Intergenic
1101718296 12:107330341-107330363 AAGGGTGAATGTGGGAAGGCTGG + Intronic
1102190781 12:110986526-110986548 GAAGGTAAACTTGGAAAGGAAGG + Intergenic
1102190873 12:110987313-110987335 GAAGGTAAACTTGGAAAGGAAGG - Intergenic
1102773697 12:115500689-115500711 AAGGGGAGGTTTGGGAAGGAGGG - Intergenic
1106557458 13:30822377-30822399 AAGTGTGAACTTGTAAAGGAGGG + Intergenic
1107315683 13:39129202-39129224 AAGTGAAATCTTGTGAAGGAAGG + Intergenic
1110343517 13:74419410-74419432 GAGGGAAACCATGGGAAGGAAGG - Intergenic
1111651729 13:91099337-91099359 TAGGATAAACTTGGAAATGAAGG + Intergenic
1112858673 13:103803366-103803388 ATGGGTCAACTTTGGAATGAAGG + Intergenic
1114307573 14:21437564-21437586 GAGTATAAACTTGGGAGGGAGGG + Intronic
1114893897 14:26961487-26961509 GGGGGAAAAGTTGGGAAGGAAGG - Intergenic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1117088170 14:52222795-52222817 AAGGGAAAACTTGATAAGGAAGG - Intergenic
1117088723 14:52227862-52227884 AAAGGAAAACTTGATAAGGAAGG - Intergenic
1117730873 14:58720435-58720457 AAGGACTGACTTGGGAAGGAGGG + Intergenic
1118828547 14:69407351-69407373 AAGAGTGAAATTTGGAAGGAAGG - Intronic
1118843343 14:69528432-69528454 CAGGGGAGACTTGGGAAGCAGGG - Exonic
1119707664 14:76794950-76794972 AAGGATAAAAATGGAAAGGAGGG - Intronic
1121202533 14:92130790-92130812 AAAAGTAAACTTGGCAATGATGG + Intronic
1122159761 14:99774457-99774479 AAGGGTACACTCGGGAGGCATGG - Intronic
1124398081 15:29322779-29322801 AAGGGGAAAAGTGGGCAGGAAGG - Intronic
1125415515 15:39448210-39448232 AAGGCTAGACCAGGGAAGGATGG + Intergenic
1125570260 15:40711618-40711640 AATGCTAAATTTGGGAAGGAAGG + Intronic
1127251166 15:57239799-57239821 AAGAGTAGAGATGGGAAGGATGG + Intronic
1127418048 15:58776372-58776394 AAGATTACACTGGGGAAGGAGGG + Intronic
1127932027 15:63603293-63603315 AAGGGAAGACTTGATAAGGAAGG - Intergenic
1128408586 15:67369520-67369542 AAGGGGAAAGAAGGGAAGGAGGG + Intronic
1129814221 15:78537950-78537972 AAGGGAAAACTTGATAAGGAAGG + Intergenic
1129980627 15:79866259-79866281 AGGGGAAAACTTAGGAAAGAAGG - Intronic
1130157146 15:81360883-81360905 AAGGGTAGACTAGCCAAGGAAGG + Intronic
1130621482 15:85467348-85467370 AAGCGGAAAGGTGGGAAGGAGGG - Intronic
1131202531 15:90411786-90411808 AGTGGTAAACTAGGGATGGATGG + Intronic
1132263865 15:100449108-100449130 AATGGTATACTTGGGCAGTAGGG - Intronic
1133264712 16:4576098-4576120 AAGGATAGAGTTGGCAAGGATGG + Exonic
1133435745 16:5778155-5778177 AAGGATAAATTGGGGAAGGTGGG + Intergenic
1133526780 16:6613290-6613312 AAGGGTAAACTTGGGAAGGATGG + Intronic
1134153364 16:11822540-11822562 AAGGGAAAAAGTGGGCAGGAGGG - Intergenic
1134384214 16:13756906-13756928 AAGGGTAAACTTGAGGAGGGAGG - Intergenic
1135526620 16:23217950-23217972 AAGGGTGAAGTGGAGAAGGAGGG - Intergenic
1136039921 16:27570595-27570617 AAGGGAAAACTTGATAAAGAAGG + Intronic
1136997728 16:35202200-35202222 AGTGGGAAACTTGGGTAGGAGGG + Intergenic
