ID: 1133528639

View in Genome Browser
Species Human (GRCh38)
Location 16:6631759-6631781
Sequence TAGGGAGGAGGAGCAGCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 473}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133528639 Original CRISPR TAGGGAGGAGGAGCAGCCAC CGG Intronic
900040074 1:453320-453342 GAGGGAGCAGAAACAGCCACAGG + Intergenic
900061506 1:688296-688318 GAGGGAGCAGAAACAGCCACAGG + Intergenic
900380183 1:2380065-2380087 AAGGAAGGAGGAGCTGGCACAGG + Intronic
900764494 1:4494790-4494812 AAGGGAGGAGGAGGGGCCATGGG - Intergenic
901031167 1:6307786-6307808 CAGGCAGAAGGAACAGCCACAGG + Intronic
901031219 1:6308042-6308064 CAGGCAGAAGGAACAGCCACAGG + Intronic
901031233 1:6308116-6308138 CAGGCAGAAGGAACAGCCACAGG + Intronic
901031265 1:6308268-6308290 CAGGCAGAAGGAACAGCCACAGG + Intronic
901031280 1:6308342-6308364 CAGGCAGAAGGAACAGCCACAGG + Intronic
901031318 1:6308533-6308555 CAGGCAGAAGGAACAGCCACAGG + Intronic
901035876 1:6335739-6335761 CGGGGAGGAGGGGCAGGCACAGG - Intronic
901211214 1:7527056-7527078 CAGGGGAGAGGAGCAGCCGCTGG - Intronic
901518294 1:9764152-9764174 GGAGGAGGAGGAGCAACCACAGG + Intronic
901684116 1:10934334-10934356 TAGTGAGGCTGAGCAGTCACGGG + Intergenic
901740119 1:11336131-11336153 GCAGGAGGAGGTGCAGCCACAGG + Intergenic
901827884 1:11874439-11874461 CAGGGAGGAGAGGCAGCCAGAGG - Intergenic
902219479 1:14955810-14955832 GAGGGAGGCGGGGCAGGCACAGG - Intronic
902343818 1:15801225-15801247 TATAGAGGAGGGGCAGTCACTGG + Intergenic
902661836 1:17909751-17909773 CATGGAGGAGGGGCGGCCACTGG + Intergenic
902891681 1:19448791-19448813 GAGGGGGGAGGAGGAGCAACAGG - Intronic
903067665 1:20709831-20709853 GAGGGAGGAGGAACAGTCAGGGG + Intronic
903140962 1:21338979-21339001 TAAGCAGGAGGAGCAGCCCCTGG - Intronic
903548214 1:24140478-24140500 TAGGGAGGAGGAGAAGAGAGAGG + Intronic
904358205 1:29955091-29955113 TAGGGAGAGGGAGCATCTACTGG - Intergenic
905316958 1:37088652-37088674 TAGGGAGGGGGCACAGCCTCAGG + Intergenic
905801871 1:40849393-40849415 TAGGGGGAAGGAGCAGATACAGG + Intergenic
906079045 1:43071561-43071583 TTGGGAGAAGCAGCAGCCACAGG + Intergenic
906533642 1:46539056-46539078 TTTGGGGGAGGAGCAGACACTGG + Intergenic
906612357 1:47212265-47212287 GAGGGAGGATGAGCATCCATGGG + Intergenic
906945485 1:50290862-50290884 AATGGAGGAGGAGCAGGCAGGGG + Intergenic
907705531 1:56829162-56829184 CAGGGAGGAGAAGGAGACACAGG - Intergenic
907880928 1:58548707-58548729 AAGGGCAGAGGAGCAGCCAAGGG - Intergenic
909475116 1:76073638-76073660 TAGAGAGCAGGAGTAACCACAGG - Intergenic
912384607 1:109265041-109265063 CAGAGAGAAGCAGCAGCCACTGG - Intronic
913230947 1:116740543-116740565 GAAGGAGGAGGAGAAGCCCCAGG - Intergenic
914825657 1:151136684-151136706 TGAGGAGGTGGGGCAGCCACTGG + Intronic
915476590 1:156156195-156156217 TAGAGAGGAGAGGCAGCCAGAGG - Intronic
917738811 1:177944155-177944177 GAGGGAGGGTGAGCAGACACTGG + Intronic
917789782 1:178492186-178492208 GAGGCAGGAGGATCAGCCACCGG + Intergenic
918413109 1:184281197-184281219 TAAGGAGGAGGAGCAGAAAGAGG - Intergenic
919910109 1:202105999-202106021 CAGGGAGGTGGAGAAGCCGCAGG + Intergenic
919922420 1:202174468-202174490 TTGGCAGGAGGAGCAGGGACTGG - Intergenic
920112938 1:203599820-203599842 CAGGGAGGAGAAGCAGGAACTGG - Intergenic
920342602 1:205284831-205284853 GAGGGAGCAGGAGCAGACAATGG + Intergenic
920525029 1:206660003-206660025 TAGAAAGGAGAAGCAGCCACAGG - Intronic
920850240 1:209623575-209623597 GCGGGAGGAGGAGGAGGCACCGG - Exonic
920991788 1:210946683-210946705 AAGGCAGGAGGAGCAGGCAGGGG - Intronic
921183647 1:212651940-212651962 AAGGGAAGGGGAGCAGCCACTGG - Intergenic
922724954 1:227918361-227918383 TGGGGAGAAGGAGCACCCTCAGG - Intergenic
922749197 1:228062823-228062845 TAGGGAGGTGGATGAGGCACAGG - Intergenic
922974452 1:229772099-229772121 TCTGGCTGAGGAGCAGCCACAGG + Intergenic
924466179 1:244301067-244301089 TAGGGAGAAGGTGAAGCCAAGGG - Intergenic
1062941074 10:1421953-1421975 TACAGAGGAGAAGCAGCCCCAGG + Intronic
1066436526 10:35401048-35401070 TAGGGTGGAGGCCCAGCAACTGG + Intronic
1066507919 10:36064914-36064936 AAGGGAGAAGGAGTAGCCAGGGG - Intergenic
1067180239 10:43979816-43979838 GAGGGTGGAGGAGCAGCCCCTGG + Intergenic
1067440902 10:46308773-46308795 GAGGGTGGAGGTGCAGGCACAGG - Intronic
1067750680 10:48969261-48969283 CAGGGAGCAGGGGCAGCCTCAGG + Intronic
1069775568 10:70925341-70925363 GAGACAGGGGGAGCAGCCACAGG + Intergenic
1070768980 10:79071288-79071310 CAGGGAGGAGGAGTCGGCACTGG - Intronic
1072334201 10:94383158-94383180 TAGGGAGGAGGAGAAGTAAATGG - Intergenic
1073636155 10:105200848-105200870 TATGGAGGTGGAGCAGAAACGGG + Intronic
1074776500 10:116771467-116771489 GAGGAAGGAAGAGAAGCCACTGG + Intergenic
