ID: 1133539138

View in Genome Browser
Species Human (GRCh38)
Location 16:6731788-6731810
Sequence TAGGAAACAGCAGTGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 758}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133539138_1133539146 13 Left 1133539138 16:6731788-6731810 CCCTTCCCCACTGCTGTTTCCTA 0: 1
1: 0
2: 6
3: 58
4: 758
Right 1133539146 16:6731824-6731846 ACAACGTTTTCTAAAATCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133539138 Original CRISPR TAGGAAACAGCAGTGGGGAA GGG (reversed) Intronic
900918162 1:5652689-5652711 TAGGAGACAGGAGGGGGCAAGGG + Intergenic
900992774 1:6105617-6105639 CAGGAAGCAGCAGTGGGCAGGGG + Intronic
901581057 1:10243820-10243842 GAGGAAAAAGCTGCGGGGAAGGG + Intronic
901714646 1:11143601-11143623 CAGGAAAGAGCAATGGGCAAAGG - Intronic
902358791 1:15929771-15929793 TAGGAAACAGCAGATGGAAATGG + Exonic
902832947 1:19029481-19029503 TGGGAAACGACAGTGGGGCAGGG - Intergenic
903395773 1:23000848-23000870 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
903662855 1:24989314-24989336 AAGGAGGCAGCAGAGGGGAAGGG + Intergenic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
904556654 1:31369355-31369377 AGGGAAACAGGGGTGGGGAATGG - Intronic
904948895 1:34219987-34220009 TAGGGTCCAGCATTGGGGAAGGG - Intergenic
905238500 1:36566569-36566591 TAGGAAACACCAAGAGGGAAAGG - Intergenic
905641727 1:39594630-39594652 TTAGAAGCAGCAATGGGGAAGGG + Intergenic
905907854 1:41631548-41631570 TAGGAATCAGCAGTGCGATATGG - Intronic
905918542 1:41702994-41703016 TAGGAAAAAGCACCGGGCAAGGG - Intronic
906254511 1:44337674-44337696 TAGGAAAGAGGAGAGGAGAAAGG + Intronic
907551402 1:55308237-55308259 GAGGAAACTGGAGTGGGGAGGGG + Intergenic
908184404 1:61638654-61638676 TTTCAAATAGCAGTGGGGAAAGG + Intergenic
909170329 1:72285226-72285248 TGGGAAACAGCAGTCAGAAAAGG - Intergenic
909520716 1:76565024-76565046 TTGGAAACGGAAATGGGGAAGGG - Intronic
909671332 1:78191937-78191959 TAAAAACAAGCAGTGGGGAAAGG - Intergenic
909729682 1:78876099-78876121 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
910762900 1:90752472-90752494 AAGGCAAGAGCAGTGGGAAAAGG - Intergenic
911071367 1:93834417-93834439 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
911510411 1:98803322-98803344 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
912360090 1:109088102-109088124 AAGGAAACACCAGTGTGGTATGG + Intergenic
912763182 1:112386626-112386648 TGGGCACCAGGAGTGGGGAAAGG - Intergenic
913095526 1:115512452-115512474 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
913245376 1:116865910-116865932 ATGGAAACAGGAGTGGGGAAAGG - Intergenic
915157672 1:153891623-153891645 AAGGAAAAAGGAGAGGGGAAGGG + Intronic
915171881 1:153983694-153983716 AAGGAAACAGTAAAGGGGAACGG + Intronic
915527884 1:156487370-156487392 GTGGGAGCAGCAGTGGGGAAAGG - Intronic
915842820 1:159229829-159229851 TCTGAAACAGCTGTGGGGGAGGG - Intergenic
916462159 1:165036569-165036591 TAAGAAATAGAAGTGTGGAATGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917749879 1:178043623-178043645 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
918205024 1:182300490-182300512 CTGGAAACAGCAGGGAGGAAAGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920544001 1:206800609-206800631 TAGGAAACCGGGATGGGGAAAGG + Intronic
920671319 1:208005654-208005676 AAGGAAAGGTCAGTGGGGAAAGG + Intergenic
920908233 1:210190918-210190940 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
921003355 1:211067515-211067537 TAGGAAGCAGCACTGGGCAGGGG - Intronic
921432483 1:215081685-215081707 TAGCAAACAGCAGTTGGGATGGG + Intronic
921625824 1:217376789-217376811 AAGGAAACTGCAGAGAGGAAAGG + Intergenic
921751485 1:218799463-218799485 TAGTAACAAGCAATGGGGAAAGG - Intergenic
922626508 1:227050818-227050840 TGGGAAAGAAGAGTGGGGAACGG + Intronic
922972571 1:229755300-229755322 GAGCAAACATCAGTAGGGAAAGG + Intergenic
923626448 1:235617569-235617591 TAGAAGATAGGAGTGGGGAAGGG - Intronic
923636253 1:235699969-235699991 TAAGAACAAGCAATGGGGAAAGG + Intronic
923720581 1:236463728-236463750 TAGGAAGCAGAAATGGGGAATGG - Intronic
924180880 1:241437612-241437634 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
924407864 1:243770649-243770671 TAAGAAACAGCTGTCTGGAAAGG - Intronic
1063901268 10:10734680-10734702 AAGGAAATAGGAGTGGAGAAAGG + Intergenic
1065078153 10:22101612-22101634 GAGGAGAGAGCAGTGGGGCAGGG + Intergenic
1065437845 10:25720092-25720114 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1067426873 10:46217254-46217276 TGGGCAACAGCGGTGGGGCAAGG + Intergenic
1068043561 10:51857570-51857592 GAGTGAACAGCAGTTGGGAATGG + Intronic
1068242655 10:54324143-54324165 TAGGAAGCAGAAGTGAGGGAAGG + Intronic
1068473026 10:57489482-57489504 CAAAAAACAGCAATGGGGAAAGG + Intergenic
1068919340 10:62465975-62465997 TGAGAAGCAGCAGTGGGGACAGG + Intronic
1069678246 10:70265065-70265087 TGGGACTCAGCAGTGGGTAACGG + Intronic
1070797283 10:79223967-79223989 CAGGAATGAGCAGTGGGGAGGGG + Intronic
1070934397 10:80282046-80282068 TAGGAAACAGGAGGGTGTAAAGG - Intronic
1070941864 10:80355730-80355752 TTAGCAACAGCAGTGGGGAAAGG + Intronic
1071190523 10:83094058-83094080 CAAGAACAAGCAGTGGGGAAAGG + Intergenic
1071244648 10:83749854-83749876 TTGTAACCAGCAATGGGGAAGGG + Intergenic
1071490505 10:86133367-86133389 TGGTAAGCAGCAGTGGAGAAAGG - Intronic
1071920821 10:90348152-90348174 TAGAAAGCAGCAGTGTGGAGAGG + Intergenic
1071961330 10:90811048-90811070 ACGGAAAAAGGAGTGGGGAAAGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072710586 10:97713613-97713635 GAGGAGACAGCCGAGGGGAAGGG + Intronic
1074019248 10:109566001-109566023 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
1074342682 10:112649210-112649232 TACGAATTAGCAGTGGGTAATGG - Intronic
1074351249 10:112739155-112739177 GAGAAAACAGCACTGGGGACAGG - Intronic
1074925522 10:118065973-118065995 TAGGACACAACAGTGGTGATGGG + Intergenic
1074979527 10:118608574-118608596 AAGGAAGCAGCAGTGGGGCTGGG - Intergenic
1075160086 10:120016015-120016037 TAGGAACACACAGTGGGGAAAGG + Intergenic
1075818895 10:125288342-125288364 GAGGCTCCAGCAGTGGGGAAGGG + Intergenic
1075897961 10:126014188-126014210 TAGTAAACATCAGTGGCGAGGGG + Exonic
1075899483 10:126028537-126028559 TGAGAAAAAGCAATGGGGAAAGG + Intronic
1076038078 10:127217947-127217969 AAGAAAAAAGCAATGGGGAAAGG - Intronic
1076157323 10:128213733-128213755 TAGGAGCCTGCAGTGGGGACTGG + Intergenic
1076774220 10:132685340-132685362 TTGGAACCAGCACAGGGGAAGGG + Intronic
1077964994 11:7120343-7120365 TAGGAGACAGCATTGGCTAATGG + Intergenic
1078115583 11:8446699-8446721 TAGAAACAAGCAATGGGGAAAGG + Intronic
1078334765 11:10454919-10454941 TATGAAACAGCTGTGAGGACAGG + Intronic
1078360679 11:10665347-10665369 TAGTAAAAAGAAGTGGGGACAGG - Intronic
1078742970 11:14085406-14085428 AAAAAAAAAGCAGTGGGGAAAGG - Intronic
1079434355 11:20431880-20431902 TAGAAAACAGTACTGCGGAATGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG + Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1080938613 11:36888381-36888403 GGGGAAACTGCATTGGGGAAAGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081352028 11:42066016-42066038 AATGACACAGAAGTGGGGAAGGG + Intergenic