1137826343 16:51499279-51499301 AGGAGTAAACTTGGGGAAGAGGG - Intergenic
1139646942 16:68338368-68338390 AGGGGTAGCCTTGGGAAGGTTGG + Intronic
1140756275 16:78070210-78070232 AAGGGAAAACTTGATAAGGAAGG - Intergenic
1140877383 16:79165106-79165128 TAGGGTAAACTTGATATGGAAGG + Intronic
1143286420 17:5793087-5793109 CAGGGTATACTTGGGTAGGAAGG + Intronic
1143868920 17:9944010-9944032 AAGTCCAAACTTGGGGAGGATGG + Intronic
1144497375 17:15757139-15757161 ATGGGGAATCTTGGGAAGGTTGG + Intergenic
1144629166 17:16861623-16861645 ATGGGGAATCTTGGGAAGGTTGG + Intergenic
1144652252 17:17014491-17014513 ATGGGGAATCTTGGGAAGGTTGG - Intergenic
1145160737 17:20572188-20572210 ATGGGGAATCTTGGGAAGGTTGG + Intergenic
1146399872 17:32494129-32494151 AGGGGAGAACCTGGGAAGGATGG + Exonic
1146748757 17:35356429-35356451 AAGGGTGAGATTGGGAAGGCAGG - Intronic
1146807382 17:35875747-35875769 GAGGGAAGACTTGGCAAGGAGGG - Intronic
1147739914 17:42665611-42665633 GAGGGTCATCTGGGGAAGGAAGG + Intronic
1148774799 17:50089285-50089307 AAGGGGACACTGGGGGAGGAGGG - Exonic
1149148934 17:53535791-53535813 ATGGGTAAACTGGGGAGGCAAGG + Intergenic
1149219834 17:54404009-54404031 AGAGATAAACTAGGGAAGGATGG - Intergenic
1149462076 17:56836988-56837010 AAGGAAAAACTGGGGGAGGAGGG - Intronic
1151692042 17:75692566-75692588 AAGGGAAGACTTGTGACGGAGGG + Intronic
1154389849 18:13927138-13927160 AAGGTTAAAAATGAGAAGGATGG + Intergenic
1157661187 18:49446648-49446670 AAGGTTAAAGTTGTGAAGAAGGG + Intronic
1159435898 18:68416495-68416517 TAGGGTGATTTTGGGAAGGAGGG - Intergenic
1165182647 19:33985909-33985931 AAAGGAAAACTTGGGAGGGTGGG - Intergenic
1165330961 19:35141053-35141075 GAGGGGTAAATTGGGAAGGAGGG - Intronic
1165717626 19:38056512-38056534 AGGGGTAAACTGACGAAGGATGG - Intronic
925761479 2:7188624-7188646 AATGGTTACCATGGGAAGGAGGG + Intergenic
926296187 2:11570628-11570650 AAGGGTAAAACTAGGGAGGAAGG - Intronic
926371631 2:12184696-12184718 AAGGGTAGACCTGGGTAAGAGGG + Intergenic
926681045 2:15664576-15664598 ATGCGTAAACATGGGCAGGAAGG + Intergenic
926776528 2:16428872-16428894 AAGGGTCAAATTTGGAGGGATGG + Intergenic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
927043822 2:19256769-19256791 AAAGGGAAATTTGGGATGGAGGG - Intergenic
927318119 2:21709640-21709662 AAGGGTAAAATGGGTAAGAAGGG + Intergenic
927684244 2:25159820-25159842 CCGGGGAAACTTGGGAAGCAGGG + Intergenic
927829831 2:26339920-26339942 ACGGGAAAACTTGATAAGGAAGG - Intronic
927992415 2:27457580-27457602 AAGGAAAAACGTGGGAAAGAAGG + Intronic
928250789 2:29677132-29677154 AAGGATAAAATAGGGAGGGAGGG - Intronic
928823176 2:35387785-35387807 CAAGGAAAATTTGGGAAGGATGG + Intergenic
929706842 2:44222498-44222520 AAGGGTAAAGTTGAGCAGGGGGG + Intronic
930032067 2:47064456-47064478 ATGGGGAAACGTGAGAAGGAAGG + Intronic
931001365 2:57787390-57787412 AAAGGTAAATTTGGAAAGGTTGG - Intergenic
