ID: 1133537749

View in Genome Browser
Species Human (GRCh38)
Location 16:6718506-6718528
Sequence CCAAAGTGAAACCACCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133537749 Original CRISPR CCAAAGTGAAACCACCTTTA AGG Intronic
900901183 1:5517063-5517085 CCAAAGGGCAACCTCCTTGAGGG - Intergenic
901172886 1:7275776-7275798 CCAAAAAGAAACCTCCTTCATGG + Intronic
901424596 1:9173889-9173911 CCAAAGACAAACCACCTCAAGGG + Intergenic
903193036 1:21667468-21667490 CCAGGGTGAAAGCACCATTATGG + Intronic
907432630 1:54422418-54422440 CCAAAGTTATACCATCTTTAAGG + Intergenic
908782024 1:67699642-67699664 CTAAAGTTAAACGACCTTCATGG + Intergenic
911621351 1:100069140-100069162 ACAAACTCAAACCACCTATATGG - Intronic
913371506 1:118104801-118104823 CAATAGAGAAACCACTTTTATGG + Intronic
913676866 1:121149112-121149134 CCAAACTCAAAACACATTTATGG + Intergenic
914028759 1:143937064-143937086 CCAAACTCAAAACACATTTATGG + Intergenic
916181410 1:162087049-162087071 CAAAAGTTCAACCACCTTTTGGG - Intronic
920260898 1:204686977-204686999 ACAAAAAGAAACCACCTTAATGG + Intergenic
1063001100 10:1923877-1923899 TCAAAGTGACACCTGCTTTATGG + Intergenic
1063131032 10:3177013-3177035 CCAAAGTTAAACTAAATTTAAGG - Intergenic
1067022651 10:42815118-42815140 ACAACCTGAAACCACCATTAAGG - Intronic
1068185244 10:53576838-53576860 TCAAAGTTAAAATACCTTTATGG - Intergenic
1069526015 10:69172416-69172438 CCAAAATGAAACCTGCTGTATGG + Exonic
1073011086 10:100360153-100360175 CCACACTGGAACCACCTCTAGGG - Intronic
1076648042 10:131967173-131967195 TCTGAGTGAAACCACCTGTATGG - Exonic
1078345268 11:10542173-10542195 CCAAGGTCAAACAACCATTAAGG + Intergenic
1079761701 11:24337695-24337717 GCAAAGTGAAGCCACCTCTGTGG + Intergenic
1087063886 11:94009775-94009797 CCAGAGGGAAACCATCTTTCAGG - Intergenic
1092929750 12:13304781-13304803 CCAAAATGCAACCACTTCTAGGG - Intergenic
1098501498 12:71197949-71197971 CCAAAGTGACAGCTTCTTTAAGG - Intronic
1100200123 12:92289112-92289134 CAAAAGGGAAATCACTTTTAGGG - Intergenic
1100807512 12:98302259-98302281 ATAAAGTGAAATCACCTTTCTGG + Intergenic
1102721958 12:115024115-115024137 CCAAAGTAAAGCCACGTTTTAGG + Intergenic
1106526678 13:30546836-30546858 CTACCGTGAATCCACCTTTAGGG + Intronic
1107558370 13:41538837-41538859 CCAAATTGTAAAGACCTTTAAGG - Intergenic
1111191434 13:84812348-84812370 CCTGAGTGCGACCACCTTTAGGG + Intergenic
1111313076 13:86515720-86515742 CCAAAGAAAAAACAACTTTAGGG - Intergenic
1111815332 13:93145888-93145910 ACAAAGTGAATGCATCTTTAGGG - Intergenic
1113885008 13:113654101-113654123 ACACAATGAAACCACATTTATGG - Intronic
1114671567 14:24414521-24414543 CCAAAGGGAAAGCACCTCTGTGG - Intronic
1116637409 14:47415389-47415411 AGAAAGTGAAACAACCTATAAGG - Intronic
1118708630 14:68502106-68502128 CCAAACTCAAACCACCTTTCTGG - Intronic
1124699298 15:31897789-31897811 TCAAAGTTATACCACATTTAAGG + Intergenic
1125134148 15:36322327-36322349 CAAAAGTGAAAAGACCTTTCTGG - Intergenic
1127158667 15:56156201-56156223 CCAAACTAAATCCACCTTTGAGG + Intronic
1128612259 15:69083665-69083687 ACAAAGTGAAACCTCCCTTAAGG + Intergenic
1133288457 16:4702279-4702301 CCAAAGTGAAACCTCCTCAGAGG + Intronic
1133537749 16:6718506-6718528 CCAAAGTGAAACCACCTTTAAGG + Intronic
1138292849 16:55862538-55862560 CCAAACTGAAAATAGCTTTATGG + Intronic
1140726234 16:77815425-77815447 CTAAAGTGCAACCTCCTTGAAGG - Intronic