1081491809 11:43575263-43575285 CAGGAAACAGAAGAGGGAAAAGG + Intronic
1081905639 11:46667790-46667812 TATCAAACAGCAGTGAGGGACGG + Exonic
1082575311 11:54796405-54796427 TTGGATACAGCAGTTTGGAAAGG - Intergenic
1082941518 11:58710027-58710049 CAGGAGACAGCAGGTGGGAAAGG + Exonic
1084528512 11:69712647-69712669 TAGGATCCACCAGTGGGTAAGGG + Intergenic
1085445768 11:76599657-76599679 TAGTAAACAGCAGTTGTTAAAGG + Intergenic
1085458344 11:76678364-76678386 CAGGAAGCAGCCCTGGGGAAAGG - Intergenic
1085570438 11:77553680-77553702 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085627514 11:78084572-78084594 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1085988226 11:81809847-81809869 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
1086136053 11:83444974-83444996 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1086760806 11:90628148-90628170 GAGAAAACAGCAGTGTGGATGGG + Intergenic
1087525589 11:99306973-99306995 TAGGTCACACCAGTGGAGAATGG - Intronic
1087834469 11:102858769-102858791 CAGGACACAGCACAGGGGAAAGG - Intergenic
1087834899 11:102863597-102863619 GAGGAAACAACACTGGGGAGGGG + Intronic
1087839323 11:102906151-102906173 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088555687 11:111058567-111058589 CAGGAAACTGCAGAGGGGCAGGG + Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089217990 11:116847314-116847336 CAGGGAAGACCAGTGGGGAAAGG + Intronic
1089961638 11:122622148-122622170 AAGAAAACAGCAGTGGGGAGAGG + Intergenic
1090251486 11:125254838-125254860 TTGGAAACAGCAGATGGGGATGG + Intronic
1090526592 11:127544808-127544830 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1090773439 11:129943120-129943142 TAGGAAAGGGCAGTGGGAAGGGG - Intronic
1090802302 11:130180496-130180518 TAGAGAAAAGCAATGGGGAAGGG - Intronic
1090991513 11:131821127-131821149 AAGGCAACAGCAATGAGGAAAGG + Intronic
1091181192 11:133606021-133606043 TAGGAAAGACCCTTGGGGAAAGG - Intergenic
1091183898 11:133630434-133630456 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1091411534 12:243478-243500 CAAGAAACAGCAGTGAGGATGGG - Intronic
1091815442 12:3434432-3434454 CAGGAAATAGCAATGAGGAAAGG - Intronic
1091986576 12:4914579-4914601 TAGGTAGCAAAAGTGGGGAAGGG + Exonic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093358675 12:18198758-18198780 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
1093394076 12:18659074-18659096 TAGGAAACAGTAGGGCAGAAGGG + Intergenic
1094315829 12:29137056-29137078 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1094400899 12:30059619-30059641 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1094478904 12:30864438-30864460 TAGGAAATAGCAGTGAGGAAAGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095052324 12:37565779-37565801 GAGGAGCCAGCAGTGTGGAAGGG - Intergenic
1095778410 12:46033785-46033807 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1095806546 12:46326009-46326031 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1096178519 12:49538631-49538653 GAGGAAAATGCAGTGGGCAAGGG - Intergenic
1097450790 12:59734383-59734405 CAGGCACCAGGAGTGGGGAAAGG + Intronic
1097995420 12:65882555-65882577 AACCAAACAGCAGTGGGGACAGG - Intronic
1098356477 12:69617272-69617294 TAGGGCACAGCATGGGGGAAGGG - Intergenic
1098920139 12:76295264-76295286 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099017042 12:77356467-77356489 TGCGAAACACCACTGGGGAAAGG + Intergenic
1099112741 12:78582833-78582855 GAGGAAGGAGTAGTGGGGAACGG - Intergenic
1099226119 12:79971596-79971618 TAGGAATCAGCTCTGGGGACTGG + Intergenic
1099762810 12:86942444-86942466 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
1099835884 12:87909472-87909494 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1099978718 12:89573732-89573754 AAATAAACAGCAATGGGGAAAGG + Intergenic
1100141506 12:91624395-91624417 AAGAAAACAGCAATGAGGAAAGG - Intergenic
1100258997 12:92914107-92914129 TAGGGAAATGCAGCGGGGAAAGG - Intronic
1100773549 12:97950114-97950136 TGGGAAACAGGGGTGGGGGATGG + Intergenic
1101064049 12:101001295-101001317 TAGGAAACAACAGTGGTGAGAGG + Intronic
1101211901 12:102543204-102543226 TAGTGCACAGCAGTGGGAAAAGG - Intergenic
1101941181 12:109100200-109100222 TAAGAGACAGAAGTGGGGAGGGG - Intronic
1102055302 12:109892330-109892352 TAGGAGTTAGCAGAGGGGAAGGG + Intergenic
1102416886 12:112771077-112771099 TAGGGAACAGATGTGGGGGAAGG - Intronic
1102540852 12:113618061-113618083 CAGGAGACAGCAATGGGGCAGGG + Intergenic
1102727902 12:115081682-115081704 AAGGAAGCAGGAGTGGGAAAAGG + Intergenic
1102735344 12:115154159-115154181 TAGGAAGAACCATTGGGGAAAGG + Intergenic
1103039811 12:117685662-117685684 TAGAAGACAGCAGAGGGGAGGGG + Intronic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1104404484 12:128506207-128506229 CAGGAGAAAGCAGTGGGGAATGG + Intronic
1105032471 12:132893512-132893534 AAGGAAAGAGGAGTGGGGAAAGG - Intronic
1105060251 12:133143589-133143611 GAGTAAACAGCACTGGCGAATGG + Intronic
1105394698 13:20019378-20019400 TGGGCAACAGTAGTGGGGACAGG + Intronic
1105894745 13:24708391-24708413 TAGAAAACAAGAGAGGGGAAGGG - Intronic
1105985950 13:25567314-25567336 CAGGAAAAAGCAGTGGGTAGGGG - Intronic
1106093816 13:26624405-26624427 GAGGAAAGTGGAGTGGGGAAGGG + Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107220078 13:37971243-37971265 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
1108132292 13:47315677-47315699 CAAGAAAAAGCAATGGGGAAAGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109353134 13:61208442-61208464 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
1110439392 13:75510189-75510211 AAGGAAACAACAGAGTGGAAAGG - Intergenic
1110479587 13:75958950-75958972 AAGGAAACAGAGGTGGGAAATGG - Intergenic
1110493359 13:76135680-76135702 TAGGAAACAAAACTGGGGATGGG + Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111474266 13:88725215-88725237 TAGGCACCAGGAGTGGGGAGAGG - Intergenic
1111822761 13:93233694-93233716 AAGGAAGCAGGAGTGTGGAAGGG + Intronic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113181958 13:107639229-107639251 TATGAAAGAGCAGAGGGGAATGG - Intronic
1113349984 13:109519649-109519671 CAGGAAGCAACAGCGGGGAAGGG + Intergenic
1113370787 13:109723522-109723544 GAGAAAACAGCAGTGCAGAAGGG + Intergenic
1113409529 13:110072653-110072675 CAGGAAACAGCAAAAGGGAAAGG - Intergenic
1113479921 13:110613196-110613218 TAGGAAACAGAAGTGTGTGATGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115242325 14:31261864-31261886 CAGGAAAAAACAGTGGGGAGGGG + Intergenic
1116019380 14:39442013-39442035 TGGGAAGCAGCAGTGGGGCTGGG + Intergenic
1116035202 14:39619134-39619156 TAGGAAAAAGGTGGGGGGAATGG - Intergenic
1116179895 14:41519589-41519611 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1116507370 14:45700911-45700933 TATGAAATAGCAGTGGGGAAAGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117822352 14:59663147-59663169 CAAGAACAAGCAGTGGGGAAAGG + Intronic
1117828395 14:59726931-59726953 TGAGAAACAGCAGTGGGGGCGGG + Exonic
1118295135 14:64561477-64561499 TAAGGAAGAGCAGTGGAGAATGG + Intronic
1118758527 14:68863327-68863349 TGGGAAGAAGCAGGGGGGAAGGG + Intergenic
1118953159 14:70453344-70453366 TTTGAAATAGCTGTGGGGAAAGG + Intronic