933074073 2:77900607-77900629 AAGGGTAAAGTGGGGAGGCAAGG - Intergenic
933305169 2:80588621-80588643 AAGGATAAAATTAGGAAGCATGG - Intronic
935397955 2:102628495-102628517 ATGGGTAAATTTTGGAAGAACGG + Intronic
935933352 2:108154061-108154083 AAGGATAAACTTTGGAAGTCTGG - Intergenic
936162137 2:110091889-110091911 AAGAGGAAAATGGGGAAGGAAGG + Intronic
936182525 2:110279465-110279487 AAGAGGAAAATGGGGAAGGAAGG - Intergenic
936344351 2:111663825-111663847 GAGACTAAACTTTGGAAGGATGG - Intergenic
937080461 2:119136514-119136536 ATGGGTAAACAGGGGAAGGGCGG - Intergenic
937432201 2:121848445-121848467 AGGGTTAAACATGGGAAGGGAGG + Intergenic
939093257 2:137803137-137803159 AAGGGAAAGATTGGAAAGGAGGG - Intergenic
941654451 2:168127996-168128018 AAGGTTAGGCTTGGGAGGGAAGG + Intronic
941749297 2:169118553-169118575 AAGGGTGAAGATGGGCAGGAAGG - Intergenic
941983439 2:171485915-171485937 AAGGGTGAAGGTGGAAAGGAGGG + Intergenic
942476500 2:176330005-176330027 AAGGGTAGCCTTGGAAAAGACGG - Intronic
942893612 2:181021671-181021693 AAAAGAAAAGTTGGGAAGGAAGG - Intronic
944400452 2:199320023-199320045 TTGGGTAAAATTGGGAAGAAAGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944890193 2:204109535-204109557 AAGTGTAAAATTAAGAAGGAAGG + Intergenic
946192287 2:218013916-218013938 CAGGGCAAACTTGGGGAGAAGGG - Intergenic
947633027 2:231665982-231666004 AATGGAAAACTTCAGAAGGAAGG + Intergenic
1169401001 20:5280108-5280130 AATGGCAGACTTGGGTAGGAGGG + Intergenic
1171312779 20:24159049-24159071 AAGGGCAAAGATGGGAAGAAGGG - Intergenic
1171568561 20:26221434-26221456 AAGGGTACAGTAGTGAAGGAAGG - Intergenic
1172223179 20:33287505-33287527 AAGGATAACCTAGGGATGGAGGG + Intronic
1172351941 20:34249928-34249950 AAGCATATACTTGGGAAGAAAGG - Intronic
1172401134 20:34652372-34652394 ATTGATAAACTTGGGAATGATGG - Intronic
1173209346 20:41020055-41020077 AATGATAACCTGGGGAAGGAGGG + Intergenic
1174963073 20:55179997-55180019 AAGGGTAGACTTGGGCTGAAAGG - Intergenic
1175126017 20:56752060-56752082 AAAGGTTACCTAGGGAAGGAAGG + Intergenic
1178686613 21:34716271-34716293 AAGGGAAAACTTGCTAAGGTAGG - Intronic
1178712629 21:34932704-34932726 AGGGGTAAAATTTAGAAGGAAGG - Intronic
1178753822 21:35328840-35328862 GAGGGTAAAATAAGGAAGGAGGG - Intronic
1179047503 21:37859953-37859975 CAGGGTAAAGGTGGGAAAGAGGG - Intronic
1180016703 21:45091193-45091215 TAGGGGAAAATTGGCAAGGACGG - Intronic
1180282360 22:10714210-10714232 AAGGGTACAGTAGTGAAGGAAGG + Intergenic
1181457770 22:23069634-23069656 AAGGGTGGCCTTGGGAGGGAAGG - Intronic
1181560079 22:23694906-23694928 AAGGGTAAATTTGGGAATCAGGG - Intronic
1182048514 22:27295785-27295807 AAGGATAAAAGTGGGAAAGAAGG + Intergenic
1182248525 22:28980479-28980501 AAGGGATATTTTGGGAAGGAAGG - Intronic
1182519783 22:30878809-30878831 ATGGGAAAACCTGGGGAGGAAGG + Intronic
1182933569 22:34197863-34197885 GAGGGCAAATTTGGGATGGATGG - Intergenic
