ID: 1133532095

View in Genome Browser
Species Human (GRCh38)
Location 16:6664820-6664842
Sequence GTTTTGCAGTCAAACGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133532092_1133532095 8 Left 1133532092 16:6664789-6664811 CCTAATTTATTTCAAAAGGCAAG 0: 1
1: 0
2: 8
3: 43
4: 560
Right 1133532095 16:6664820-6664842 GTTTTGCAGTCAAACGGATCTGG 0: 1
1: 0
2: 2
3: 17
4: 182
1133532091_1133532095 11 Left 1133532091 16:6664786-6664808 CCTCCTAATTTATTTCAAAAGGC 0: 1
1: 0
2: 0
3: 22
4: 226
Right 1133532095 16:6664820-6664842 GTTTTGCAGTCAAACGGATCTGG 0: 1
1: 0
2: 2
3: 17
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133532095 Original CRISPR GTTTTGCAGTCAAACGGATC TGG Intronic
903247158 1:22024593-22024615 GCTTTGAAGTCATACTGATCTGG - Intergenic
903760227 1:25692637-25692659 GTTTTGAAGTCCAGCGGAACTGG - Intronic
904199141 1:28808016-28808038 GGTTTGGAGTCACACAGATCTGG + Intergenic
904474868 1:30758195-30758217 TTTTTGCAGCCAGACAGATCTGG - Intergenic
904481290 1:30795291-30795313 GTTTTGGAGTCAGATAGATCTGG + Intergenic
906773961 1:48511804-48511826 ATTTTGCAGTCAGACAGAGCAGG + Intergenic
906830020 1:49021148-49021170 ATTTTGAAGTCAGACGGATCTGG + Intronic
907406577 1:54257315-54257337 GTTTTGCTGTCAAAGGGAAGAGG - Intronic
907515161 1:54989233-54989255 GCTTTGCAGTCAGACGAAGCTGG + Intronic
910237456 1:85049690-85049712 GTTTTGGAGTCAGACAGATGAGG + Intronic
910846933 1:91612840-91612862 GTTTTGACATCAAACAGATCTGG - Intergenic
911488903 1:98537666-98537688 CTTTTGAAGTCAAACAGATGTGG - Intergenic
912156500 1:106927467-106927489 GTTTTGCATTCAAATGGATCTGG - Intergenic
913547582 1:119884757-119884779 GATTTGCAGTCAGACTGATCTGG + Intergenic
914851846 1:151320400-151320422 GTTTTGCAGAAAGACGGATGGGG + Intronic
915506283 1:156358546-156358568 GTTTTGGAGTCAAACAGATCTGG - Intronic
916522338 1:165575405-165575427 GCTTTGAAGTCAAACAAATCTGG + Intergenic
916648518 1:166813526-166813548 GTTTTACAGTCAAAAGGACCTGG - Intergenic
918891186 1:190271262-190271284 GTTTTACTGTCAAACAGATTTGG + Intronic
919483925 1:198122640-198122662 GTTTTGGAGTCATACAGACCTGG - Intergenic
924309270 1:242722903-242722925 GTTTTCCATTCATACAGATCTGG + Intergenic
924479121 1:244411706-244411728 GTTTTGCTGCCAAATGAATCTGG + Intronic
924672678 1:246145934-246145956 GTTTTGAAGTCAGACAGACCTGG - Intronic
1063968322 10:11363778-11363800 GTGTTGCAGTGAGACGGAGCAGG + Intergenic
1065734579 10:28740144-28740166 GTTTTGCAGCCCAACAGCTCTGG - Intergenic
1066195590 10:33096471-33096493 GCTTTGCTGTAAAACAGATCTGG - Intergenic
1067717338 10:48699530-48699552 GTTTTGGAGGCAGACAGATCTGG + Intronic
1067837251 10:49649275-49649297 GTTTTGGAGTCAGGCGGAACTGG + Intronic
1069882187 10:71600492-71600514 GTTCTGCGGTCAAACAAATCTGG - Intronic
1069968298 10:72140923-72140945 GCTTTACAGTCAAACAGAGCTGG + Intronic
1070154215 10:73823838-73823860 GCTTTGCAGTCAGACAGACCTGG - Intronic
1071388708 10:85148321-85148343 TTTTTGCAGTTAGACTGATCAGG + Intergenic
1073487094 10:103826374-103826396 GTTTTGGAGTCCAACAGACCTGG - Intronic