1119060228 14:71466264-71466286 TAGTAAACAGCAGGTAGGAATGG - Intronic
1119248086 14:73130227-73130249 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1119288595 14:73476249-73476271 GTGGAAACAGGAGAGGGGAAAGG + Intergenic
1119895416 14:78215681-78215703 CAGGAAACAGCTGTGGACAAGGG - Intergenic
1119905414 14:78297786-78297808 AAGGGAAGAGGAGTGGGGAAGGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120251174 14:82063156-82063178 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1120493554 14:85205951-85205973 TCAGACACAGCAGTGAGGAAAGG - Intergenic
1120659714 14:87236941-87236963 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1120741931 14:88118104-88118126 TATCAAACAACAGTGGGGAAAGG - Intergenic
1121230207 14:92352034-92352056 TAGTAAACAGAAATGAGGAAGGG + Intronic
1121389789 14:93564208-93564230 ACGGAAAGAGGAGTGGGGAAAGG + Intronic
1121416570 14:93783407-93783429 GTGGAACCAGCACTGGGGAATGG - Intronic
1121703871 14:95976593-95976615 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1123478980 15:20613735-20613757 AAAGCAACAGCAATGGGGAAAGG + Intergenic
1123639032 15:22386650-22386672 AAAGCAACAGCAATGGGGAAAGG - Intergenic
1124604441 15:31160328-31160350 TAGGCACCAGCTGTGGGGAACGG - Intronic
1124719368 15:32098286-32098308 AAGGAAAAGGCTGTGGGGAAAGG + Intronic
1124853189 15:33360949-33360971 TAGGGAACAGCAGTGGGATTGGG - Intronic
1124919440 15:34011603-34011625 ATGGAAAAAGCAGAGGGGAAGGG + Intronic
1124922604 15:34040947-34040969 TAGACCATAGCAGTGGGGAAGGG + Intronic
1125031277 15:35078468-35078490 AAGGAAAAATCAGTGAGGAAGGG + Intergenic
1125291602 15:38154631-38154653 AAGAAAACAGCTCTGGGGAAAGG + Intergenic
1126431431 15:48589356-48589378 TATGAACAAGCAGTGGGGATGGG - Intronic
1126688068 15:51265563-51265585 TAGGAAACTGCAGTCAGGACTGG - Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127698190 15:61472082-61472104 TAGGCAACAGCAGCAGGGAGTGG - Intergenic
1128090927 15:64918420-64918442 GAGGAGACAGGATTGGGGAATGG - Intronic
1128179190 15:65586388-65586410 TAAGGAACAGCAGTGTTGAATGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129267173 15:74399983-74400005 TTGGAGACAGCAGTGGGAAGAGG + Intergenic
1129569031 15:76658801-76658823 CAAGAACAAGCAGTGGGGAAAGG + Intronic
1129736408 15:77967819-77967841 TAGGAAAAAGCAATGGAGAGTGG - Intergenic
1130170432 15:81506721-81506743 TAGGTAAGATCAGTGGGGTAGGG - Intergenic
1130426002 15:83800418-83800440 TAGGACACAGCAGGTGGCAATGG + Intronic
1130869725 15:87960999-87961021 TAGGAAAAAGCAGTTGGGCCTGG - Intronic
1130945725 15:88549568-88549590 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
1131159919 15:90099008-90099030 GAGGAGCCAGTAGTGGGGAAAGG - Intronic
1131684924 15:94758111-94758133 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1131952252 15:97693418-97693440 TAGGACAGTGCAGAGGGGAATGG - Intergenic
1132070374 15:98771378-98771400 TATGAAACGGCAGTGAGGAAGGG - Intronic
1132263236 15:100443933-100443955 ACGGAAAGAGGAGTGGGGAAAGG - Intronic
1132466422 16:79368-79390 TAGGAGACAGCTGTGTGGTAAGG - Intronic
1133099732 16:3471820-3471842 CAGGAACCAGCACGGGGGAAAGG - Intronic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1133573995 16:7069832-7069854 AAGGGAACATCAATGGGGAATGG - Intronic
1133668114 16:7990708-7990730 TTGGGAACGGCAGTGAGGAAGGG - Intergenic
1134224205 16:12379086-12379108 CAGGAAACAGGAGTGGAGTATGG - Intronic
1136530176 16:30862859-30862881 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
1138097958 16:54228382-54228404 TAGAACACAACAGTGGGGGAAGG - Intergenic
1138315244 16:56064130-56064152 CAGGAAACAGGAGTGGGAAAGGG - Intergenic
1141082096 16:81061564-81061586 TTGAAAACAGCAGATGGGAAAGG - Exonic
1141189495 16:81814170-81814192 TAAGATACAGCGGAGGGGAATGG + Intronic
1141239669 16:82254083-82254105 TACAAGACAGCAGTGGGGATTGG + Intergenic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143674097 17:8418166-8418188 AAGGAAACAACAGTGGACAAGGG - Intronic
1143725050 17:8838890-8838912 TGGGACACACCAGTGGGGACAGG + Intronic
1143755924 17:9067574-9067596 TAAGAGACAGGAGTGGAGAATGG - Intronic
1144170612 17:12656450-12656472 TATGCAACAGGAGTGAGGAAGGG - Intergenic
1145353986 17:22119458-22119480 AATGATACAGAAGTGGGGAAGGG - Intergenic
1145709914 17:26962729-26962751 TAGGCAAAAGCCGTGGGGGAGGG - Intergenic
1145722595 17:27088052-27088074 TGGGAAGAAACAGTGGGGAAGGG - Intergenic
1146294223 17:31636521-31636543 TTGCAAACAGCAGTTAGGAATGG + Intergenic
1146967012 17:37040601-37040623 TTGGCAACAGCAGTGGGGGTTGG - Intronic
1147885075 17:43678859-43678881 TAGGAATCAGATCTGGGGAAGGG + Intergenic
1147959310 17:44156605-44156627 TAGGAAATAGGAGTGGGGAAGGG - Intronic
1148232856 17:45947933-45947955 TAGGGAATGGGAGTGGGGAAGGG - Intronic
1148745098 17:49913742-49913764 TGGGAAACAGCAGGTGGGAGGGG + Intergenic
1149220734 17:54413154-54413176 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1149396436 17:56249748-56249770 CATGAGACATCAGTGGGGAATGG + Intronic
1149539131 17:57455482-57455504 TAGGAACCAGCGGTGGACAAGGG - Intronic
1150025634 17:61671337-61671359 TAGTAAACAGGAATGGAGAAAGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151361987 17:73594388-73594410 TAGGGAGCAGCACTGGGGGAGGG - Intronic
1151502966 17:74504035-74504057 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1151940309 17:77287841-77287863 CAGGAAACAGGAGTGGCGCAGGG + Intronic
1152097072 17:78278561-78278583 CAGGAGACAGCAGAGGGGACAGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1154133837 18:11759433-11759455 TAGGAAACACCAGGTGGTAATGG - Intronic
1154493703 18:14940472-14940494 GAGGGAACAGCAGCGTGGAATGG + Intergenic
1156114203 18:33767413-33767435 TTGTGAATAGCAGTGGGGAAAGG + Intergenic
1156237579 18:35219409-35219431 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1156251713 18:35358396-35358418 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
1156302472 18:35847563-35847585 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1156460392 18:37318401-37318423 TAGGCAACAGGAGAGGGGAATGG - Intronic
1156470230 18:37373227-37373249 TGGGAACCAGCAGTGAGAAAGGG - Intronic
1156958408 18:42994521-42994543 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
1156987291 18:43362794-43362816 AAGGAAACAGCACAGGAGAAAGG - Intergenic
1157054582 18:44211508-44211530 CAGAAACAAGCAGTGGGGAAAGG + Intergenic
1157514264 18:48299670-48299692 TAGGAAACAGCCAGGGGAAAGGG + Intronic
1157602816 18:48904689-48904711 TGGGGAAGAGCAGAGGGGAATGG + Intergenic
1157839737 18:50945478-50945500 TAGGAAAAAGAAGTAGGGAAGGG - Intronic
1157918850 18:51695876-51695898 AAGTAAACAGCAATGAGGAAAGG + Intergenic
1157936760 18:51882177-51882199 TTGGCATCAGCAGTGGGGAATGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158195461 18:54880597-54880619 GAGGAACCAGCAGTGTTGAAGGG - Intronic
1158252264 18:55502341-55502363 TATGAAACTGCAGTGAGCAAAGG - Intronic
1158735100 18:60070552-60070574 TAAGAAACACCAGGGGAGAAGGG - Intergenic
1159652974 18:70999556-70999578 TGGGAAGCAGCCTTGGGGAAAGG + Intergenic
1160541883 18:79628448-79628470 TCTGACACAGCAGTGGGGACAGG + Intergenic
1161676254 19:5651705-5651727 TGGGAAACACCAGGGAGGAAGGG - Intronic