1183174604 22:36213522-36213544 AGGGGAAAAATTGGGCAGGAGGG + Intergenic
1183473772 22:38024589-38024611 AGGGACAAACATGGGAAGGACGG + Intronic
950323683 3:12083519-12083541 AAGGAGAAACTTTGGGAGGAAGG - Intronic
951254848 3:20436951-20436973 AAGGGTAAAGTTGAAATGGAAGG + Intergenic
951654596 3:24991493-24991515 AAGAGTAAGATTGGAAAGGAAGG - Intergenic
952331020 3:32364629-32364651 AAGTGAACATTTGGGAAGGATGG - Intronic
952388274 3:32858953-32858975 AAGGGTAAACTTCACAAAGATGG - Intronic
952924271 3:38309729-38309751 AAGGTTAACCTTGGGCAGGTGGG + Intronic
954719457 3:52548794-52548816 AAAGGTAAACATGTGAAGAAAGG + Intronic
954875743 3:53802114-53802136 AAGGCATAACATGGGAAGGAGGG - Intronic
955134779 3:56205860-56205882 AAGGTTAAATTTGGCAAGAAAGG - Intronic
955618644 3:60836801-60836823 AAGGGAAAACTTGATAAGGAAGG + Intronic
956019954 3:64923615-64923637 GTGGGTAACTTTGGGAAGGAAGG + Intergenic
956904122 3:73748062-73748084 AAGAGTAAACTCTGGAACGAGGG + Intergenic
957036448 3:75297811-75297833 TAGCATACACTTGGGAAGGAAGG + Intergenic
957110283 3:75946914-75946936 AAGGGTACAGTAGTGAAGGAAGG + Intronic
958738461 3:98038554-98038576 AAGAGAAAATTTGGAAAGGATGG + Intergenic
959214703 3:103437017-103437039 TGGGGTACTCTTGGGAAGGAAGG - Intergenic
959584359 3:108012338-108012360 AAGAGTAAAGGAGGGAAGGAGGG + Intergenic
961224574 3:125230076-125230098 TAGGGTGAGCTTGGGAAGGAAGG - Exonic
961396788 3:126599203-126599225 AAGGATAGAGGTGGGAAGGAAGG - Intronic
962338166 3:134556439-134556461 AAGGGGGAAAGTGGGAAGGAGGG + Intronic
962626845 3:137234197-137234219 AAGGCTTAACTGGGGGAGGATGG - Intergenic
964577287 3:158186794-158186816 AAAGGTAGAATTGGGAAGAAGGG - Intronic
964876383 3:161372560-161372582 GAGGGCAAACTGGGGAAAGAAGG + Exonic
965383838 3:168022566-168022588 AAGGGAAGACCTGGGAACGATGG + Intronic
965702565 3:171473063-171473085 AAGGCACAACTTGAGAAGGATGG - Intergenic
966593895 3:181710233-181710255 AAGGGTAGACCAGGGGAGGAGGG + Intergenic
967552399 3:190811889-190811911 AAAGGTACACTGGGCAAGGAGGG + Intergenic
968293864 3:197558510-197558532 AAGAGTCAAATAGGGAAGGAGGG - Intronic
968496171 4:917646-917668 AAGGGTTACCGTGGGGAGGAGGG + Intronic
969841109 4:9882727-9882749 AAGGATTAGTTTGGGAAGGAAGG + Intronic
969892644 4:10274019-10274041 AAGGGAAAACTTGATAGGGAAGG + Intergenic
970513851 4:16807683-16807705 AAGGGTACACCAGGGCAGGAAGG - Intronic
970914965 4:21321918-21321940 AAGGAAAAAGGTGGGAAGGAGGG + Intronic
975424083 4:74206225-74206247 AAGGGAAAACTTGATAAAGAAGG + Intronic
975794981 4:77997670-77997692 AAATGGAAACTAGGGAAGGATGG - Intergenic
976331701 4:83839197-83839219 AAGGCTAAACTTGGAAATAAGGG + Intergenic
978013477 4:103716152-103716174 AATGGCAAATTGGGGAAGGATGG + Intronic
978879673 4:113686383-113686405 AAGGGAAAACTTGGGAATATAGG - Intronic
981650833 4:147056504-147056526 AGGGGTTGTCTTGGGAAGGAAGG + Intergenic