1076739746 10:132477395-132477417 CAGGAAGGAGGAGCAGCCTCTGG - Intergenic
1076806325 10:132860934-132860956 GTGCGAGGAGGAGCAGGCACTGG + Exonic
1076966298 11:89227-89249 GAGGGAGCAGAAACAGCCACAGG + Intergenic
1077102826 11:829745-829767 CAGGGAGGAGGGGCAGCGCCGGG + Intronic
1077362326 11:2146173-2146195 AGGGGATGGGGAGCAGCCACAGG - Intronic
1077563255 11:3279362-3279384 TGGGGAGGAGGAGGAGCATCAGG - Intergenic
1077569148 11:3325178-3325200 TGGGGAGGAGGAGGAGCATCAGG - Intergenic
1077696078 11:4393715-4393737 GAGGGAGGAGGAGGAGCCGTGGG + Intergenic
1077982209 11:7311557-7311579 TCTGGAGGAGGAGCATCCAGTGG + Intronic
1078802337 11:14659672-14659694 TAGGGAGGAACAGCACACACTGG - Intronic
1081622633 11:44628024-44628046 GAGGGAGGAGAAATAGCCACAGG + Intergenic
1081898067 11:46604182-46604204 TAGGAAGGAGGTGAAGGCACTGG + Intronic
1082772248 11:57217179-57217201 TGGGGAGGAGGGGAAGGCACAGG - Intergenic
1083729681 11:64646027-64646049 TAGGAAGGAGGAGTAGCCCTGGG + Intronic
1084274219 11:68043461-68043483 CAGGGAGCTGGAGCAGCCGCTGG + Exonic
1084668828 11:70593083-70593105 CAGGCAGCAGGGGCAGCCACAGG - Intronic
1084764140 11:71296679-71296701 TGGGGAGGAGGTGGAGCAACAGG + Intergenic
1085127370 11:74010957-74010979 AAGGGAAGAGAGGCAGCCACTGG + Intergenic
1085344596 11:75760049-75760071 TAGGGAGGAGGAGCTGCCTCAGG - Intronic
1085709052 11:78812647-78812669 CAGGCAGGAGGCTCAGCCACTGG - Intronic
1088599428 11:111461949-111461971 ACAGGAGGAGGAGCAGCTACTGG + Intergenic
1089610106 11:119664286-119664308 CCGGGAGGAGGAGCAGCATCTGG + Exonic
1090299936 11:125626345-125626367 TTGGGAGGAGGCGCTGCCGCAGG + Intronic
1091335478 11:134762765-134762787 TGGGGAGGAAGCGCAGCCCCCGG + Intergenic
1091741516 12:2963276-2963298 GAAGGAGAAGGAGGAGCCACAGG - Intronic
1092245830 12:6863767-6863789 GAGGGAGGAGGAGCAAACAGTGG + Intronic
1092307945 12:7321004-7321026 TGGGGAGGAGGAGGTGCTACTGG - Intronic
1093561969 12:20552507-20552529 GAGGGAGGAGGAGGAGCAGCAGG + Intronic
1093724959 12:22494533-22494555 CAGGGAGGAGGATCAGCAAAAGG + Intronic
1093966755 12:25335856-25335878 AAGGGAGGATAAGTAGCCACTGG + Intergenic
1096430243 12:51537324-51537346 CAGGGAGGAGGAGCGGCACCTGG - Intergenic
1096446693 12:51699476-51699498 TGGGGAGGAGTAGCAGCCAGTGG + Intronic
1096514847 12:52150102-52150124 TCAGGAGGGGGTGCAGCCACAGG - Intergenic
1096654072 12:53077676-53077698 CAGGCAGGAAGGGCAGCCACAGG + Intronic
1097221929 12:57456170-57456192 TGGGGAGCACGTGCAGCCACAGG - Exonic
1097971884 12:65641900-65641922 TAAGGTGGAGGAGCAGCAAGAGG + Intergenic
1099925040 12:89006946-89006968 TAGGGAGGAGGGACAGCCATTGG + Intergenic
1101021844 12:100560852-100560874 GAGTGAGGAGGAGAAGCCACAGG + Intronic
1102255063 12:111410372-111410394 TGGGGAGGAGGTTCACCCACAGG + Intronic
1103007742 12:117435550-117435572 TAGGGAGGAGGATCTGGCTCAGG - Intronic
1103237529 12:119385801-119385823 CACGGAGGGGGAGCAGCGACTGG - Intronic
1103904707 12:124321410-124321432 CAGGGAGGAGGGGCATCCTCAGG - Intergenic
1103979516 12:124727414-124727436 CAGGGAGGAGGTTCAGCAACCGG + Intergenic
1104730493 12:131102980-131103002 GAGAGAGGAGGGGCAGTCACAGG - Intronic
1104769600 12:131352834-131352856 AAGGAAGGAGGAGCAGCAACTGG - Intergenic
1104878499 12:132053311-132053333 CAGGAAGGAAGAGGAGCCACTGG - Intronic
1104931381 12:132341176-132341198 GAGGAGGGAGGACCAGCCACAGG + Intergenic
1104981953 12:132577177-132577199 TGGGGAGGAGCAGCAGCCCCAGG - Intronic
1105927288 13:25019048-25019070 TAGGGCTGAGGAGCCGCCAGGGG + Intergenic
1106005468 13:25766029-25766051 TAAGGAGGAGTCGCAGCCTCAGG + Intronic
1106032695 13:26017193-26017215 TAGGACTGAGGAGCAGCCCCGGG + Intronic
1109132795 13:58610245-58610267 TTAGGAGGAGGAGGAGCCAGGGG + Intergenic
1111196815 13:84885875-84885897 TAGGGAGTAAGAGCAGAGACTGG + Intergenic
1112048067 13:95617315-95617337 TATGGAGAAGGAGTAGCCTCTGG + Intronic
1112439027 13:99412087-99412109 TGGTGAGGAAGAGGAGCCACGGG - Intergenic
1114728876 14:24969278-24969300 TGGGGATGAGTAGCAGCCAAGGG + Intronic
1115769275 14:36654205-36654227 TAGGCAGGAGGAGCACTGACTGG + Intergenic
1116386888 14:44341983-44342005 CAGGGAGGAGGAGCATACCCGGG + Intergenic
1116430293 14:44838628-44838650 TATGGAGGAGAAGCATCCAGAGG - Intergenic
1118631132 14:67704247-67704269 GAAGGAGGAGGAGCAGCTAGAGG + Intronic
1118720712 14:68591784-68591806 TAGGGATCTGGAGCAGCCACTGG + Intronic
1118922975 14:70166937-70166959 CATAGAGGAGGAGCAGCCAGAGG - Exonic
1119171259 14:72537908-72537930 AAGGGAGGATCTGCAGCCACAGG - Intronic
1119913302 14:78371241-78371263 TAGAGAGGAGAAGAAGCAACTGG + Intronic
1120125630 14:80739081-80739103 AAGGGATGAGAAGTAGCCACTGG - Intronic
1120438131 14:84504202-84504224 TAGGGTGGAGGAGCAGAGGCTGG + Intergenic
1120816048 14:88859483-88859505 TAGAGGGGAGCAGCAGACACTGG + Intronic