1073996254 10:109318389-109318411 ATTTTGGAGTCAGACAGATCTGG + Intergenic
1074587754 10:114784815-114784837 GTTTTGGAATCAAACAAATCTGG - Intergenic
1077987147 11:7364564-7364586 GTTTTAAAGTCAAACAAATCTGG - Intronic
1078916096 11:15780223-15780245 GTTCTGGGGTCAAACAGATCTGG + Intergenic
1079324200 11:19477498-19477520 ATTTTGCATTCAGACGGAACTGG + Intronic
1081639233 11:44741689-44741711 GTTTTGGAGTCCCATGGATCTGG + Intronic
1082252891 11:50001481-50001503 GTTTTGTAGTGAAATGCATCGGG - Intergenic
1086977583 11:93153513-93153535 GTTTTGGAGTCAGACAGATCTGG - Intronic
1087529789 11:99365102-99365124 GTTTGGCTGTCAAATTGATCTGG + Intronic
1088105856 11:106205963-106205985 GTTTTGCATTCACACTAATCTGG + Intergenic
1089370804 11:117955097-117955119 ATTTTGAACTCAAATGGATCTGG + Intergenic
1092078612 12:5694131-5694153 GTTTTGGAATCAAACAGAGCTGG - Intronic
1093406046 12:18806000-18806022 GTTTTGCAGCCAAATGACTCAGG - Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1095116589 12:38360418-38360440 TTTTTGTAGTCAAACAAATCAGG - Intergenic
1095599322 12:43997177-43997199 GTTTTGGAGTCAAATATATCTGG - Intronic
1095832861 12:46605744-46605766 GTTTTAAAGTCAAACAAATCTGG - Intergenic
1097317112 12:58183396-58183418 GCTTTGGAGTCCAACGGCTCAGG + Intergenic
1097942191 12:65322711-65322733 GTTTTGCAGTCAGACAGCCCTGG + Intronic
1097964852 12:65568022-65568044 GTTTTGCAGTCAAAGAAAACGGG + Intergenic
1097967778 12:65599125-65599147 GTTTTGATGTCAAACAGATTTGG - Intergenic
1098987775 12:77030819-77030841 GTTTTGCCATCAAACAGATGTGG - Intronic
1102409760 12:112707503-112707525 GCTTTGAAGTCAGACTGATCTGG - Intronic
1102472102 12:113165107-113165129 GTTTTGAAGTCAAATGGACTTGG - Intronic
1112275411 13:98013430-98013452 GCTTTGGAGTCAGACAGATCTGG - Intronic
1114752156 14:25217087-25217109 AGTTTGGAGTCAAACAGATCTGG - Intergenic
1115154941 14:30327926-30327948 GTTTTGGAGTCAGGTGGATCAGG - Intergenic
1116325240 14:43525161-43525183 GTTTTGCAAACAAAGGGACCAGG - Intergenic
1116941943 14:50799157-50799179 GCTTTGGAATCAAACGGACCTGG + Intronic
1117229357 14:53699786-53699808 GTTTTGCTGACAGAAGGATCCGG + Intergenic
1118909074 14:70046305-70046327 GCTTTGCTGGCAAACGTATCTGG + Exonic
1118987202 14:70766728-70766750 GTTCTGAAGTCAGACAGATCTGG - Intronic
1124989793 15:34660330-34660352 GTTTTGCAGCCAGAGAGATCCGG + Intergenic
1126525452 15:49649393-49649415 GTTTTCCAGTAAAACGGAGAAGG + Exonic
1127668839 15:61174961-61174983 GCTTTGCAGTCAAGCAGATTTGG - Intronic
1128952501 15:71901108-71901130 GTTTTACAGTAAAAAGGTTCTGG + Intronic
1130556254 15:84924429-84924451 ATTTTGGAGTCAGACAGATCTGG - Intronic
1131327091 15:91458456-91458478 GGGTTGAAGTCACACGGATCTGG + Intergenic
1131899925 15:97076900-97076922 GCTTTGCAGTCATACAGATGTGG + Intergenic
1131963070 15:97809411-97809433 GTTTTGCAGGCAGACAGATCTGG - Intergenic
1133532095 16:6664820-6664842 GTTTTGCAGTCAAACGGATCTGG + Intronic
1133828490 16:9300357-9300379 TTTTTGGAGTCATACAGATCAGG + Intergenic