1161684455 19:5696021-5696043 AAGGGGACAGCAGTGGGGAGGGG + Intronic
1161712374 19:5856227-5856249 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
1161898443 19:7099698-7099720 CAGGGGACTGCAGTGGGGAAGGG + Intergenic
1161937546 19:7381379-7381401 TCCGAAACAGCAGTGGGGCTTGG + Intronic
1162262467 19:9544044-9544066 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1163407111 19:17129622-17129644 GAGGAAACAGAAGTGCTGAAAGG - Intronic
1163899963 19:20092521-20092543 ATGGAAAGAGGAGTGGGGAAAGG + Intronic
1164081040 19:21861599-21861621 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164220249 19:23186887-23186909 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
1164237227 19:23347777-23347799 TAGGAAAAGGCAGTGGCCAAAGG - Intronic
1165443955 19:35846344-35846366 TAGGGCAAAGCAGTGGGGAGTGG + Intronic
1165571646 19:36780018-36780040 GAGGAGTCAGCAGTGTGGAAGGG + Intergenic
1165809093 19:38599976-38599998 TAGGAAAGAGCTGCAGGGAATGG + Exonic
1166347516 19:42175845-42175867 TAGGAAAAAGCAGCCGGGATGGG - Intronic
1166857302 19:45789063-45789085 TTAGAAGAAGCAGTGGGGAAGGG - Intronic
1166926912 19:46275402-46275424 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
1167562763 19:50235848-50235870 TAGGAAAGGGCAGTGGAGAGGGG - Intronic
1167642824 19:50691173-50691195 TAGGAAAAGGGAGAGGGGAAGGG + Intronic
1167671800 19:50857847-50857869 TGGGAAACAGCAGTGTGAGAGGG - Intronic
1168097072 19:54122001-54122023 TGGGAAAGGCCAGTGGGGAAGGG - Intronic
1168098095 19:54126773-54126795 TAGGAAACCCCACTGGGGAAGGG - Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925210634 2:2042883-2042905 CAGGGAAGAGCAGGGGGGAAGGG - Intronic
925503877 2:4538825-4538847 TGGGAAACAGCATTAAGGAAAGG + Intergenic
926643562 2:15263922-15263944 TAGGCACTAGCAGTGAGGAAAGG + Intronic
926705767 2:15836359-15836381 GAGGAAACAGAAGTGGGTCAGGG + Intergenic
926907487 2:17819541-17819563 TAGGAAACAGAGGCTGGGAAGGG - Intergenic
927134382 2:20085954-20085976 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
927550005 2:23990037-23990059 TAGGAGGCAGCAGTGGAAAAAGG - Intronic
927558535 2:24052459-24052481 TGGGAAATAGCACTTGGGAAAGG - Intronic
928827438 2:35439167-35439189 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
929004621 2:37383068-37383090 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
929392121 2:41481753-41481775 TAGGAAAGTACAGTGGTGAAAGG + Intergenic
929950246 2:46404490-46404512 CAGGTGACAGCAGTGGGGATAGG + Intergenic
930487141 2:52024175-52024197 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
930660658 2:54049637-54049659 TAAGAAGCAGCAGAGGGGCAAGG - Intronic
930767350 2:55097548-55097570 AAGGAGACAGCAGTGGGGGAAGG + Intronic
931200949 2:60096889-60096911 TCAGAGACAGCTGTGGGGAAGGG - Intergenic
931212552 2:60211800-60211822 GAGGAAACATCAGTGAGGGAAGG + Intergenic
931255337 2:60567158-60567180 CACAAAACAGCAGTTGGGAATGG + Intergenic
931651862 2:64475859-64475881 TAGCAAGCAGCAGTGGGGTGTGG - Intergenic
931774052 2:65524713-65524735 TAGGAAACAACTGTGGGAGAGGG + Intergenic
931829702 2:66038044-66038066 ATGGCACCAGCAGTGGGGAAAGG + Intergenic
931895580 2:66726064-66726086 AAGGAAACATAAGTGGAGAACGG - Intergenic
931948474 2:67335244-67335266 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
931972908 2:67610061-67610083 TATGCAACTGCAGTGGGAAAAGG - Intergenic
931974168 2:67624572-67624594 TAAAAAAAAGCAATGGGGAAAGG - Intergenic
932090536 2:68802068-68802090 TAGGCAGCAGCAGTGGGAATAGG + Intronic
932296061 2:70624255-70624277 ATGGAAAAAGGAGTGGGGAAAGG - Intronic
932816576 2:74866589-74866611 CAGGAAACAGCAGTGTAGACAGG - Intronic
932973731 2:76575917-76575939 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935758971 2:106300953-106300975 TAGTCGACAGCAGTGGGCAATGG - Intergenic
937016526 2:118611076-118611098 TATGGAACAGCAGATGGGAAGGG - Intergenic
937137504 2:119566704-119566726 TAGGAAAGACCAGTGAGGTAGGG - Intronic
937280075 2:120711633-120711655 TAGGAAAGAGCAGGGGGAGATGG + Intergenic
937352286 2:121173635-121173657 TAGGATATGGCAGTGGGGGAAGG + Intergenic
937868507 2:126771349-126771371 CAGGAGGCAGCAGTGGGGCAAGG + Intergenic
938964395 2:136375505-136375527 AAGGAAAAAGGAGTGAGGAAGGG + Intergenic
940107566 2:150116245-150116267 ATGGAAAGAGCAGTGGGGAAAGG - Intergenic
940140476 2:150486491-150486513 GAGGAGATAGCAGTGGGGAGAGG - Intronic
940254749 2:151716973-151716995 TAGTTAACAGCAGTGGGCAGTGG - Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940722290 2:157295153-157295175 TAGGAGACAGGAGTGGGGAATGG - Intronic
940901696 2:159131631-159131653 AAAGAAAGACCAGTGGGGAAAGG - Intronic
941080618 2:161056562-161056584 CAGGACACAGCAGTAGGGTACGG + Intergenic
941277039 2:163502576-163502598 TAGAAACAAGCAATGGGGAAAGG + Intergenic
941478493 2:165976714-165976736 CAGAAACCAGCAATGGGGAAAGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943413838 2:187573429-187573451 AAAAAAACAGCAATGGGGAAAGG + Intergenic
943450356 2:188036871-188036893 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
943721904 2:191213442-191213464 TAGGAAAAAGCAGTGGATTAAGG - Intergenic
943865559 2:192921702-192921724 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
943909061 2:193540176-193540198 TAGAAAAAGGCAGTGTGGAAAGG + Intergenic
944087213 2:195863451-195863473 TAGGAACGAGGGGTGGGGAAGGG - Intronic
944157874 2:196626872-196626894 TAGCGAACAGCAGTGGAAAATGG - Intergenic
944251280 2:197581913-197581935 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
944605236 2:201346570-201346592 TAGGAAAAAGCGGTGGGAATCGG - Exonic
944901549 2:204221667-204221689 AAGGAAGCAGGACTGGGGAAAGG - Intergenic
945116134 2:206409868-206409890 TGGGAAACTGCAGGGGGGCAGGG + Intergenic
945173697 2:207021049-207021071 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
945301235 2:208218138-208218160 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
945315730 2:208369040-208369062 TAGGAAAAAGTAGTGGGATATGG + Intronic
946667082 2:222062012-222062034 TAGGAAACTGCAGAAGGAAAGGG + Intergenic
946780829 2:223191903-223191925 ATGGAAAGAGGAGTGGGGAAAGG + Intronic
947450998 2:230208840-230208862 TAGGAAAAGGCAGAGAGGAAAGG + Intronic
947548493 2:231029363-231029385 AGGGAAACTACAGTGGGGAAAGG + Intergenic
947770766 2:232668425-232668447 GAGGAAACAGCTCTGGGGAAGGG + Intronic
947943872 2:234083004-234083026 TAGGTAAGAGAAGTGGGAAAGGG + Intergenic
948834860 2:240620959-240620981 TAGGCAAGATCAGTGGGGGAGGG + Intronic
1169915551 20:10679108-10679130 TATGAAACAGGATTGGGGCAGGG - Intergenic
1170102237 20:12714941-12714963 TAGGGGACAGGAGTGAGGAAAGG - Intergenic
1170102248 20:12715013-12715035 TAGGGGACAGGAGTGAGGAAAGG - Intergenic
1170183889 20:13565291-13565313 TAGAAAACAACATAGGGGAAAGG + Intronic
1170213559 20:13869106-13869128 GAGGAAAGAGCAGTGGGCCATGG - Intronic
1170529356 20:17274667-17274689 CAGGTAACAGCAGTTGGGACTGG - Intronic
1170680216 20:18519668-18519690 ACGGAAAGAGGAGTGGGGAAAGG + Intronic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171086216 20:22240344-22240366 AAGGAAGCAGCAGTGGGCAGAGG - Intergenic
1171094286 20:22316609-22316631 TTGGAAATAGCAGAGGGAAAAGG + Intergenic
1171343907 20:24451523-24451545 CAGGCAGCAGCAGTGGTGAATGG - Intergenic