981737734 4:147970450-147970472 AAGGTTAAACTGGGGAGGAAAGG + Intronic
982213091 4:153056937-153056959 AAGGCTAAAGTTGGGCAGTAGGG - Intergenic
982596963 4:157398118-157398140 ATAGGTAAACTTGGGAAGGTAGG + Intergenic
983747071 4:171214926-171214948 AAGGGAAAACTTGGAAGGGAGGG + Intergenic
983916288 4:173295509-173295531 AAGGCTAAACTTGGACAGGTAGG + Exonic
985355370 4:189113623-189113645 AAGGGTACACATGCGTAGGAAGG - Intergenic
986336465 5:6759276-6759298 GAGGGTTAACTTGGGAGGGGCGG + Intergenic
986693258 5:10331284-10331306 GAGAGTATACTTGGGAGGGAAGG - Intergenic
987525514 5:19044941-19044963 ATGGGTAAACTGGGAGAGGAGGG + Intergenic
988496762 5:31751912-31751934 ATGGTTAAACTTGGAAAGGGAGG - Intronic
989152838 5:38317339-38317361 AAGGGTGAAGATGGGATGGAGGG + Intronic
991603113 5:68373133-68373155 ATGGGAAAACTTGATAAGGAAGG + Intergenic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
994025181 5:95073648-95073670 AAAGGTAAAGTTGAGAGGGAAGG + Intronic
994059503 5:95458591-95458613 AGGAGGAAACTTGGGAAGAAGGG - Intergenic
996074883 5:119180562-119180584 AAAGGTAAACTTGGCAAATAAGG - Intronic
998631773 5:143906597-143906619 ACGAGTACACTTGGGCAGGAGGG - Intergenic
999323238 5:150627311-150627333 GAGGGTCAACTGGGGAAGGGTGG + Intronic
1000263946 5:159616891-159616913 AAGGCTCCACTGGGGAAGGATGG + Intergenic
1001141034 5:169144263-169144285 CAAGGTAAACATGGGAGGGAAGG - Intronic
1002004203 5:176218714-176218736 TATGGTAAACTTAGGAAGGCAGG - Intergenic
1002038462 5:176492181-176492203 AAGAGCAAACCTGGGGAGGAAGG - Exonic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002222171 5:177691917-177691939 TATGGTAAACTTAGGAAGGCAGG + Intergenic
1002340225 5:178511603-178511625 GAGGTTAAACTCTGGAAGGAAGG + Intronic
1002803427 6:548989-549011 AAGGTGAACCATGGGAAGGAAGG + Intronic
1002905874 6:1448698-1448720 AAGGCAAGACTTGGGAATGACGG - Intergenic
1003988316 6:11460311-11460333 AATGCTAATCTTGGAAAGGACGG + Intergenic
1004331860 6:14728979-14729001 AAGGAAAAAAATGGGAAGGAGGG + Intergenic
1004745771 6:18507673-18507695 AATCAGAAACTTGGGAAGGAGGG + Intergenic
1007708211 6:43804467-43804489 AAGGGGACACTTGGGGAGGTGGG + Intergenic
1008918676 6:56818977-56818999 AAGGGTAAAGGTGGGAAAAATGG - Intronic
1008974392 6:57407940-57407962 AGAGGGAAACTTGGGAAGGTTGG + Intronic
1008975876 6:57426200-57426222 AAGGTTATATTTGGGAAGGTGGG - Intronic
1009163281 6:60309459-60309481 AGAGGGAAACTTGGGAAGGTTGG + Intergenic
1009164403 6:60323323-60323345 AAGGTTATATTTGGGAAGGTGGG - Intergenic
1010328773 6:74596555-74596577 AAGGGAAAAATTGGGAAACATGG + Intergenic
1011954394 6:93007813-93007835 AAGGGTAAAATTGGGACAGAAGG - Intergenic
1012910970 6:105117632-105117654 AAGTGTTAACATGGGAAGAAGGG - Intronic
1013765178 6:113566041-113566063 ATGGGTAAATTTGAGAAGAATGG + Intergenic
1014215977 6:118753122-118753144 AATGGTGGACTTGGGAAGGAAGG - Intergenic
1014755521 6:125298443-125298465 ATTGGTAAACATGTGAAGGAAGG - Intronic