1120887282 14:89461731-89461753 TAGTCAGGAGGAGCATCCAGGGG + Intronic
1121413387 14:93762861-93762883 TGGGGTGGAGGAGCAGCAAGAGG - Intronic
1121535226 14:94686438-94686460 GAGGGAGGAAGAGGAGCCCCAGG - Intergenic
1122286374 14:100655058-100655080 TGCAGAGGGGGAGCAGCCACAGG + Intergenic
1122529915 14:102418388-102418410 GAGGGAGGAGCAGGAGACACAGG + Intronic
1122750405 14:103928620-103928642 CAGGGAGGAGGTGCAGCGCCAGG + Exonic
1122771756 14:104100834-104100856 CAGGGAGAAGGAGCAGCAAGAGG + Intronic
1123038197 14:105479774-105479796 ATTGGAGGAGGGGCAGCCACGGG + Intronic
1123068331 14:105629106-105629128 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1123072340 14:105647911-105647933 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1123092350 14:105747430-105747452 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1123097926 14:105775131-105775153 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1123701719 15:22918929-22918951 GGGCGAGGAGGAGCAGCCCCCGG - Intronic
1123762187 15:23441628-23441650 GAGGCAGGAGGAGGAGCTACGGG - Exonic
1123981909 15:25612491-25612513 CAGGAAGGAGGAGAAGCCTCAGG - Intergenic
1124167137 15:27338314-27338336 CAGGGAGAAGGAGCAACCACAGG - Intronic
1124333956 15:28843386-28843408 GAGGCAGGAGGAGGAGCTACGGG - Intergenic
1124369740 15:29097358-29097380 GAGGGAGGAGGGCCAGCCCCCGG - Intronic
1124648405 15:31456879-31456901 TAGGGAGGAGGAGCAGAGGAGGG - Intergenic
1125094146 15:35831521-35831543 GAGGGAGGAGGTGCACCCAATGG + Intergenic
1125629648 15:41136696-41136718 CAGGTAGGTGGAGGAGCCACAGG - Intergenic
1127328663 15:57918375-57918397 TAGGGAGCACGAACAGGCACAGG - Intergenic
1127698555 15:61474997-61475019 AAGGGGGAAGGAGAAGCCACAGG + Intergenic
1128262332 15:66241154-66241176 CTGGGAGGAGGAGCAGCTGCGGG - Intronic
1128427751 15:67559403-67559425 TAGAGAGGAGAAGCAGCCTCAGG - Intronic
1128874425 15:71190626-71190648 TAGAAAGGAGAAGCAGCCAAAGG + Intronic
1129117226 15:73371168-73371190 GACAGAGGAGGAGCAGCCCCAGG + Intergenic
1129665742 15:77578521-77578543 AGGGGAGGGGGAGCAGGCACTGG - Intergenic
1129738623 15:77979138-77979160 TAGGGGCGAGCAGCAGCCCCAGG - Intergenic
1129847449 15:78774476-78774498 TAGGGGCGAGCAGCAGCCCCAGG + Intronic
1130254454 15:82319436-82319458 TAGGGGCGAGCAGCAGCCCCAGG - Intergenic
1130600511 15:85270534-85270556 TAGGGGCGAGCAGCAGCCCCAGG + Intergenic
1130699478 15:86164274-86164296 TAGGGAGGAGGAAATGACACTGG + Intronic
1131116633 15:89799994-89800016 GAGGGAGGAGGGGGACCCACAGG - Intronic
1131400596 15:92122508-92122530 TGGGGAGGATGTGGAGCCACTGG + Intronic
1132441832 15:101874298-101874320 GAGGGAGCAGAAACAGCCACAGG - Intergenic
1133002402 16:2857994-2858016 GAGGAGGGAGGAGCAGCCTCCGG + Intronic
1133130281 16:3672522-3672544 TAGGGAGGTGGGGCAGCTCCCGG + Intronic
1133209944 16:4257996-4258018 GAGGGAGCCGGGGCAGCCACAGG - Exonic
1133392600 16:5422233-5422255 GAGGGAGGAGGAGCAGGGAGAGG + Intergenic
1133392606 16:5422252-5422274 GAGGGAGGAGGAGCAGGGAGAGG + Intergenic
1133528639 16:6631759-6631781 TAGGGAGGAGGAGCAGCCACCGG + Intronic
1133668271 16:7992453-7992475 AAGGCAGGAGGAGCAGAGACGGG + Intergenic
1134897209 16:17898951-17898973 TAGGAAGGAGGAGGACCGACAGG + Intergenic
1135758097 16:25114751-25114773 TGAGAAGGAGGAGGAGCCACGGG - Intronic
1135822053 16:25692993-25693015 TGGGGAGAAGAAGCTGCCACAGG + Exonic
1136551608 16:30985189-30985211 GAGGGAGAAGGAGGAGCCAGCGG + Exonic
1137376964 16:47960160-47960182 CAGGGAGGAGATGGAGCCACAGG + Intergenic
1139481586 16:67233868-67233890 TGGGGAAGAGGGGCAGCCAGAGG + Exonic
1139970601 16:70771882-70771904 TAGGGCGGATTAGAAGCCACTGG - Intronic
1140564587 16:76026901-76026923 TCGAGAGGAGGAGAAGCAACTGG + Intergenic
1141160296 16:81625238-81625260 CTGGGAGGTGGAGCAGCCATGGG - Intronic
1141571601 16:84937317-84937339 TATGGGGGAGCAGCAGCCGCTGG - Intergenic
1141581416 16:85002210-85002232 GCTGGAGGAGGAGGAGCCACAGG - Intronic
1141698974 16:85633797-85633819 CAGGGAGCAGGGGCAGCCCCGGG - Intronic
1142144686 16:88487917-88487939 CAGGGAGGAGTGGCAGCCAGCGG - Intronic
1142607735 17:1091331-1091353 GAGGGAGAAGGAGCACCCTCCGG + Intronic
1142928562 17:3262226-3262248 CAGGGAGTAGGAGAAGCCACTGG + Intergenic
1143091394 17:4451013-4451035 TAAGCAGGAGGGGCAGCCAGAGG - Intronic
1143151979 17:4812879-4812901 GAGTGAGGAGGAGCAGTCAGAGG + Intronic
1144485919 17:15664211-15664233 TAGGGCAGAGAAGCAGGCACAGG + Intronic
1144851803 17:18247573-18247595 TAGGGAGGTAGTGAAGCCACAGG + Intronic
1144955701 17:19017853-19017875 CAGGCAGAAGGAGCAGCCTCTGG + Intronic
1145206990 17:20989846-20989868 CTGGGGGGAGGGGCAGCCACTGG + Intergenic
1146000154 17:29126057-29126079 TAGGGAAGGGGAGCAGCGCCAGG + Intronic