1172168759 20:32915960-32915982 TAGGTAACAGCAGCTGGGCAGGG - Intronic
1175253086 20:57621519-57621541 CAGGAAACACAATTGGGGAATGG - Intergenic
1175570374 20:60014463-60014485 GAGGACACAGCAGCTGGGAAGGG - Intronic
1175604468 20:60300807-60300829 TATGAGACAGCCGTGTGGAAAGG + Intergenic
1175707318 20:61190051-61190073 TAGGAAACAGCAGAGAGAATTGG + Intergenic
1176149968 20:63585772-63585794 GAGGACACAGGAGTGGGGAGTGG - Intergenic
1176690766 21:9905278-9905300 AAGGAGATAGCAGTGGGAAATGG + Intergenic
1176977932 21:15345302-15345324 TAGGAAACAGAAGAAGGGAAAGG - Intergenic
1177030955 21:15981868-15981890 ATGGAAAGAGAAGTGGGGAAAGG + Intergenic
1177062826 21:16395620-16395642 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1177102892 21:16917634-16917656 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1178420209 21:32437331-32437353 GAGACCACAGCAGTGGGGAAGGG - Intronic
1178865292 21:36321718-36321740 AAGGAGAGAGAAGTGGGGAAAGG - Intronic
1178990402 21:37350392-37350414 TAGAAAATAGGAGTGGGAAAAGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179650149 21:42803109-42803131 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1179780206 21:43694731-43694753 TGGGAGGCAGCAGTGGAGAAGGG - Exonic
1180107364 21:45629007-45629029 CAGGAAACAGGAGTGGGAAGAGG + Intergenic
1180228985 21:46414904-46414926 TAGCAAACAGCAGGGAGGAGGGG - Intronic
1180746657 22:18093882-18093904 TAGGAAAGGGCAGGCGGGAAGGG + Exonic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1182309311 22:29393445-29393467 TGGGTGACAGAAGTGGGGAAGGG + Intronic
1182862514 22:33572309-33572331 TAAGAAACAGAAGTGGGGCGGGG + Intronic
1203289282 22_KI270735v1_random:17899-17921 TAGGCAAAAGCCGTGGGGGAGGG + Intergenic
949140227 3:623871-623893 TAGGAAAGAGCACTGAGGAAGGG - Intergenic
949315809 3:2753532-2753554 AAGGATACAGCAGTGGGAGAAGG + Intronic
949376469 3:3395718-3395740 TAATAACAAGCAGTGGGGAAAGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950144703 3:10640709-10640731 CAGGAGGCAGCAATGGGGAATGG - Intronic
950796810 3:15516829-15516851 GAGGAAAAAGCAGGAGGGAATGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951143632 3:19198718-19198740 TTGAAAACATCAGTGGGGAGTGG - Intronic
951316101 3:21191265-21191287 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
951384371 3:22026392-22026414 CAGGTAACTGCATTGGGGAAAGG + Intronic
951507323 3:23462546-23462568 TAGCAAAGAGGAGTAGGGAAAGG - Intronic
951762569 3:26162444-26162466 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
951839833 3:27022606-27022628 TAGGAAGCAGAAGTGGGAGAAGG + Intergenic
951981073 3:28567825-28567847 CAGGAGACAGCAGTCGGCAAGGG + Intergenic
952297117 3:32071383-32071405 ATGGAAACAGGAGTGGGGAAAGG - Intronic
952426006 3:33174914-33174936 TATGTAACAGCTGTGGGGAGTGG - Exonic
953042943 3:39271074-39271096 TGGGAAAAAGGAATGGGGAAGGG - Intronic
953302713 3:41794859-41794881 CAGGAAACAGCAAGGAGGAAAGG + Intronic
953355930 3:42256416-42256438 ATAGAATCAGCAGTGGGGAATGG - Intergenic
953700919 3:45195144-45195166 TAGAAGAGAGCAGTGGGGCAGGG - Intergenic
953918968 3:46938886-46938908 GAGGAAACAGGATTAGGGAAAGG - Intronic
954161541 3:48726387-48726409 ATGGAAACAGGAGTGGGGAAAGG + Intronic
954619103 3:51985672-51985694 CAGGAGACAGCAATGGGGGATGG + Intronic
954671555 3:52293897-52293919 AAGGAAACAGCACTGGGGGGTGG - Intergenic
954685512 3:52368050-52368072 GAGGAAACATCAGTGGTGAGGGG + Intronic
955253591 3:57307308-57307330 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956249284 3:67218857-67218879 TAGGAAGCACCAGTAGGGGAGGG + Intergenic
956548776 3:70436930-70436952 ATGGAAACAGGAGTGGGGAAAGG + Intergenic
956723171 3:72135992-72136014 TAGGAAGCAGGAGTGTGGAGTGG - Intergenic
956798973 3:72739769-72739791 AAGGAAACAGGAGTGGGGCAGGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957366822 3:79235662-79235684 AAGGAAACAGCACTGGGCAGAGG - Intronic
957576173 3:82010893-82010915 AAGGAAGGAGCAGTAGGGAAGGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958507550 3:94999460-94999482 TAAAAACCAGCAATGGGGAAAGG - Intergenic
959160231 3:102715260-102715282 AAAAAAACAGCAGTGGGGGATGG - Intergenic
959499457 3:107088839-107088861 CATGGATCAGCAGTGGGGAATGG + Intergenic
959566074 3:107834492-107834514 TAAGAAGAAGCAGGGGGGAATGG + Intergenic
959973036 3:112428444-112428466 GAGGAGACTGCACTGGGGAATGG - Intergenic
961612953 3:128155039-128155061 TAGGACAGAGGAGTGGGTAAGGG - Intronic
962639711 3:137372566-137372588 TAAAAACAAGCAGTGGGGAAAGG - Intergenic
962660855 3:137599120-137599142 CAAGAAAGAGGAGTGGGGAAAGG - Intergenic
962710622 3:138082704-138082726 AAGGAGACAGCAGTGGGGAATGG - Intronic
962915086 3:139894044-139894066 TCCCAAACAGAAGTGGGGAAGGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963319983 3:143801095-143801117 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
963520655 3:146357195-146357217 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
963732881 3:148989831-148989853 TAGGAAACAGAAAAGTGGAAAGG - Intergenic
963767230 3:149350283-149350305 TTGGAAACACCATTGGGAAAGGG - Intergenic
964300038 3:155277250-155277272 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
964502775 3:157366796-157366818 TAGGAAAAAGCAATGCAGAAGGG + Intronic
964533169 3:157690066-157690088 CAGGAACAAGCAATGGGGAAAGG + Intergenic
964983826 3:162716033-162716055 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
965262436 3:166502849-166502871 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
965335342 3:167426400-167426422 TGGAAAAGAGGAGTGGGGAAAGG - Intergenic
965336551 3:167434860-167434882 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
965624643 3:170674431-170674453 ACGGAAAGAGGAGTGGGGAAAGG + Intronic
966067047 3:175831318-175831340 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
966279527 3:178211177-178211199 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
966589144 3:181660716-181660738 TAGAAATTAGCAGTGGGAAATGG + Intergenic
967425651 3:189324361-189324383 TTGGAAAGAGCAGTGGGCTAGGG - Exonic
967767309 3:193295389-193295411 GAGGAGATAGCAGTGGAGAAAGG - Intronic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
968413026 4:405645-405667 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
968774496 4:2532294-2532316 TAGGGAAGAGTAGTGGGGAGAGG - Intronic
968907701 4:3462357-3462379 ACGGGAACAGCAGTGGGGAGGGG - Intergenic
969338406 4:6525631-6525653 TTGGAATCAGCAGTAGGGCAAGG - Intronic
969402436 4:6964411-6964433 TGGGAAACTGCAGTCAGGAAGGG - Intronic
969709817 4:8836269-8836291 CAGGAAACACAGGTGGGGAATGG - Intergenic
969882092 4:10183091-10183113 TAGGATACAGCAGTGGCAGAGGG + Intergenic
970029010 4:11655811-11655833 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
971214382 4:24649902-24649924 AAGGAAACAGCTGTGGATAATGG - Intergenic
971720004 4:30232977-30232999 TAGGAAACAACAGTGGGCCCAGG + Intergenic
972594854 4:40520575-40520597 TAGGAAATAGTAGAGGAGAAAGG + Intronic
972606365 4:40617803-40617825 TAGGAAACTGTAATGGGGAAAGG - Intronic
973078784 4:45963479-45963501 TAAAAACAAGCAGTGGGGAAAGG - Intergenic
973817253 4:54630522-54630544 GAGGAAACAGGACTGAGGAAGGG - Intergenic