1134667848 16:16032269-16032291 GTTTTGCAGTTAAAAGAAACTGG - Intronic
1135263239 16:20999278-20999300 GCTTTGCAGCCAAACAGATCTGG - Intronic
1135673562 16:24395109-24395131 GCTTTGAAATCAAACAGATCTGG - Intergenic
1139366502 16:66436957-66436979 GCTCTGGAGTCAAACTGATCTGG + Intronic
1140767393 16:78173204-78173226 GCTTTGGAGTCATACAGATCTGG + Intronic
1141753566 16:85976008-85976030 GTTTTCAAGGCCAACGGATCAGG - Intergenic
1141923317 16:87150941-87150963 GGTTTGGAGTCAAACAGATCTGG - Intronic
1144771298 17:17761015-17761037 GTTTTGGAGTCAAACAGACCTGG + Intronic
1145897362 17:28467147-28467169 GTTTTGGAATCAAACAGATCTGG - Intronic
1147699295 17:42382427-42382449 GCTCTGAAGTCAAACAGATCTGG - Intronic
1148188549 17:45662222-45662244 GCTTTGCAGTCAGACGAATTTGG + Intergenic
1155432788 18:25778777-25778799 GTTTTGGAATCAAACAGACCTGG - Intergenic
1160536358 18:79596570-79596592 GTTTAGCAGTGAAACTGCTCCGG + Intergenic
1161808210 19:6457365-6457387 GCTTTGAAGTCAGACAGATCTGG - Intronic
1164689911 19:30203017-30203039 GTTTTGAAGTCAAACTGCTTTGG + Intergenic
925574507 2:5347471-5347493 GTTCCCCAGACAAACGGATCAGG + Intergenic
925585685 2:5461787-5461809 GTTTTGCTGTAAAAAGGAGCAGG + Intergenic
925671041 2:6310174-6310196 GTTTGTCAGTCAAAGGGGTCAGG - Intergenic
925739590 2:6994094-6994116 GCTTTGCAGTCAAGCAGACCTGG - Intronic
927019932 2:19006003-19006025 GCTTTGCAGTCAGACGTCTCTGG + Intergenic
930199827 2:48542332-48542354 GCTTTGGAGTCAAGCAGATCTGG + Intronic
930841573 2:55853229-55853251 GTTATGGAGTCAAACTGACCTGG + Intergenic
936898035 2:117450869-117450891 GCTTTGCAGTCAAATAGATCTGG - Intergenic
944930000 2:204507526-204507548 GTTTTGCAGTCTAACCTCTCAGG + Intergenic
946700914 2:222412318-222412340 GTTTTGGAGTCAAACAGATTTGG + Intergenic
1171021161 20:21585246-21585268 GTTTTGGAATCAAACAGATATGG - Intergenic
1172607806 20:36226524-36226546 GTTTTGGAGTCTAACAGATTGGG - Intronic
1172748210 20:37230026-37230048 GTTTTGGAGTGAAAAGGTTCTGG - Exonic
1173103206 20:40106943-40106965 TTTTTGAAGTCACACAGATCTGG + Intergenic
1173675526 20:44831755-44831777 GTTTTGGAGTTAAAGAGATCAGG - Intergenic
1173726115 20:45299125-45299147 GTTTTGGAGTCAGATGGACCTGG - Intronic
1173855004 20:46244624-46244646 GCTTTGGAGTCAAACAGACCGGG - Intronic
1175478517 20:59294444-59294466 GCTTTGAAGTCAAACAGACCTGG - Intergenic
1183080115 22:35450813-35450835 GTTTTGGAGTCAGATGGACCCGG - Intergenic
950127993 3:10522384-10522406 GCTGTGCAGTCAAACAGATATGG - Intronic
951144592 3:19212309-19212331 GTTTTGGAGTCAAGTGGGTCTGG - Intronic
951337076 3:21436304-21436326 GTGTTGAAGTCAGACAGATCTGG + Intronic
951420511 3:22478834-22478856 GTTTTGCAGCCATAAGGATGAGG - Intergenic
952337290 3:32414947-32414969 GCTTTGGAGTCAAACAGTTCTGG - Intronic
954075754 3:48178658-48178680 ATTTTGGAGTCAAACAGATGAGG - Intronic
955872107 3:63450261-63450283 GTTTTGAAGTCGGATGGATCAGG + Intronic
957236126 3:77594296-77594318 CCTTTGCAGCCAAATGGATCTGG - Intronic
960463084 3:117960655-117960677 GCTTTGCAGTCAGATGGACCTGG - Intergenic