1146704602 17:34991793-34991815 CAAGGAGGATGAGCAGCAACAGG + Exonic
1146793173 17:35764376-35764398 CAGGGAGGAGGGGCTGCCCCAGG + Intronic
1146923250 17:36727708-36727730 CAGGCAGGAGGCTCAGCCACTGG - Intergenic
1146932828 17:36790286-36790308 TAGAGAGAATGAGGAGCCACTGG + Intergenic
1147121031 17:38335177-38335199 CAGGTAGCAGGAGCAGCCCCAGG + Exonic
1148131094 17:45262943-45262965 TTGGGACTAGAAGCAGCCACTGG + Intergenic
1148189153 17:45666781-45666803 TCTGGAGGAGGGGCTGCCACAGG - Intergenic
1148208026 17:45791727-45791749 TGGGGAGGAGGAGCAGCCCTGGG - Intronic
1148509232 17:48154625-48154647 TAGGAAGGAGAAGAGGCCACTGG - Intronic
1148610540 17:48961737-48961759 TAGGAAGGAGGAGGAGGCAGTGG - Exonic
1148820121 17:50355260-50355282 TGGGGAGGAGGAGGAGCCAGAGG + Intronic
1149891858 17:60396962-60396984 TAGGAAGAAAAAGCAGCCACTGG - Intronic
1151653054 17:75481734-75481756 CATGGAGGAGGCTCAGCCACAGG - Intronic
1152128853 17:78464151-78464173 TAGGGGGGATGAGCAGCCCTTGG - Intronic
1152540092 17:80970435-80970457 CCAGGAGCAGGAGCAGCCACAGG + Intergenic
1152748744 17:82052850-82052872 GAGGCAGGAGGACCAGCCCCCGG - Intronic
1152793981 17:82297967-82297989 TGGGGAGGAGGAGGAGGCGCTGG + Intergenic
1152889076 17:82869861-82869883 CAGGGAGGAAGAGGAGCCCCTGG - Intronic
1153874591 18:9357821-9357843 TAAGGAGGAGGAGCAGGGAAGGG + Intronic
1153875086 18:9363024-9363046 TAGGAAGGAGGAGCAGCGGCAGG - Intronic
1154308953 18:13253049-13253071 TTGGGAGCAGGAGCAGTTACAGG - Intronic
1154337813 18:13479935-13479957 TGGGGAGGATGTGGAGCCACCGG + Intronic
1154486470 18:14875544-14875566 AAGAGAGGAGGAGGAGCCCCTGG + Intergenic
1155156688 18:23163504-23163526 GTGGGAGGAGAAGCAGGCACAGG + Intronic
1155650654 18:28137217-28137239 CAGGGAGGAGCAGCAGAGACTGG + Intronic
1158064316 18:53387166-53387188 TGGGCAGGAGTAGAAGCCACGGG - Intronic
1160005766 18:75068046-75068068 CAGGGAAGGGGAGCAGGCACTGG + Intergenic
1160184019 18:76660708-76660730 TGGGGAGGAGGAGCAGGCAGAGG + Intergenic
1160213414 18:76903596-76903618 TTGGCAGGAGGAGCAGCCCAAGG + Intronic
1160643101 19:158850-158872 GAGGGAGCAGAAACAGCCACAGG + Intergenic
1160667688 19:340718-340740 AAGGGAGCTGGGGCAGCCACTGG + Intronic
1161196032 19:2987257-2987279 GAGGGGGAAGGGGCAGCCACAGG + Intronic
1161557797 19:4954409-4954431 GAGGGAGGAGGAGGAGCAGCAGG + Exonic
1161614657 19:5263383-5263405 TAAGGAGGAGGAGCAGAAAGCGG + Intronic
1162932222 19:13962910-13962932 TCGGGAGGAGGAGGAGCCCGGGG - Intronic
1163329635 19:16628137-16628159 AAAGGAGGAGGAGGAGCCGCCGG + Exonic
1163641230 19:18463265-18463287 CAGGGAGGAGGAGCAACCTGAGG + Intronic
1164434162 19:28214720-28214742 TTGGGAGGGGGAGCAGGGACAGG - Intergenic
1164887719 19:31797184-31797206 TAGGGGAGAGGAGAAGCGACAGG + Intergenic
1166106269 19:40599613-40599635 AAGGGAGGAGGAGCGGAAACGGG - Intronic
1166164443 19:40977496-40977518 CAGGGAGGAGGAACAGCAAGAGG - Intergenic
1166168507 19:41009587-41009609 TAGGGAGGAGGAACTGAGACAGG + Intronic
1166524336 19:43501790-43501812 CCGGGAGGAGGAGCAGCTGCGGG - Exonic
1166694445 19:44844744-44844766 TAGGGAGGAGGGCGAGCCGCTGG + Intergenic
1167245981 19:48373455-48373477 GAGGAAGGAGGAGCAGCTTCAGG + Intronic
1167406175 19:49310190-49310212 TGGGGAGGAAGAGCAGGGACAGG + Intronic
1167426989 19:49434472-49434494 GAGGGAGGAGGAGGAGACTCTGG - Intronic
1167778748 19:51581429-51581451 CAGGGAGGAGTGGCAGCAACTGG + Exonic
1167785199 19:51630265-51630287 GAGGGAGGAGGGACAGGCACAGG - Intronic
1167787298 19:51646689-51646711 GAGGGAGGAGGGACAGGCACAGG - Intronic
1168144179 19:54410412-54410434 GACTGAGAAGGAGCAGCCACAGG - Intergenic
1168348422 19:55661940-55661962 TAGGGAGGAGGGGCAGGGACGGG - Intronic
925353003 2:3215359-3215381 CAGGGCAGAGGAGCTGCCACCGG + Intronic
925664988 2:6243427-6243449 AAGAGAGGGGGAGAAGCCACGGG + Intergenic
925705533 2:6681428-6681450 TAGGGGAAAGCAGCAGCCACAGG - Intergenic
926105445 2:10146726-10146748 TAGGGAGGAGGAGGAGGGAGAGG + Intronic
926143353 2:10381775-10381797 GAGGGAGGATGTGAAGCCACAGG + Intronic
926151275 2:10426959-10426981 GAGGAGGGAGGCGCAGCCACCGG - Exonic
926203338 2:10817089-10817111 TAGCGGGCTGGAGCAGCCACGGG - Intronic
927501790 2:23588168-23588190 CCAGGAGGAGGAGCAGGCACTGG - Intronic
929800405 2:45095671-45095693 TTGGGGAGAGGAGCAGCCCCAGG - Intergenic
930487445 2:52026141-52026163 TAGGGTGGAGGAGCAGAGGCTGG + Intergenic
932709826 2:74054366-74054388 AAGGGAGGAGGAGTGGTCACAGG + Intronic
933494715 2:83034750-83034772 TAGGGAGGAGAAGCTGTTACAGG - Intergenic
933552472 2:83792910-83792932 TAGGGTGGAGGAGCAGGCCGAGG + Intergenic
934113615 2:88764835-88764857 TAGGGCTGAGGAGCCGCCAGGGG - Intergenic
934526361 2:95054244-95054266 TAGGAAGGAGAAGCTGCCCCTGG - Intergenic
934773040 2:96920081-96920103 TAGGCAGGAGGAGCTGCAAAGGG + Intronic