974205422 4:58696494-58696516 CAGAGAACAGGAGTGGGGAAGGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975551228 4:75615023-75615045 CAAGAAACAGCATTGGGGAAGGG + Intronic
976132900 4:81903946-81903968 GAGGCAAGAGCAATGGGGAATGG - Intronic
976558783 4:86478224-86478246 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
976719384 4:88155108-88155130 ATGGAAAGAGGAGTGGGGAAAGG + Intronic
977039102 4:91992414-91992436 CAGGACAAAGAAGTGGGGAATGG + Intergenic
977308244 4:95352110-95352132 TAAGAAACAGCAGAGTGGAGTGG - Intronic
978010495 4:103676599-103676621 TAAAAACAAGCAGTGGGGAAAGG + Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979284731 4:118909546-118909568 TGGGACACAGCACTGTGGAAGGG + Intronic
979707786 4:123741020-123741042 TGGGAAACACCAGTGAGAAAAGG + Intergenic
979727717 4:123984265-123984287 TAGGAAAAAGGAGGGGGGAAAGG - Intergenic
979822230 4:125189219-125189241 TTGGAAGCAGCAGTGTGGCAGGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980285159 4:130771005-130771027 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
980309109 4:131102584-131102606 CAGGCACCAGGAGTGGGGAAAGG + Intergenic
980472223 4:133265769-133265791 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
980491181 4:133531632-133531654 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980626657 4:135381805-135381827 TCAGAAACAACAGTTGGGAAAGG - Intergenic
980861207 4:138501491-138501513 TAGGAAAAAGCAGTGATGTATGG + Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981143709 4:141300878-141300900 TTGAAAACAGCAGGGTGGAATGG + Intergenic
981152490 4:141395586-141395608 TAGAATGCAGAAGTGGGGAAAGG - Intergenic
981462613 4:145030410-145030432 AAGGTAACTGCACTGGGGAAAGG + Intronic
982233918 4:153234419-153234441 TAGGAAATAGCAGAGGGCATCGG + Intronic
982413984 4:155110550-155110572 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
982617025 4:157651609-157651631 TAGGTAACACTGGTGGGGAAAGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983345774 4:166524167-166524189 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
983707883 4:170681129-170681151 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
983984240 4:174038786-174038808 GAGGAAACTGCAGTCCGGAAAGG - Intergenic
984087377 4:175329665-175329687 TGTGAAACAGCATTAGGGAATGG - Intergenic
984098829 4:175463465-175463487 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
984200430 4:176713981-176714003 AAGGAAGCAGCAGTGGAGACGGG + Intronic
984437480 4:179724089-179724111 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
984520145 4:180792267-180792289 TGGGAAGCAGCACTGGGGATAGG + Intergenic
984993023 4:185399743-185399765 TAGAAAATACCAGTGGGAAAAGG + Exonic
986076443 5:4342645-4342667 TAGGAAGCAGGAGTGGGCAACGG - Intergenic
986368733 5:7060216-7060238 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
987100986 5:14591002-14591024 TAGAAAACAGAACTGGGGAAGGG + Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988541141 5:32111300-32111322 TAAGACACAACAGTGGGGCAAGG - Intergenic
988622113 5:32833687-32833709 GAGGAAACAGGAGGGGGAAAGGG - Intergenic
988978321 5:36537745-36537767 TAGGAAGCAGGAGTGAGGGATGG - Intergenic
989142981 5:38220531-38220553 TAGGAAAGAGAAGTGGGTAGAGG + Intergenic
989288352 5:39730598-39730620 TAGGAAACAGAATTGGGGTAAGG + Intergenic
989420392 5:41232274-41232296 TAGGAAACAGAAGTGAGTAAGGG - Intronic
989614930 5:43329844-43329866 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990174248 5:53089578-53089600 AAGCAAACAGCTTTGGGGAAGGG - Intronic
990508631 5:56470008-56470030 CAGGGAAGAGCAGTGGGGACTGG + Intronic
990659717 5:57999810-57999832 GAGAAAAAAGCAATGGGGAAAGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
991621264 5:68547682-68547704 TAGGAATCACTGGTGGGGAAAGG - Intergenic
991649061 5:68833305-68833327 TAGGAAAAAGGAGAGGGGAAGGG + Intergenic
991772557 5:70053350-70053372 CAGGAAACAGCACTTGGGGATGG + Intronic
991851850 5:70928774-70928796 CAGGAAACAGCACTTGGGGATGG + Intronic
991904249 5:71492689-71492711 AAGGAAACAGCAGAGTGAAAAGG - Intronic
992736594 5:79727889-79727911 CAGGATACAGAAGTGTGGAAAGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994034286 5:95180804-95180826 TGGGAAGCAGCAGCTGGGAAGGG - Intronic
994325128 5:98438367-98438389 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
995163333 5:109008328-109008350 TTGGAAATAGCTGTGGGAAATGG - Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996018042 5:118562804-118562826 GGGAAAACAGGAGTGGGGAAGGG + Intergenic
996052394 5:118948798-118948820 AAGGAAAGAGGAGTGGGGAAAGG + Intronic
996483898 5:124008025-124008047 GAAGAAATAGCAGTGGGGAGGGG - Intergenic
996745218 5:126841622-126841644 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
998370108 5:141655465-141655487 CAGGAGACAGGGGTGGGGAATGG + Intronic
999337459 5:150734686-150734708 TAAGCCACAGCAGTCGGGAAGGG + Intronic
999874801 5:155792135-155792157 TTGACAAAAGCAGTGGGGAAAGG + Intergenic
1000509634 5:162165223-162165245 TAGAATACAGGAGTGGGGGAGGG - Intergenic
1000598243 5:163241105-163241127 TAGGAAACATAAATGGGGCAAGG - Intergenic
1000885108 5:166741167-166741189 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1001134076 5:169088091-169088113 AAGAAAACAGCGGTAGGGAATGG - Intronic
1001424997 5:171617175-171617197 GAGGAAACATCAGGGGTGAAGGG - Intergenic
1001717392 5:173827717-173827739 TAGGATACAGAAGGTGGGAAAGG + Intergenic
1002199319 5:177518420-177518442 TAGGCAACAGCATTGCGGCAAGG + Intergenic
1002516085 5:179760039-179760061 AAGGAAACAGGACTGGGGAGAGG + Intronic
1002660111 5:180786041-180786063 CAGGAAGCAGGAGAGGGGAAGGG - Intergenic
1003162782 6:3650637-3650659 TGGGAAACAGGAGTGGGGCTGGG - Intergenic
1003961168 6:11210793-11210815 TAGAAAAGAGAAGTGAGGAAGGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005806899 6:29482185-29482207 CAGAAAAAAGCAATGGGGAAAGG - Intergenic
1006102266 6:31693003-31693025 TGGGAAACAGCAGCGAGGAGAGG - Intronic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1007078962 6:39085354-39085376 CGGGAAACAGCAGGGAGGAAGGG - Intronic
1007496008 6:42260744-42260766 TAGGAAGCAGCAGGGGGTGATGG + Intronic
1007920701 6:45607070-45607092 GAGGGAAGAGCAGTGGGGAGGGG + Intronic
1008036551 6:46751656-46751678 TAGGAAATAGCACTGGAGGATGG + Intronic
1008476808 6:51942144-51942166 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009940000 6:70280557-70280579 TAGAAAACAGCAGCGGGTACTGG - Intronic
1010071504 6:71750622-71750644 AAGGAAAGAGGAGTGGGGAAAGG + Intergenic
1010272723 6:73932754-73932776 TAGGAAAGAGCATTTGGGAAAGG - Intergenic
1010612493 6:77971066-77971088 TAAAAACAAGCAGTGGGGAAAGG + Intergenic
1011595380 6:89011040-89011062 TAGAAAACAGAAGTGAGGTACGG - Intergenic
1012532040 6:100249928-100249950 TTGGAGAAAGGAGTGGGGAAAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013391393 6:109689657-109689679 CAGGAAACAGCAGCAGGGAGGGG - Intronic
1013799431 6:113924680-113924702 TAGGAAGGAACAGAGGGGAAAGG + Intergenic
1014115106 6:117661621-117661643 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1014492830 6:122082872-122082894 AATGATACAGAAGTGGGGAAGGG - Intergenic
1014984267 6:127982595-127982617 TAGGGAAGAGCAAAGGGGAAAGG - Intronic