961210270 3:125120209-125120231 GTTTTGCAATCAGACGAATTGGG - Intronic
961774186 3:129272235-129272257 TTTGTGCAGTCAAACTGAACAGG - Exonic
961983670 3:131108509-131108531 GTTTTACAGTAAAATGGATCAGG + Intronic
962311201 3:134328103-134328125 GCTTTACAGTCAGACAGATCTGG + Intergenic
964439271 3:156689072-156689094 GTTCTGAAGTCTAACCGATCTGG + Intronic
964689658 3:159436273-159436295 GCTTTGCAGTCAAGCAGAGCTGG + Intronic
965288968 3:166851636-166851658 GATTTGCAGTCACATGGATTAGG - Intergenic
965605561 3:170494916-170494938 GCTTTGGAGTCACACAGATCTGG + Intronic
966213430 3:177476493-177476515 GTTTTGGAGTCAAACAGAGCAGG - Intergenic
966919059 3:184600727-184600749 GTTTTGGAGTCAGAAAGATCTGG + Intronic
967233898 3:187366615-187366637 GTTTTGGAGTCACACAGACCCGG + Intergenic
970857214 4:20662636-20662658 GCTTTGGAGTCAAACATATCTGG + Intergenic
975954057 4:79814920-79814942 GTTTTGAAGTTAGACAGATCTGG - Intergenic
976162638 4:82219752-82219774 GTTTTGAAGTCAAACAGAACTGG + Intergenic
976498847 4:85762685-85762707 GGTTTGGAGTCAGACGGACCTGG - Intronic
978897505 4:113906646-113906668 GTTTTGGAATCAAACAGACCTGG + Intronic
979315596 4:119258191-119258213 ATTTTGAAGTCAGACCGATCTGG - Intronic
980161094 4:129163972-129163994 GTTTTTCAGTAAAAAGCATCTGG - Intergenic
981926479 4:150145796-150145818 GCTTTGCAGCCAAAAAGATCAGG - Intronic
982278498 4:153660785-153660807 GTTTTGCAGTCAGACAGACTTGG - Intergenic
983942621 4:173551691-173551713 GTTTTGGAGCCAGACAGATCTGG + Intergenic
984002452 4:174266652-174266674 GTTTTGAAGTCAGACAGACCTGG + Intronic
985642302 5:1069379-1069401 GTTGTGCAGAGAAACGGACCGGG + Intronic
988017148 5:25573849-25573871 CATTAGCAGTGAAACGGATCTGG - Intergenic
988045860 5:25952112-25952134 GCTTTGCAGTCACAGAGATCTGG - Intergenic
990226341 5:53659317-53659339 GTTTTGCAGTCAGACTAATATGG + Intronic
990705728 5:58527289-58527311 CTTTTGAAGTCAAACAGACCTGG + Intergenic
992472126 5:77068439-77068461 GTTATGCAATCAAACCTATCTGG - Intergenic
994114946 5:96051378-96051400 GTATTGAAGTCAAACTGTTCAGG + Intergenic
996955102 5:129173926-129173948 GCTTTGGAGTCAAAATGATCTGG + Intergenic
997748536 5:136321345-136321367 GTTTTGCAGTCAGGAGGACCTGG + Intronic
998801433 5:145873557-145873579 GTTTTGGAGTCAGATAGATCTGG - Intergenic
998807271 5:145930992-145931014 GTTTTGGAGTCTAACAGACCCGG - Intergenic
999729990 5:154469459-154469481 GTTTTCGAGTCAAATGCATCTGG + Intergenic
1000602562 5:163292471-163292493 GTTTTAGAGTCACACAGATCTGG + Intergenic
1000800660 5:165721989-165722011 GTTTTGGAGTCAAATGGACTGGG - Intergenic
1001369253 5:171180313-171180335 GTTTTAGAGTCAGACAGATCTGG + Intronic
1001931374 5:175675522-175675544 GTTTTGCAGTCCAACTGTCCTGG - Intronic
1001961337 5:175881975-175881997 GTATTGCAGTCTAACTGATATGG - Exonic
1005252985 6:23968749-23968771 GCTTTGAAGTGAAATGGATCAGG - Intergenic
1006720688 6:36148142-36148164 GTTTTGCATTCAAAAAGACCCGG + Intergenic
1007109130 6:39302997-39303019 ATTTTGGAGTCAAATAGATCAGG + Intronic