1146881937 17:36449198-36449220 CCAAGGAGAAAACACCATTATGG + Intergenic
1150076675 17:62198149-62198171 CCACAGAGAAGCCACCATTAGGG - Intergenic
1153876772 18:9379877-9379899 ACAAAGTGATACCATGTTTATGG - Intronic
1159575882 18:70176773-70176795 CCAAACTGATACTACTTTTATGG + Exonic
1168523845 19:57073301-57073323 GCAACGTGGAACAACCTTTATGG - Intergenic
925343068 2:3149984-3150006 TCAAAGTGAAACCACCTCACTGG - Intergenic
925859401 2:8160240-8160262 TCAAAGTGAAGCCAGCGTTAGGG - Intergenic
928969515 2:37013154-37013176 AGAAAGTGAAACCACGTTTAAGG - Intronic
930262977 2:49169081-49169103 CCAAAGTGAAACCACAAAAAAGG - Intergenic
932537466 2:72614845-72614867 CCAAAGTGAACCCCTCTTTCTGG - Intronic
934959590 2:98659242-98659264 TCAAAGTGAAACCACTTTCTAGG + Intronic
936669211 2:114636840-114636862 TCAAAGTGAATCCCTCTTTATGG - Intronic
940538708 2:154982051-154982073 CCAAACTCAAATTACCTTTATGG + Intergenic
942138460 2:172953625-172953647 CCAAAGTGACAAAACATTTATGG - Intronic
942522881 2:176822764-176822786 GCAAAGTGAAATTAACTTTATGG - Intergenic
943730088 2:191293317-191293339 CCAGAGTCAAACGACATTTAGGG + Intronic
948715330 2:239857345-239857367 CCAAGGTGACATCACCTGTAAGG + Intergenic
1169644793 20:7798117-7798139 TCAAAGTGGAACCAACTCTATGG + Intergenic
1169966556 20:11224244-11224266 CCAAAGTGAATGCACCTTCCAGG + Intergenic
1170659890 20:18327444-18327466 CCAAAGTAAAACCACAATTGTGG - Intergenic
1181507516 22:23369904-23369926 CCAAACTGAAAGCAGCTTTATGG + Intergenic
1182525735 22:30917584-30917606 CCTAAGTCAAACCATCATTAAGG + Intergenic
1182772606 22:32806124-32806146 CCTAACTGATCCCACCTTTAAGG - Intronic
952712121 3:36442354-36442376 ACAAAAAGAAACCACCTTAAAGG + Intronic
952741661 3:36739781-36739803 CCAAAGTGAACTGACCTTCAAGG + Exonic
959946198 3:112127963-112127985 CCACATTGAAACCACACTTAGGG + Intronic
962617865 3:137146135-137146157 CAATAGTGCCACCACCTTTAAGG + Intergenic
962625048 3:137217588-137217610 CAAACGTGAACCCACCTGTAAGG + Intergenic
963212650 3:142710222-142710244 CAAAAGGAAAACCAGCTTTAGGG - Intronic
965103296 3:164330334-164330356 TCAAAGTGAAACAACAATTATGG + Intergenic
965531755 3:169777421-169777443 CCAAAGATAAACCATATTTAGGG + Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
966351210 3:179034282-179034304 CCATGGTAAAAGCACCTTTAGGG - Intronic
967377617 3:188822882-188822904 CCAAAGTAAATCCCCCTTTATGG + Intronic
968597841 4:1494587-1494609 CCTAAGTGAAGCCACCTCCACGG + Intergenic
972522940 4:39878638-39878660 TAAAAGTGAAACCACCTTTAAGG - Intronic
973119586 4:46504338-46504360 CCCAATTGAAACCACTTATATGG + Intergenic
974701798 4:65459333-65459355 CAAAAGTTAATCCAGCTTTATGG + Intronic
977601847 4:98941811-98941833 CCAAAGTGAGCTCACCTTGATGG + Intergenic
980801409 4:137755445-137755467 CCAAAGTGGAGACACCTTGAGGG + Intergenic
981304659 4:143234045-143234067 ACAAAGGGAACCCTCCTTTATGG - Intergenic
982068476 4:151674812-151674834 CAAAACAGAAACCACCTGTAAGG + Intronic
983439875 4:167768316-167768338 CCAAAGGTAAACAATCTTTAAGG - Intergenic
986600022 5:9463859-9463881 ACACAGTGAAAACACCTTCAGGG - Intronic
987143238 5:14966475-14966497 GCAACGTGAAACCCCCTTCATGG - Intergenic
989350918 5:40485778-40485800 CCAAAGAGAAACCAAGTTTGAGG + Intergenic
989497563 5:42126493-42126515 TCAAAGTGAGACCAACTCTATGG - Intergenic
990467130 5:56080925-56080947 CCTAAGTGAAACCACAATCAGGG + Intergenic