1015070457 6:129087777-129087799 TAGTAAACAGCAGAGGGTACAGG + Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016009906 6:139128758-139128780 GTTGAAACAGCAGTGTGGAAAGG + Intergenic
1016204746 6:141456455-141456477 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
1016249083 6:142019449-142019471 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016634794 6:146275557-146275579 TAGGAAAAAGGAGAGAGGAAGGG - Intronic
1017352119 6:153454675-153454697 CAGGAACAAGCAATGGGGAAAGG - Intergenic
1017372938 6:153735132-153735154 CAGGAAGCAGCAGTGGGGCCAGG - Intergenic
1017563814 6:155662806-155662828 AAGGAAAAGGCATTGGGGAAAGG + Intergenic
1018135937 6:160778522-160778544 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1018488821 6:164271241-164271263 AAGGAAAGAGCAATGGGGCAAGG - Intergenic
1018850475 6:167586532-167586554 TAAGAACATGCAGTGGGGAAAGG + Intergenic
1019059823 6:169248979-169249001 AAGGGAACCGCAGTGGAGAAGGG + Intronic
1019319349 7:408625-408647 TAGGATACAGGAGTGGTGAGTGG + Intergenic
1019408590 7:896985-897007 GTGGACACAGCTGTGGGGAAGGG - Intergenic
1019626309 7:2017597-2017619 TGGGAGGCAGCGGTGGGGAAGGG + Intronic
1019950345 7:4367239-4367261 GAGAAAACAGCAATGGGGACTGG + Intergenic
1020131051 7:5558846-5558868 TAGGAAGCAGCTGCCGGGAATGG + Intronic
1020137003 7:5593190-5593212 GAGGAAACGGCAGTCGGGACCGG - Exonic
1020540922 7:9460618-9460640 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1021393834 7:20124222-20124244 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1021637564 7:22707048-22707070 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1022447626 7:30482873-30482895 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
1022572573 7:31469102-31469124 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
1023834326 7:44059479-44059501 TGGGGGACAGCAGTGGAGAAGGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024535201 7:50424633-50424655 TTAGAAATATCAGTGGGGAAAGG + Intergenic
1024739006 7:52335550-52335572 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1026093098 7:67317575-67317597 TAAGAAACAACAGTGGGGAGAGG - Intergenic
1028161802 7:87494128-87494150 AAGTAAACAGCAGTGTGGAGGGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028589656 7:92481687-92481709 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1029500427 7:100925799-100925821 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1029959921 7:104679913-104679935 TAGGGAAAAGCAGAGGGGCAAGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030730805 7:112986265-112986287 TGGGAAAGAGAAGTGGGAAATGG + Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031296827 7:120012521-120012543 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1031422229 7:121565892-121565914 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
1031777553 7:125921213-125921235 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1031895751 7:127346770-127346792 AAGGAAGCAGGAGCGGGGAAGGG + Intronic
1032223267 7:130010211-130010233 GTGGAAACAGCAGTGGGGAAAGG + Intergenic
1033464820 7:141580900-141580922 ATGGAAAGAGGAGTGGGGAAAGG + Intronic
1033646440 7:143308413-143308435 TAGGAAACAGCTGTGGGAGCTGG + Intergenic
1034239647 7:149600118-149600140 CAGGAAACACCAGTAGGGAGTGG - Intergenic
1034417582 7:150973332-150973354 TAGAAAATAGCAGTTGGGAACGG - Intronic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1035379847 7:158430823-158430845 GTGAAAACAGCAGTGAGGAAGGG + Intronic
1035421312 7:158731086-158731108 TAGAGAACAGCGGTGGGGGATGG - Exonic
1035595590 8:854882-854904 CAGGAAACAGTAGTGAGGAACGG + Intergenic
1035880454 8:3240286-3240308 ACGGAAAGAGGAGTGGGGAAAGG + Intronic
1035909585 8:3550622-3550644 AAGGAAACAGCACTAGGCAAAGG - Intronic
1036070706 8:5438708-5438730 ATGGAAACAGAAGTGGGGAAAGG + Intergenic
1036706494 8:11050834-11050856 TGGGGAGCAGCACTGGGGAATGG - Intronic
1037372138 8:18191720-18191742 TGAGAAAAAGCAATGGGGAAAGG + Intronic
1038247142 8:25869372-25869394 TAGGAAAGAGCAGCAGGGCAAGG - Intronic
1038477774 8:27880076-27880098 AAAGAATAAGCAGTGGGGAAAGG + Intronic
1039246163 8:35610804-35610826 TAGTATACATCAGTGGGGTATGG + Intronic
1039380177 8:37077488-37077510 GAGGGAACTGCAGTGGTGAAGGG + Intergenic
1039380668 8:37081911-37081933 TTGGAAACAACAGTGGGAAGGGG + Intergenic
1040964284 8:53068683-53068705 TTGAAAAAAGCAATGGGGAAAGG - Intergenic
1041220209 8:55643358-55643380 CAAGAATGAGCAGTGGGGAAAGG - Intergenic
1041266580 8:56071540-56071562 TGGGTAACAGCAGTAGGGGAGGG + Intronic
1041651624 8:60308564-60308586 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
1041686319 8:60648143-60648165 TAGGGAACAGCATGGAGGAAGGG - Intergenic
1041953878 8:63536272-63536294 CGGGAAGCTGCAGTGGGGAATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042386340 8:68179489-68179511 TTGAAAACAACACTGGGGAAGGG + Intronic
1042682381 8:71400026-71400048 TGAGAAACAGCAATGGGGAAAGG + Intergenic
1043052276 8:75398711-75398733 TAGGAAACAGCAGTTGTTATAGG + Intergenic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1044818970 8:96143385-96143407 CAGGAGCCAGGAGTGGGGAAGGG - Exonic
1045277708 8:100722234-100722256 GAGGAAAGAGCAGAGAGGAAGGG + Exonic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045827874 8:106422163-106422185 TAGGACATCGCAGTGGAGAAAGG + Intronic
1046075077 8:109304065-109304087 TTGGAAAGGGGAGTGGGGAAAGG - Intronic
1046194795 8:110847422-110847444 CTGGAAATAGCAGTGGGGAGGGG + Intergenic
1046560864 8:115835805-115835827 TAGGAAACAGCAGAGGAGCTGGG + Intergenic
1046989224 8:120430694-120430716 TATGAAGCAGCAGTGGGAACTGG + Intronic
1047201883 8:122774057-122774079 TGGAAACCAGGAGTGGGGAAAGG + Intergenic
1047254137 8:123203038-123203060 CATGACAGAGCAGTGGGGAAAGG + Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047282932 8:123461341-123461363 TAGGAAACACCAGTAGGGAGTGG - Intronic
1047465933 8:125114316-125114338 TAGGCAATAGCAGCGGGTAAGGG - Intronic
1047589171 8:126309140-126309162 AAGGAAACAGGATTAGGGAAAGG + Intergenic
1047925191 8:129675923-129675945 TTGAAAGCAGCAGTGGGGAACGG - Intergenic
1048116435 8:131529116-131529138 AAGGAAATAGCAGTGGGCAAAGG - Intergenic
1048135678 8:131744363-131744385 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1048143980 8:131822831-131822853 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1048728206 8:137410346-137410368 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1048764028 8:137826890-137826912 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1049010984 8:139887188-139887210 TAGGACACAGGAGTGGGTAGAGG - Intronic
1049414017 8:142487284-142487306 TGGGAAGCTGCAGCGGGGAATGG - Intronic
1049642505 8:143721931-143721953 GAGGGAAAAGCAGGGGGGAAGGG - Intronic
1049868582 8:144956166-144956188 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1050008527 9:1160439-1160461 AAGTAAAGATCAGTGGGGAAGGG - Intergenic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051059603 9:13030912-13030934 TAAGAGACAACAGTGGGAAAAGG + Intergenic
1051663952 9:19450830-19450852 TGGGAAACTGCAGGGGGGCAGGG - Exonic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1052163294 9:25291320-25291342 ACGGAAAGAGGAGTGGGGAAAGG - Intergenic