934793552 2:97082649-97082671 TAGGGAGGACAGGGAGCCACTGG - Intergenic
934843291 2:97645400-97645422 AAGGGAGGAGGAGCAGGAAGGGG - Intergenic
934952436 2:98586625-98586647 ATGGGAGGATGAGCAGCCAGGGG - Intronic
935218077 2:100990164-100990186 TAGGTAGAAGGAGGAGACACTGG + Intronic
935233549 2:101119389-101119411 TAGGGTGGAAGAGGAGGCACAGG - Intronic
935454056 2:103245162-103245184 TAGGGAGGAGGAAGAACCAGAGG - Intergenic
935832399 2:107013728-107013750 TAGTGAAGTGGAGCAGACACTGG + Intergenic
936292376 2:111236103-111236125 TAGGGAGGAGGACAAGCCCTGGG + Intergenic
937247715 2:120504234-120504256 TAGGGGGCAGGAGCTGCCAAAGG - Intergenic
938757983 2:134398044-134398066 GAAAGAGGAGGAGCTGCCACAGG + Intronic
938790112 2:134669073-134669095 AAGTGAGGGGGAGCAGCCCCAGG - Intronic
938962533 2:136356204-136356226 GAGGGAGGAGGAGGAGGTACAGG + Intergenic
940279636 2:151976143-151976165 TTGGGTGCAGGAGCAACCACAGG - Intronic
940393922 2:153165898-153165920 TAGTGAGGAATAGCAGCCTCAGG + Intergenic
940533916 2:154914161-154914183 ATGGGTGGAGGAGCAGCCACTGG + Intergenic
944614313 2:201444326-201444348 GAGGGAGGAGAAGCAGGCAGGGG - Intronic
945223114 2:207504606-207504628 GGGGGTGGAGGAGGAGCCACAGG + Intergenic
946191637 2:218010662-218010684 GAGGAAGGAGCAGCAGCCGCGGG + Intergenic
946307931 2:218866399-218866421 GATGGAGGAGGAGGAGACACAGG + Intronic
946531756 2:220578068-220578090 TAAGGAGGCAGAGCAGCCCCTGG - Intergenic
947542789 2:230990371-230990393 GAAGGCGGAGGCGCAGCCACAGG + Intergenic
948198945 2:236115705-236115727 CAGGGAGTTGGGGCAGCCACTGG - Intronic
948309289 2:236972864-236972886 CTGGGAGGAGGAGCTGCCCCCGG - Intergenic
949032345 2:241803038-241803060 GAGGGAGGAGGAGCTCCCACTGG - Intronic
1170201918 20:13753382-13753404 TGGGGAGGAGGGCCAGCCAGTGG - Intronic
1170506432 20:17030424-17030446 TTGGGAGGTGGGGCAGGCACAGG - Intergenic
1171233934 20:23509412-23509434 GAGGGCAGAGGTGCAGCCACAGG + Intergenic
1171981452 20:31632059-31632081 TAGGGAGGAGGAGACGGCAATGG + Intergenic
1172788632 20:37487094-37487116 GAGGCAGGAGCAGCAGCCACTGG - Intergenic
1172973467 20:38889774-38889796 GAGGGAGGAGGAGCTGCAGCTGG + Intronic
1173322325 20:41999108-41999130 CAGTGAGGAGGAGCAGCTGCAGG - Intergenic
1173662303 20:44743129-44743151 AAAGGAGGAGAAGCAGCTACTGG + Intergenic
1173747144 20:45446526-45446548 GAGGGAAGAGTAGCAGCCCCAGG + Intergenic
1174151192 20:48487703-48487725 GAGGGAGGAGGAGCAGATACTGG + Intergenic
1175459712 20:59143285-59143307 TAGGCAGGTGGAGAAGACACAGG + Intergenic
1176073125 20:63236980-63237002 TAGGGCAGAGGAGCAGGCCCGGG - Intronic
1176101940 20:63368392-63368414 TAGGGAGGAGGGGCAGCCAGAGG - Intronic
1176201257 20:63861662-63861684 TGGGCCGGAGCAGCAGCCACCGG + Exonic
1176794828 21:13363832-13363854 AAGAGAGGAGGAGGAGCCCCTGG - Intergenic
1178011233 21:28289479-28289501 TTGGGAGTTGGAGGAGCCACAGG - Intergenic
1179167185 21:38944315-38944337 TGGGGAGGAGGCGGAGACACGGG - Intergenic
1180042054 21:45285515-45285537 AACGGAGGAGGTGCTGCCACAGG + Intronic
1181725471 22:24807843-24807865 GAGGACGGAGGAGCAGCAACAGG - Intronic
1181745144 22:24950841-24950863 TAGGGAGGAGGGGCAGCAGATGG + Intergenic
1181753846 22:25008951-25008973 GTGGGAGGAGGAGGAGCCAGTGG + Intronic
1181959234 22:26610985-26611007 CAGGGTGGAGGGGCAGCCCCAGG - Intronic
1182322947 22:29490112-29490134 GAAGGAGGAGGAGAAGCCCCAGG + Exonic
1182609601 22:31536108-31536130 TATGGAGGAGAAACAGCCACGGG - Intronic
1182865763 22:33602927-33602949 ATGGGAGGAGGAGCAGCAGCTGG - Intronic
1182930577 22:34170168-34170190 TAGGGAGGAGGAGATGCAAAGGG + Intergenic
1183186894 22:36296982-36297004 CAGGGAGGAGAAGCAGCGACAGG - Exonic
1183257273 22:36770671-36770693 GAAGGAGGAGGAGCAGTCAGAGG - Intronic
1183662697 22:39230757-39230779 TGGGCAGGAGGAGAGGCCACGGG + Intronic
1183991710 22:41601268-41601290 TAGGGAGGAGGAGTGGGCGCTGG + Intronic
1184317364 22:43706284-43706306 GAGGCAGGAGAAGCAGCCACAGG - Intronic
1184391884 22:44207533-44207555 CAGGGAGGAGCAGCAGCCTGGGG - Exonic
1184410908 22:44325832-44325854 TCGGGAAGAGGAGCAGCCTGAGG - Intergenic
1184687772 22:46104272-46104294 CCGGGAGGAGCAGGAGCCACCGG - Intronic
1184875795 22:47274637-47274659 GAGGGAAGAGGAGGAGCCCCAGG - Intergenic
1185102070 22:48845907-48845929 CAGGCAGGTGGGGCAGCCACAGG + Intronic
949552346 3:5121859-5121881 TAGGCAGGACGTGCAGCCTCGGG - Intergenic
949789826 3:7781012-7781034 AAGGGAGGAGGAGGATGCACAGG - Intergenic
949820721 3:8112615-8112637 TAGGGAGTGGGAACACCCACAGG + Intergenic
951053030 3:18115989-18116011 TAGTGAGGATGTGGAGCCACTGG - Intronic
952303930 3:32128799-32128821 TGGGGAGCAGGAGCAGCCTAAGG - Intronic
952388400 3:32859795-32859817 GAGGGATGGGGAGCAGCCAAGGG + Intronic
952844143 3:37672654-37672676 TTGGGATGAGGAGCATCCAATGG + Intronic