1015376314 6:132513952-132513974 AAAGGTAAACTAGAGAATGAAGG + Intergenic
1016021548 6:139241372-139241394 AAAGGAGAAATTGGGAAGGAAGG + Exonic
1017462381 6:154663481-154663503 AATGGAAAATATGGGAAGGAAGG - Intergenic
1018429433 6:163711936-163711958 CAGGCTGAACTTGGGAACGAAGG + Intergenic
1019046124 6:169147615-169147637 CAAGGTTAGCTTGGGAAGGATGG - Intergenic
1019233494 6:170588077-170588099 AAGAGAAAATTTGGGGAGGAAGG + Intergenic
1021144625 7:17069806-17069828 AAAGGTATGCTTGGGAAGAATGG + Intergenic
1021355952 7:19653433-19653455 AGTGGTAAACATGGAAAGGAAGG + Intergenic
1021930355 7:25574991-25575013 AAGGGAAAACTTGGCAGGCATGG + Intergenic
1022315548 7:29241663-29241685 AAGGGCAAAGCTGGGCAGGAGGG + Intronic
1022868147 7:34444485-34444507 GAGGATACACTGGGGAAGGAAGG + Intergenic
1022951390 7:35341590-35341612 AAGGTTAAACTTAGGGAGGAAGG + Intergenic
1023073370 7:36459534-36459556 AAAGGAAAACTTGATAAGGAAGG - Intergenic
1025203081 7:56974195-56974217 AAGGGTGGAGTTGGGGAGGAGGG - Intergenic
1025226825 7:57172743-57172765 AAGAGTAAAGTTAAGAAGGATGG - Intergenic
1025297395 7:57786925-57786947 AAGGGTAAACCTGGGGTGGGGGG - Intergenic
1025668863 7:63602731-63602753 AAGGGTGGAGTTGGGGAGGAGGG + Intergenic
1028215758 7:88130837-88130859 AAGGGAAGATTTGGGAAGTATGG - Intronic
1029156717 7:98522417-98522439 GCTGGTAAAGTTGGGAAGGAGGG + Intergenic
1029414672 7:100435558-100435580 AAGGTTACACTTTGGGAGGAAGG + Intronic
1030133079 7:106219576-106219598 AAGTGAAATCTTGGGGAGGAAGG - Intergenic
1030557729 7:111047870-111047892 AAGGGAAAGCTTGATAAGGAAGG - Intronic
1031000258 7:116406979-116407001 AAAGGAAAACTTGGGAAAGCAGG + Intronic
1031351668 7:120739632-120739654 AAGAATAAATTTAGGAAGGAAGG + Intronic
1032092699 7:128919284-128919306 AAGTGTGAAACTGGGAAGGATGG + Intergenic
1032727389 7:134603501-134603523 ATGGGAAAACTTGGTAAGGAAGG + Intergenic
1032994775 7:137432815-137432837 CAGGGAAATATTGGGAAGGAAGG - Intronic
1033734905 7:144212509-144212531 AAGGGGAAGCCTGGGAATGAAGG - Intergenic
1033748150 7:144338460-144338482 AAGGGGAAGCCTGGGAATGAAGG + Intergenic
1034435881 7:151062610-151062632 AGGGGTGAACCTGAGAAGGAGGG - Intronic
1036069487 8:5424866-5424888 AAGGGTAAAGTCAGAAAGGAGGG + Intergenic
1037498838 8:19466108-19466130 AAGGGTAAATTTTGAAAGGGGGG + Intronic
1037680286 8:21091738-21091760 AAGAGTAACCCAGGGAAGGAGGG + Intergenic
1038526964 8:28282984-28283006 AAGGTTAAACTTAGTGAGGAAGG + Intergenic
1038667502 8:29552591-29552613 AGGGGTAATATTGGAAAGGAGGG - Intergenic
1039846575 8:41329900-41329922 AAGGGGAAAGGTGGGAAGGTGGG - Intergenic
1041387013 8:57314871-57314893 AAGATTAAACTTGGTCAGGAGGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041749671 8:61246468-61246490 AATGTAAAAGTTGGGAAGGAAGG - Intronic
1043444906 8:80309671-80309693 AAGTGTAGAGTTGGAAAGGAAGG - Intergenic