1052720431 9:32166616-32166638 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1053058239 9:35007125-35007147 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1053078299 9:35153584-35153606 ATGGAAAGAGTAGTGGGGAAAGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053441501 9:38120204-38120226 TAGGACACAGAATTGGAGAAAGG + Intergenic
1053627499 9:39889792-39889814 AAGGAGATAGCAGTGGGAAATGG + Intergenic
1053778494 9:41576229-41576251 AAGGAGATAGCAGTGGGAAATGG - Intergenic
1053797945 9:41742883-41742905 GAGGAGCCAGCAGTGTGGAAGGG + Intergenic
1054147252 9:61572074-61572096 GAGGAGCCAGCAGTGTGGAAGGG - Intergenic
1054166456 9:61786473-61786495 AAGGAGATAGCAGTGGGAAATGG - Intergenic
1054186359 9:61954938-61954960 GAGGAGCCAGCAGTGTGGAAGGG + Intergenic
1054216388 9:62360911-62360933 AAGGAGATAGCAGTGGGAAATGG - Intergenic
1054466989 9:65503111-65503133 GAGGAGCCAGCAGTGTGGAAGGG - Intergenic
1054652146 9:67633585-67633607 GAGGAGCCAGCAGTGTGGAAGGG - Intergenic
1054671093 9:67794432-67794454 AAGGAGATAGCAGTGGGAAATGG + Intergenic
1054756079 9:68959445-68959467 GAGGAAATAGGGGTGGGGAATGG - Intronic
1054807267 9:69406821-69406843 ACGGAAAGAGGAGTGGGGAAAGG + Intergenic
1055276139 9:74619191-74619213 TAGTAAATAGCAATGGGAAAGGG - Intronic
1055626943 9:78184451-78184473 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1055935761 9:81603011-81603033 CCGGAAACAGGAGTGTGGAATGG + Intronic
1056587955 9:87940442-87940464 TGGGAAGAAACAGTGGGGAAAGG + Intergenic
1056608913 9:88112503-88112525 TGGGAAGAAACAGTGGGGAAAGG - Intergenic
1057117150 9:92536196-92536218 TAGAAAACAGCAGTGGGTGTGGG + Intronic
1057269934 9:93645021-93645043 GAGGAAGCAGCAGAGGGGCAGGG - Intronic
1057840957 9:98485268-98485290 AAGGAAACAGCGGTGGGAATGGG + Intronic
1058272545 9:102991037-102991059 TAGGAAAACGCATTGGGGAATGG + Intergenic
1058462360 9:105195019-105195041 GAGGAAATAGCCGTTGGGAATGG - Intergenic
1058908599 9:109500062-109500084 GAGGATAAGGCAGTGGGGAAAGG - Intergenic
1058921288 9:109617657-109617679 TAGGATACAGCAGAGGTGATGGG - Intergenic
1059206755 9:112474507-112474529 TAGGGCACAGTATTGGGGAAGGG - Intronic
1059863272 9:118487741-118487763 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1060737657 9:126076695-126076717 ATGGAAAAAGGAGTGGGGAAAGG + Intergenic
1061120693 9:128640634-128640656 GAGGAGACAGAAGTGGGGCAGGG + Intronic
1061615312 9:131775197-131775219 GAGGAAACAGAAGCCGGGAAGGG - Intergenic
1061676072 9:132216511-132216533 TAGGATTCTGCAGTGGGGCAGGG + Intronic
1061763636 9:132867961-132867983 AAGGGAACAGCAGTGGGGTCTGG + Intronic
1062257111 9:135631654-135631676 TAGGAAAGAGATGTAGGGAAAGG + Intronic
1062692203 9:137847923-137847945 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
1062723892 9:138060394-138060416 TAGAAACCAGCAGAGGGGCATGG + Intronic
1185761671 X:2693353-2693375 TAGGGAAGAGCAGTGGGATAGGG + Intronic
1185814967 X:3146140-3146162 CAGGAGACAGCAGAGGGAAAAGG - Intergenic
1186020681 X:5251535-5251557 TAGGAAACAGAAGTGATTAATGG + Intergenic
1186326487 X:8482714-8482736 CAGAAAGGAGCAGTGGGGAAGGG - Intergenic
1187114048 X:16331305-16331327 GAGGAAACAGAATTGGGCAAGGG - Intergenic
1188300855 X:28504622-28504644 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1188419717 X:29978975-29978997 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1188431243 X:30106985-30107007 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1188463169 X:30451186-30451208 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1188527272 X:31099922-31099944 GAGGAAACAGCTGTCGGGGAAGG - Intronic
1188552878 X:31381142-31381164 ATGGAAAGAGGAGTGGGGAAAGG - Intronic
1189023837 X:37370792-37370814 TGGGTACCAGGAGTGGGGAAAGG - Intronic
1189412938 X:40790024-40790046 TCAAAAACAACAGTGGGGAAAGG + Intergenic
1189751258 X:44225271-44225293 CAGGAAACAGAAGTAGGGAATGG - Intronic
1190189865 X:48268259-48268281 GGGGAAACAGTTGTGGGGAAGGG + Intronic
1190199167 X:48345465-48345487 GGGGAAACAGTTGTGGGGAAGGG - Intergenic
1190344077 X:49321886-49321908 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190345171 X:49331431-49331453 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190346265 X:49340997-49341019 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190347517 X:49532026-49532048 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190348618 X:49541582-49541604 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190349719 X:49551138-49551160 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190350823 X:49560691-49560713 TAGGAAACAGCAGAGGGAGGTGG + Intronic
1190351924 X:49570249-49570271 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190353025 X:49579798-49579820 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190354126 X:49589345-49589367 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190355228 X:49598869-49598891 TAGGAAACAGCAGAGGGAGGTGG + Intronic
1190658609 X:52634759-52634781 GAGGAAACAGTTGTGGGGAAGGG + Intergenic
1190737717 X:53266775-53266797 GAGGAGACAGCAGTGGGGATGGG + Intronic
1191761526 X:64652706-64652728 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1191825796 X:65363539-65363561 ACGGAAACAGGAGTGGGGAAAGG - Intergenic
1192128537 X:68525744-68525766 TAAAAACCAGCAATGGGGAAAGG - Intronic
1192153559 X:68726704-68726726 TAGGTGACAGCAGTGAAGAAAGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192282216 X:69699064-69699086 TAGGAAAAGGCAGTGGCGGAGGG + Intronic
1192454881 X:71268290-71268312 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1192491454 X:71579666-71579688 TGGGAGACAGGAGTGGGGTAGGG + Intronic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192731280 X:73804806-73804828 ATGGAAAAAGGAGTGGGGAAAGG + Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192913896 X:75634199-75634221 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193300354 X:79881600-79881622 AGGGAAGCAGCAGTGGGTAAAGG - Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193436749 X:81482809-81482831 CAGAAACCAGCAATGGGGAAAGG + Intergenic
1193703810 X:84795569-84795591 CAAGAACAAGCAGTGGGGAAAGG + Intergenic
1194660899 X:96627671-96627693 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1194736638 X:97520046-97520068 TGGGAAAAAGCAGGGGGGTAGGG - Intronic
1195140555 X:101955058-101955080 ACGAAAACAGCAATGGGGAAAGG + Intergenic
1195202863 X:102566493-102566515 TGTGAAAGAGCAGTGGGGAAAGG - Intergenic
1195240742 X:102949600-102949622 TGGGACACAGCAGTAGGGACTGG - Intergenic
1195652348 X:107298410-107298432 GAGGAAACATCAGGGGTGAAGGG + Intergenic
1196300215 X:114043624-114043646 ATGGAAAGAGGAGTGGGGAAAGG - Intergenic
1197406301 X:126055910-126055932 TGGAAAAGAACAGTGGGGAAAGG - Intergenic
1198983542 X:142425639-142425661 ATGGAAAGAGGAGTGGGGAAAGG + Intergenic
1199408695 X:147494038-147494060 TGGGAGAGAGCACTGGGGAAAGG + Intergenic
1200243007 X:154507566-154507588 AAGGAAACAGAAGTAGGGATTGG + Intronic
1200792724 Y:7313971-7313993 TAGGAGACTGCCGTGGGGACTGG + Intergenic
1201709190 Y:16970917-16970939 GAAAAACCAGCAGTGGGGAAAGG - Intergenic
1202194562 Y:22285920-22285942 TTGAAAGCAGCAGTGGGGACCGG - Intergenic