952884190 3:38002696-38002718 TGGGGAGGGGAAGAAGCCACAGG + Intronic
953416665 3:42724432-42724454 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
953790302 3:45942383-45942405 CAGGGACCAGGAGCAGCCTCAGG - Intronic
954205124 3:49053099-49053121 GAGAGAGGAGGAGAAGGCACCGG + Intronic
954264231 3:49460631-49460653 AAGGTAGGAGGAGCAGCTGCTGG + Intergenic
954638429 3:52084254-52084276 ATGGGAGGAGGAGCAGCTCCTGG - Intronic
954656505 3:52197490-52197512 TGGGGAGGAGGGGAAGGCACAGG - Intergenic
954803737 3:53202891-53202913 GAGGGCGGAGCAGCGGCCACCGG + Intergenic
955140151 3:56260682-56260704 GAGGGAGGAGGAGAAGCCAGAGG - Intronic
955525107 3:59811968-59811990 TAGGTAGGATGAGCTGCCACGGG - Intronic
956799424 3:72743408-72743430 TGGGGAGGAGGGACAGCAACAGG + Intergenic
959247589 3:103894306-103894328 GAGGAAGGAGAAGCAGCCAGAGG + Intergenic
959988155 3:112599763-112599785 TAGGCAGGAGGTCCAGACACAGG - Intergenic
960251152 3:115455140-115455162 TAGTGAGGATGTGCAGCTACAGG - Intergenic
960857841 3:122121269-122121291 AAGGGAGGAGGAGAAGATACAGG - Intergenic
961474460 3:127138074-127138096 TCTGGAGGAGAGGCAGCCACAGG - Intergenic
961649637 3:128410937-128410959 AAGGGAGGAGGGGCAGCCCAGGG + Intergenic
961918917 3:130405585-130405607 TAGGGAGTACGAGGAGACACAGG + Exonic
962832645 3:139157816-139157838 TAGGGTGGGGGAGCAGGCAGGGG + Intronic
963300080 3:143587640-143587662 TAGGGTGAAAGAGCAGGCACTGG + Intronic
963870400 3:150409098-150409120 AAGGAAGGAGGAGCCGCCGCGGG + Exonic
964720792 3:159765348-159765370 GAGGAAGGAGGAGCAGCCAGAGG + Intronic
965615270 3:170586100-170586122 GAGGGAGGACGAGCAGGCACGGG - Intronic
966192526 3:177284425-177284447 GAGGGAGGAGGAGCACTCAACGG - Intergenic
967055395 3:185825258-185825280 GCGGGAGGAGGAGCAGCGGCGGG + Intergenic
967305055 3:188051825-188051847 AAGGGTAGAGCAGCAGCCACCGG - Intergenic
967744987 3:193045357-193045379 TAGAGAGGAACAGCAGGCACAGG + Intergenic
967932437 3:194700142-194700164 TTGGGAGGAGGGGCAGTCCCTGG + Intergenic
968726945 4:2252219-2252241 CAGGGTGGAGGAGCAGCAACAGG - Intronic
969348646 4:6585054-6585076 GATGGAGAAGGAGCAGCCAGAGG - Intronic
969462519 4:7336264-7336286 AAGGGAGGAGAAGCATCCAGCGG + Intronic
969581974 4:8071052-8071074 TGTGGATGAGGAGAAGCCACTGG - Intronic
969676397 4:8616667-8616689 TGGGGGTGAGGAGGAGCCACAGG + Intronic
970210437 4:13704263-13704285 CAGGCAGCACGAGCAGCCACTGG - Intergenic
970484206 4:16507989-16508011 TAAGGGGGAGGATCAGCCTCTGG - Intronic
970652671 4:18195824-18195846 TATGGAGGAGGAGCAGGGAGAGG - Intergenic
972257870 4:37378180-37378202 CAGGGACGTGGAGCAGACACAGG - Intronic
972276826 4:37565440-37565462 CATGGAGGAGGAGCAGCACCGGG + Intronic
972604060 4:40597856-40597878 TAGCCAGAAGGAGCAGACACTGG + Intronic
975820218 4:78263154-78263176 TAGGGAGGTGGAGCAGAGATAGG - Intronic
975968559 4:80005856-80005878 CAGGGATGACGAGAAGCCACTGG - Intronic
976104927 4:81606445-81606467 AGGGGAGGAGGAGCAGGCATTGG - Intronic
976325517 4:83767019-83767041 AAAGGAGGGGGAGCAGCCATTGG + Intergenic
976599880 4:86928326-86928348 TATGGGGGAGGTGCTGCCACTGG + Intronic
977363532 4:96036948-96036970 GGGGGTGGAGGAGGAGCCACTGG - Intergenic
978274042 4:106927274-106927296 TGGGCAGGAGGAGAAGACACTGG - Intronic
978370240 4:108022621-108022643 TATAGAGGAGGAGGAGCCCCAGG - Intronic
981009571 4:139911638-139911660 TAGGTAGGAGGTGCAGCCTTTGG + Intronic
981033917 4:140151840-140151862 GAGGTAGGATGAGCAGCCAATGG - Intronic
981756510 4:148145990-148146012 AAGGGAGGAGGGGCAGACACTGG + Intronic
981871929 4:149497207-149497229 CTGGGAGGAGGAGGAGCCTCAGG + Intergenic
985679968 5:1250709-1250731 AAGGGAGGAGAAGCAGGCAAGGG - Intergenic
986113054 5:4739281-4739303 CCGGGAGGAGGGGCAGCCACAGG + Intergenic
986806534 5:11313223-11313245 CAGGGAGGAGGAGGAGGGACAGG - Intronic
987934888 5:24451192-24451214 TGGGGAGCAGGAGCCGCCATGGG + Intergenic
988264256 5:28928595-28928617 TAGGGCTGAGGAGCTGCCAGGGG + Intergenic
990584662 5:57199382-57199404 GACTGAGGAGGAGCAGCCATAGG + Intronic
992488804 5:77220885-77220907 TAGGGAGGAAGTGGAGGCACAGG + Intronic
992669551 5:79045231-79045253 CAGGGAGAAAGAGAAGCCACAGG + Intronic
993413845 5:87601828-87601850 TTGTGAGGAGGAGCAGCCTCAGG - Intergenic
996080844 5:119256168-119256190 TATGGAGGAGGATCAGCCAGTGG - Intergenic
996264181 5:121515039-121515061 TGGAGAGGAGGAGAAACCACAGG - Intergenic
998036973 5:138925830-138925852 TTGGGGGGAGGAGCGGCCCCAGG + Intronic
998164753 5:139836691-139836713 CATGGAGGAAGAGCAGCCCCAGG - Intronic
998368577 5:141646754-141646776 TGGAGAGAAGGAGCAGCCTCAGG - Intronic
998523686 5:142823348-142823370 AAGGGAGGAGCACCAGGCACTGG - Intronic
998754386 5:145360108-145360130 TTTGGAGGAGGAGGACCCACAGG - Intergenic