1043540376 8:81255662-81255684 AAGGAAAAACTTGGGGAGGAAGG + Intergenic
1043657174 8:82683465-82683487 ATGGGTAAAGTTAGGAAAGATGG - Intergenic
1044165639 8:88980214-88980236 AAGCGTATGCATGGGAAGGATGG + Intergenic
1044855419 8:96470119-96470141 AAGGTGGAACTTGGGAGGGATGG + Intergenic
1045116479 8:98988351-98988373 AAGGGTTAAGTGGAGAAGGATGG + Intergenic
1046921904 8:119739491-119739513 AAGGGAAAACTGGGGAAGCAAGG + Intronic
1047709344 8:127535664-127535686 AAGAGGAAACTAGGAAAGGATGG - Intergenic
1047979993 8:130171208-130171230 AAGGCTGAAGTGGGGAAGGATGG - Intronic
1048273860 8:133050974-133050996 AAAGGTAGGCTTGGGAGGGAGGG + Intronic
1048494105 8:134920922-134920944 AAGGTTTACCTTGGGGAGGAAGG + Intergenic
1048643296 8:136388502-136388524 AAAGGTAGTCGTGGGAAGGATGG + Intergenic
1048667701 8:136681806-136681828 AATGGTAGACTTGAGAAGTAAGG + Intergenic
1049512691 8:143037725-143037747 AGAGGTACAGTTGGGAAGGATGG + Intergenic
1049833571 8:144718234-144718256 TAGGATGTACTTGGGAAGGAAGG - Intergenic
1050539331 9:6656700-6656722 AAGTGTGAAGTGGGGAAGGAGGG + Intergenic
1051365017 9:16315858-16315880 AAGGGTCATTCTGGGAAGGACGG + Intergenic
1052372252 9:27678372-27678394 AAGGCAAAATTTGGAAAGGAAGG + Intergenic
1053796215 9:41729110-41729132 AAGGATAAACCTGGGATGGGGGG + Intergenic
1054184620 9:61941180-61941202 AAGGATAAACCTGGGATGGGGGG + Intergenic
1054653887 9:67647317-67647339 AAGGATAAACCTGGGATGGGGGG - Intergenic
1056274299 9:84978176-84978198 AAGATTAAACTTAGTAAGGAAGG + Intronic
1057560923 9:96127189-96127211 AGGGACAAAGTTGGGAAGGAGGG + Intergenic
1059408924 9:114119813-114119835 AAGGGTTAACCTGGGTGGGAGGG + Intergenic
1060439364 9:123624705-123624727 AAGAGAAGACTTGGCAAGGAAGG - Intronic
1061647171 9:132013396-132013418 GGTGTTAAACTTGGGAAGGAGGG + Intronic
1186376415 X:9006806-9006828 AAGGGTAGAGGTGGGATGGAGGG - Intergenic
1186383516 X:9086091-9086113 AAGGATATGCTTAGGAAGGAAGG - Intronic
1186644911 X:11496030-11496052 AAGGCTCAACTGGTGAAGGAAGG - Intronic
1187297184 X:18013205-18013227 GAGGGTGAACTTGGGAAAGCTGG - Intergenic
1187717127 X:22113873-22113895 ATGGGGAAAATTGGGAAGAAAGG + Intronic
1188591349 X:31839909-31839931 AAGAGTAAACTTGGAAAGGCTGG + Intronic
1189093205 X:38109590-38109612 GAGGGTAAATTTAGGAAGCAGGG + Intronic
1189146927 X:38665055-38665077 AAGGGAAACCTTGGCAAGGTGGG + Intronic
1190755029 X:53394301-53394323 ATGGGTAAATATGGGGAGGAAGG + Intronic
1191669081 X:63732350-63732372 ATGGGAAAAATTGAGAAGGAGGG - Intronic
1192342278 X:70273979-70274001 AAGGGTTAAGTAGGGAGGGAGGG - Intronic
1192554435 X:72078636-72078658 GAGGGTGACCTTGGCAAGGATGG - Intergenic
1196203107 X:112908580-112908602 AAGGGAAAACTTGGTGTGGATGG + Intergenic
1197528715 X:127595413-127595435 TATGGTAAACATGGAAAGGATGG - Intergenic
1197645565 X:129012892-129012914 AATGGAAAAGTTGGGAAGGCTGG + Intergenic
1199818368 X:151420498-151420520 GAGGGTAAAGTTGGGTAGTAAGG + Intergenic