1010750237 6:79609343-79609365 CTTTTCCAGTCAAACTCATCTGG - Intergenic
1011811833 6:91141105-91141127 GTTTTGATGTCAAACTGACCTGG - Intergenic
1012864506 6:104601923-104601945 ATTTTGCAATCAAATTGATCTGG + Intergenic
1013618253 6:111864791-111864813 GTTTAGCAGTCACACAGACCTGG + Intronic
1014474504 6:121855713-121855735 GTTTTGCAGCCAACTGGATTCGG + Intergenic
1015930262 6:138352200-138352222 GCTTTGCAGTCAAGCTGAACTGG - Intergenic
1016799465 6:148154171-148154193 GTTTTGGAGTCAGATGGAGCTGG + Intergenic
1016938754 6:149467732-149467754 GTTTTGCAGCCTAAGGGGTCAGG - Intronic
1020443735 7:8246625-8246647 GTTTCTCAGTCAAATGGATGTGG - Intronic
1021422911 7:20465503-20465525 GTTTTAGAGTCAAACAGACCTGG - Intergenic
1021481946 7:21127919-21127941 GTTTTGCATTCAAGCAGATGAGG + Intergenic
1022259857 7:28693630-28693652 GTTTTGGAGTCAGACAGACCTGG + Intronic
1028485213 7:91349813-91349835 GCTTTTGAGTCAAACAGATCTGG + Intergenic
1038547794 8:28439292-28439314 GCTTTGCAGTCAGACAGACCTGG - Intronic
1038919827 8:32070241-32070263 GTTTTCAAGCCAAACGGAACTGG + Intronic
1040741924 8:50586390-50586412 GCTGTGCAGTCAGACAGATCTGG - Intronic
1041362572 8:57068503-57068525 CTTTTGGAGTCAGACAGATCTGG - Intergenic
1041828234 8:62123017-62123039 ATTGTAGAGTCAAACGGATCTGG - Intergenic
1044856480 8:96481350-96481372 GATATGGAGTCAAACAGATCCGG - Intergenic
1048615787 8:136074172-136074194 CATTTGGAGTCAAACAGATCTGG + Intergenic
1050611836 9:7361542-7361564 GTTCTGCAGTCAATTGGAACTGG + Intergenic
1053271753 9:36754755-36754777 ATTTTGGAATCAAACAGATCAGG + Intergenic
1059354631 9:113688958-113688980 GTTATGGAGTCAGACAGATCTGG + Intergenic
1060494196 9:124105979-124106001 GCTGTGCAGTCAAACAGATCTGG - Intergenic
1062508382 9:136890288-136890310 GTTTTAGAGTAAAACTGATCTGG + Intronic
1189298416 X:39935376-39935398 GTTTTGGAGTCAGATGGAACTGG - Intergenic
1189614929 X:42773465-42773487 GATTTGAAGTCAAAAAGATCTGG - Intergenic
1190429176 X:50361800-50361822 CTTTTGCAGTCAATCTGATTAGG - Intergenic
1191868746 X:65727402-65727424 GATTTGGAGTCAAACAGACCTGG + Intronic
1194679846 X:96839207-96839229 GTTTTGGAGTCAGACAGATTTGG - Intronic
1194937036 X:99962760-99962782 GTTTTGCAGCCAGACATATCTGG + Intergenic
1194959366 X:100217395-100217417 GCTTTGCATTCAAACAGATCTGG - Intergenic
1196587918 X:117451315-117451337 GTTATAGAGTCAAATGGATCTGG + Intergenic
1196754630 X:119147378-119147400 GTTTTGCAGCCAAGGGGAGCAGG + Intronic
1196937497 X:120744065-120744087 GCTTTGAAGTCAGACAGATCTGG - Intergenic
1198316735 X:135475240-135475262 GTTTTGCAGTCAGTCAGACCTGG + Intergenic
1198372024 X:135999011-135999033 GTTTTGCAGTCAAATACATGTGG + Intronic
1198711213 X:139506566-139506588 GTTTTGCAATCAGAAAGATCTGG + Intergenic
1198840082 X:140847076-140847098 TTTTTGCAATCAAACATATCAGG + Intergenic
1199264029 X:145809159-145809181 GCTTTGGAGTCAAACAGATCTGG - Intergenic
1199416253 X:147586469-147586491 CCTTTGCAGTCAAACATATCTGG - Intergenic
1199537556 X:148920278-148920300 GGTTTGCAGTCAAGAGGTTCAGG - Intronic