998883275 5:146667122-146667144 TAGGGAGGTGGAGAAGACAATGG + Intronic
999339590 5:150758673-150758695 TGGAAAGGAGGAGCAGCCTCGGG - Intronic
1000025962 5:157359442-157359464 TGGGGAGGATGAGCAGTCAGTGG - Intronic
1001630284 5:173169973-173169995 AAGGGAGAAGGAGCAGGCAGGGG - Intergenic
1001635516 5:173207420-173207442 GATGGAGGAGGAGGAGACACAGG + Intergenic
1002213206 5:177610448-177610470 CAGGGGGGAGGAGAAGCCAAAGG + Intergenic
1002318926 5:178363676-178363698 TGGGGAGGTGAAGCAGCCATCGG - Intronic
1002560696 5:180080033-180080055 TTGGGAGGCTGAGCAGTCACAGG + Intergenic
1002586723 5:180253257-180253279 AAGGAAGGGGGAGCAGCCAGAGG - Intronic
1002664685 5:180814427-180814449 TGCTGAGGAGGAGCAGCCAGAGG - Intronic
1002733773 5:181365623-181365645 GAGGGAGCAGAAACAGCCACAGG - Intergenic
1002750770 6:108497-108519 GAGGGAGCAGAAACAGCCACAGG + Intergenic
1002897413 6:1387885-1387907 TAGGGAGAAGGAGCCGGCTCAGG + Intergenic
1003498119 6:6682301-6682323 AAGGGAGGGAGAGAAGCCACTGG - Intergenic
1004020325 6:11770861-11770883 TAGTTAGGAAGAGCAGGCACAGG + Intronic
1006025359 6:31143306-31143328 GAAGGAGGAGGGGCAGCGACTGG - Exonic
1006106321 6:31719065-31719087 GTGGGAGGAGGGGCAGCCAATGG + Exonic
1006419773 6:33925732-33925754 TGAGGAGGAGGAGGAGACACTGG - Intergenic
1007216942 6:40247763-40247785 AAGGGAGGGTGAGCAGCCAAGGG - Intergenic
1007418049 6:41703447-41703469 GACGGAGGAGGAGCAGCCCCAGG - Intronic
1007419436 6:41710840-41710862 TCGGGAGGAGGAGGAGACCCTGG - Intronic
1010169137 6:72954310-72954332 AAGGCAGGAGGAGGAGCCAGAGG + Intronic
1011181381 6:84625350-84625372 TACAGAGGAGGAGGAACCACAGG + Intergenic
1015189336 6:130456272-130456294 AAGAAAGGAGAAGCAGCCACAGG + Intergenic
1016055522 6:139574120-139574142 TAGAGAGGAGCAACAGACACTGG - Intergenic
1016097550 6:140056802-140056824 TAGGAAGGAGGAGGATCCAGTGG + Intergenic
1017042051 6:150315599-150315621 CAGGGATGGGCAGCAGCCACTGG - Intergenic
1017983520 6:159422815-159422837 AAGGAGGGAGGAGCAGTCACTGG - Intergenic
1018472752 6:164111285-164111307 TTGAGAGGAGGAGCAGACAGTGG + Intergenic
1019154646 6:170030993-170031015 TGGGGAGAAGGAGCAGCTCCAGG - Intergenic
1019238020 6:170637943-170637965 GAGGGAGCAGAAACAGCCACAGG - Intergenic
1019538672 7:1541711-1541733 TTGGAAGGAGGAGCAGGCAAAGG - Exonic
1019982438 7:4631322-4631344 TAGGGTGCAGCAGCAGGCACTGG - Intergenic
1021836859 7:24685482-24685504 TGGGGGGGAGGAGGAGACACAGG - Intronic
1022040469 7:26576557-26576579 TGGGAAGGAAGAGCAGCCCCAGG + Intergenic
1022066606 7:26864774-26864796 GAAGCAGGAGGAGGAGCCACTGG + Intronic
1022529752 7:31059612-31059634 TCTGGAGGAGGAGGAGCCACTGG + Intronic
1022536522 7:31101976-31101998 GGGGGAGGAGGAGCAGCCTGAGG - Intronic
1023529808 7:41140571-41140593 TAGGAAGGAGGAGAACACACAGG + Intergenic
1023829365 7:44029833-44029855 TGGGGAGGAGGAGGAGACACGGG - Intergenic
1023832967 7:44050827-44050849 TCTGGAGGAGGAGCAGTCACGGG - Intronic
1023871371 7:44264697-44264719 GAGGGAGGGGGAGCAGGGACTGG - Intronic
1024526025 7:50350074-50350096 TAGGGAGGTGGGGCAGCCCCGGG + Intronic
1024531609 7:50398331-50398353 TAGGCAGGAGGGGCAGGCAGAGG - Intronic
1024904524 7:54361545-54361567 TAGGGAGTTTGAACAGCCACTGG - Intergenic
1025231557 7:57206204-57206226 GAGGGAGGAGGAGCAGATCCTGG - Intergenic
1025950497 7:66141686-66141708 TAGGACCGAGGAGCAGCCGCTGG + Intronic
1026032881 7:66810087-66810109 CAGTGAGAAGGAGCAGGCACTGG + Exonic
1026476191 7:70737745-70737767 CAGAGAGGAGGAGGAGCCAGGGG + Intronic
1029739671 7:102484091-102484113 TGGGGAGGAGGAGGAGACACGGG - Intronic
1029757672 7:102583270-102583292 TGGGGAGGAGGAGGAGACACGGG - Intronic
1029775608 7:102682331-102682353 TGGGGAGGAGGAGGAGACACGGG - Intergenic
1030065196 7:105653934-105653956 TAGGAAGGAACAGCAGGCACTGG - Intronic
1030802902 7:113875450-113875472 CAGGGAGGACTAGCAGCCCCTGG - Intergenic
1031208214 7:118790099-118790121 GAAGGAGGAGGAGCAGACAAAGG + Intergenic
1031586290 7:123534951-123534973 TAGGGAAGAAGAGGAGCCAGAGG + Intronic
1032477046 7:132218677-132218699 TACTGAGCAGGAGCAGCCACTGG - Intronic
1032886365 7:136143528-136143550 GACTGAGAAGGAGCAGCCACAGG - Intergenic
1034265325 7:149777860-149777882 GAGGGAGATGGGGCAGCCACAGG + Intergenic
1034266224 7:149782339-149782361 TGTGGAGGAGGAGCAGTGACAGG - Intergenic
1034293413 7:149949991-149950013 CAGGGAGGAAGTGCACCCACGGG + Intergenic
1034430289 7:151037891-151037913 TAGGGAGCACGAGCAGAAACGGG - Intronic
1034696089 7:153055108-153055130 TGGGGAGGAGGAGCTGGCAGAGG + Intergenic
1034812653 7:154146862-154146884 CAGGGAGGAAGTGCACCCACGGG - Intronic
1035287590 7:157816238-157816260 CAGGGAGGCGGGGCAGGCACGGG - Intronic
1035298513 7:157881340-157881362 TAGGAAGGAGATGCAGACACAGG + Intronic
1035334100 7:158114591-158114613 GAGAGAGGAGGAGGAGCCAGCGG + Intronic