993841630 5:92887109-92887131 TGTAAATGAAACCACCTTTAAGG - Intergenic
993873136 5:93274934-93274956 CCCAAGGGAAGCCAGCTTTAGGG - Intergenic
1003737228 6:8890397-8890419 CCAAAGTAACACTACCTTTTAGG - Intergenic
1006382694 6:33709578-33709600 CCAAAGTGTAAAGATCTTTAAGG - Intronic
1008282112 6:49609191-49609213 CCGAAGTGAATGCACCTTCAAGG + Intronic
1010014631 6:71090363-71090385 ACAAAGTGAAACCACAGATAAGG + Intergenic
1011018340 6:82783187-82783209 AGAAAGTGAAACCAGCTATAAGG + Intergenic
1011502858 6:88010255-88010277 CCAAAGGGAAACCAGTTTGAAGG - Intergenic
1013888551 6:114999732-114999754 CAAAAGTGAAGCCACCCTTGAGG + Intergenic
1014272937 6:119353783-119353805 CCAAAGTAAAAATACCTTAAGGG - Intergenic
1020510330 7:9048529-9048551 CCAAAATGAGACCCCCTTTCAGG + Intergenic
1021077270 7:16320267-16320289 ATAAATTGAAACCACTTTTATGG - Intronic
1022198699 7:28095076-28095098 CCAAAGCCAAACCACTTTCAAGG + Intronic
1023785072 7:43698159-43698181 GCAAAGTCAAAACACATTTATGG + Intronic
1025008503 7:55375719-55375741 CCAAAGTCAAAGCATCTTCAAGG + Intronic
1026130326 7:67614940-67614962 CCAAACTGAGACTATCTTTATGG - Intergenic
1026368587 7:69675068-69675090 CCAAAGTGAAAGCACTATCAAGG - Intronic
1027690425 7:81337986-81338008 TTAAAATGAAATCACCTTTATGG - Intergenic
1028659769 7:93256196-93256218 AAAAAGTGTAACCATCTTTAAGG - Intronic
1029980977 7:104878847-104878869 AGAAAGTGAAACAGCCTTTAAGG + Intronic
1030147980 7:106375622-106375644 ACAAAGTGAATGTACCTTTACGG + Intergenic
1030694800 7:112573185-112573207 CCACAGTGAGATTACCTTTAAGG + Intergenic
1031486961 7:122338625-122338647 CCAAAGTGAAAATACCCTAATGG + Intronic
1032386258 7:131527114-131527136 CCAATGTGAAACTACTCTTAAGG - Intronic
1032483608 7:132266092-132266114 CCAAACTGAATCCAGCTCTAGGG + Intronic
1032644558 7:133808304-133808326 CCAAAGTGCATTAACCTTTATGG + Intronic
1036742953 8:11381837-11381859 CCAAAGGTAAACCACCATTTTGG + Intergenic
1037319224 8:17628422-17628444 GCAAAGTAAAAGCACCCTTAAGG - Intronic
1040997583 8:53417691-53417713 CCAAAATGTAACCACCTGAATGG + Intergenic
1043522874 8:81064994-81065016 CCGAAGAGACAGCACCTTTAAGG + Intronic
1044735590 8:95275081-95275103 GCAAAGTGAAACCAAATTGATGG + Intergenic
1047808205 8:128380530-128380552 CAAAAGTGAAGCCACCTCTGAGG - Intergenic
1052177055 9:25474684-25474706 CCACATTGAAACCACATTAAAGG + Intergenic
1055815308 9:80198385-80198407 CAAAATTGAAACCACTTTAAAGG - Intergenic
1058790441 9:108439372-108439394 CCAATGTGAAACTCCTTTTATGG - Intergenic
1059160072 9:112025634-112025656 CCAAAGTGAAACAATCTGTGAGG + Intergenic
1059775950 9:117475234-117475256 CCAAAGTGGAAGCACCTTCCAGG - Intergenic
1061194635 9:129101002-129101024 CCAAAGTCAGACCACCTGTGTGG - Intronic
1061305602 9:129731233-129731255 CCAAATTGGAACCATCTTTTTGG + Intergenic
1188018942 X:25135855-25135877 CCAAAGAGAAACAACCTATAGGG - Intergenic
1188801744 X:34540037-34540059 CCAAAATGACACTTCCTTTATGG - Intergenic
1194324529 X:92496659-92496681 CCAAAGTAATTCCACCTTTCTGG + Intronic
1194997375 X:100605886-100605908 CCAAAATGAAATCATTTTTAAGG - Intergenic
1194999659 X:100630744-100630766 CCAAAATGAACGCACCTTAAAGG + Exonic
1195112752 X:101664126-101664148 CCACAGTCACACCACCTTTAAGG - Intergenic
1198798507 X:140425452-140425474 CCACAGTAAATGCACCTTTAGGG + Intergenic
1200633272 Y:5615868-5615890 CCAAAGTAATTCCACCTTTCTGG + Intronic