1035509748 8:168666-168688 GAGGGAGCAGAAACAGCCACAGG + Intergenic
1035640928 8:1184692-1184714 TAGGGAGCAGGAGGAGGCTCAGG + Intergenic
1037042147 8:14249367-14249389 TAGGGAGGATGAGAAACCCCAGG - Intronic
1038335309 8:26641137-26641159 CAGGGCCGAGGAGCAGGCACAGG + Intronic
1038452115 8:27646500-27646522 CAGGGAGGAGGCCCAGTCACGGG + Intronic
1038687772 8:29734181-29734203 TAGGAGGGAGGAGCAACCCCAGG - Intergenic
1040642232 8:49349393-49349415 CAGGGAAGCAGAGCAGCCACAGG + Intergenic
1041632598 8:60104588-60104610 TAGCTAGGAGGAGCAGGCACAGG + Intergenic
1042193844 8:66214894-66214916 TATAGATGAGGAGCAGGCACTGG - Intergenic
1043486488 8:80703382-80703404 TGGGGAGGAGGAGGAAGCACAGG - Intronic
1044560284 8:93605944-93605966 GAATAAGGAGGAGCAGCCACGGG + Intergenic
1044651522 8:94500565-94500587 TGGGGAGGATGAGGAGCAACTGG + Intronic
1048004258 8:130406174-130406196 TAGGCAGCAGGAGCAGTCCCTGG - Intronic
1048199214 8:132357812-132357834 ATTGGAGGAGGAGCAGCCATAGG - Intronic
1048949019 8:139477733-139477755 AAAGGAGGAGGAACAGCCTCAGG - Intergenic
1048998673 8:139810302-139810324 CACGAAGCAGGAGCAGCCACGGG + Intronic
1049106423 8:140616642-140616664 TACAGAGGAGGAGCTGACACAGG + Intronic
1049343825 8:142128035-142128057 CAGGAAGGAGGAGCAGCCTGGGG - Intergenic
1049591841 8:143466249-143466271 TAGGTGGGAGGACGAGCCACGGG + Intronic
1049658814 8:143810617-143810639 CAAGGATGAGCAGCAGCCACAGG + Intronic
1049668109 8:143857428-143857450 TAAGGTGGAGCAGCAGCCAATGG + Exonic
1049769395 8:144372894-144372916 GTGGGAGGAGGAGGGGCCACTGG + Intergenic
1049769404 8:144372916-144372938 GTGGGAGGAGGAGGGGCCACTGG + Intergenic
1049769430 8:144372982-144373004 GTGGGAGGAGGAGGGGCCACTGG + Intergenic
1049922986 9:382409-382431 TAGGGTGGATGAAAAGCCACCGG - Intronic
1051208762 9:14719262-14719284 TAGGGAAGAGGAACAATCACTGG - Intergenic
1052883223 9:33618548-33618570 TGGGGTGGAGGAGCAGCTGCAGG - Intergenic
1053004424 9:34594465-34594487 GAGGGAGGAGGAGCGGGCTCCGG + Intergenic
1053715691 9:40885146-40885168 TAGGGCTGAGGAGCCGCCAGGGG + Intergenic
1054076859 9:60545592-60545614 TAGGGCTGAGGAGCCGCCAGGGG - Intergenic
1054718120 9:68577749-68577771 CAGGGAGGAGGAGCTGTCACAGG + Intergenic
1055008363 9:71535522-71535544 AAGGGAGAGGGAGAAGCCACAGG + Intergenic
1056487978 9:87077848-87077870 TAGAGAGAAGGAGAAGTCACAGG + Intergenic
1056490540 9:87102617-87102639 GAAGGAGGAGGAGTAGTCACAGG - Intergenic
1057544800 9:96010263-96010285 TAGTGAGGACTAGAAGCCACAGG + Intronic
1057548883 9:96037800-96037822 CAGGGAGAAGGAGGAGCCAGAGG + Intergenic
1057813850 9:98279494-98279516 GAGGGAGGAGAAGCAGCTGCAGG - Intergenic
1059611384 9:115900755-115900777 AAGGGAGGAGGAGCAGGAAAAGG - Intergenic
1061517146 9:131096562-131096584 GAGGGACGAGGAGGAGGCACAGG - Exonic
1061783237 9:133008008-133008030 TAGGGAGGAGGAGAAGGAAAGGG - Intergenic
1061861121 9:133469289-133469311 CAGGGAGGAGGGGCAGCCGAGGG - Exonic
1062151397 9:135021068-135021090 CAGGGCTGAGGGGCAGCCACCGG - Intergenic
1062315096 9:135963209-135963231 GAGGCAGGAGGAGGAGCCATTGG + Intergenic
1062362356 9:136193873-136193895 TAGGGAGGGGGCGCGGCCGCCGG - Intergenic
1062569613 9:137179103-137179125 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
1062635491 9:137488440-137488462 AAGGGAGGTGGAGCAGACACAGG + Intronic
1062758226 9:138318239-138318261 GAGGGAGCAGAAACAGCCACAGG - Intergenic
1185717429 X:2354041-2354063 TGGGGAGGAGGAGGAGACACAGG + Intronic
1186482660 X:9907832-9907854 TATAGAGAGGGAGCAGCCACAGG - Intronic
1187533815 X:20119446-20119468 TAAGGTGGAGGAACAGCCAATGG - Intergenic
1189248552 X:39582021-39582043 TGGTGAGCAGGAGCAGCAACAGG + Intergenic
1189573504 X:42325004-42325026 GAGGGAGCAGGAGCAGGCAAGGG - Intergenic
1189798737 X:44672598-44672620 TGGGGAGGAGGTGCAGGCAGAGG + Intergenic
1190110418 X:47585765-47585787 TAGGGTTGGGGAGCAGCCACAGG - Intronic
1190145480 X:47888037-47888059 TAGAGAGGAGTGGCAGCAACTGG + Exonic
1191591870 X:62894629-62894651 TAGGGAGGACCAACAGTCACTGG - Intergenic
1192561366 X:72130172-72130194 TGAGGTGGAGGAGGAGCCACTGG - Exonic
1192894188 X:75423138-75423160 TACTGAGGAGCTGCAGCCACAGG + Intronic
1195006767 X:100692829-100692851 TAGAGAGGAGGAGCAGCCCAAGG - Intronic
1195722666 X:107881220-107881242 TAGAGAGCAGGAGCTCCCACTGG + Intronic
1195751482 X:108164776-108164798 TAGGGAAGAACATCAGCCACCGG + Intronic
1196016372 X:110944522-110944544 ATGGGAGGAGGAGCAGGAACTGG - Intronic
1198073682 X:133174335-133174357 TATGGATGTGGTGCAGCCACTGG + Intergenic
1198672425 X:139095285-139095307 TAGGGACAAGAAGCAGCCAAAGG + Intronic
1199851032 X:151725099-151725121 CAGGGTGGAGGCCCAGCCACGGG - Intergenic
1200133808 X:153865042-153865064 AAGGGAGGTGGAGGGGCCACGGG - Intronic