ID: 1133545273

View in Genome Browser
Species Human (GRCh38)
Location 16:6800273-6800295
Sequence CTAAGGTGTTTCCAGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133545273_1133545280 -3 Left 1133545273 16:6800273-6800295 CCAGCACCCTGGAAACACCTTAG 0: 1
1: 0
2: 3
3: 17
4: 155
Right 1133545280 16:6800293-6800315 TAGTCCTGGGCCAACCAGACGGG 0: 1
1: 0
2: 3
3: 14
4: 117
1133545273_1133545279 -4 Left 1133545273 16:6800273-6800295 CCAGCACCCTGGAAACACCTTAG 0: 1
1: 0
2: 3
3: 17
4: 155
Right 1133545279 16:6800292-6800314 TTAGTCCTGGGCCAACCAGACGG 0: 1
1: 0
2: 1
3: 6
4: 104
1133545273_1133545282 1 Left 1133545273 16:6800273-6800295 CCAGCACCCTGGAAACACCTTAG 0: 1
1: 0
2: 3
3: 17
4: 155
Right 1133545282 16:6800297-6800319 CCTGGGCCAACCAGACGGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 142
1133545273_1133545286 19 Left 1133545273 16:6800273-6800295 CCAGCACCCTGGAAACACCTTAG 0: 1
1: 0
2: 3
3: 17
4: 155
Right 1133545286 16:6800315-6800337 GCTGGTAGTACCAAAAGTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 106
1133545273_1133545285 18 Left 1133545273 16:6800273-6800295 CCAGCACCCTGGAAACACCTTAG 0: 1
1: 0
2: 3
3: 17
4: 155
Right 1133545285 16:6800314-6800336 GGCTGGTAGTACCAAAAGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133545273 Original CRISPR CTAAGGTGTTTCCAGGGTGC TGG (reversed) Intronic
900112239 1:1013252-1013274 TTTAGGTGTTTCCAGGGTGTTGG + Intergenic
906746730 1:48226909-48226931 CTCAGGCGGTCCCAGGGTGCTGG - Intronic
907205643 1:52768235-52768257 CATTGGTGTTTCCAGGCTGCTGG + Intronic
912887383 1:113489146-113489168 CTAAGGTGTTCCCAGACCGCTGG - Intronic
914337508 1:146729073-146729095 ATTATGTGTTTTCAGGGTGCTGG + Intergenic
916446375 1:164876066-164876088 CTAAGGTGTCTCCAGAGTGGAGG + Intronic
916865307 1:168850010-168850032 GGAATGTGTTTCCAGGATGCAGG + Intergenic
916925938 1:169521026-169521048 CATTGGTGTTTCCAGGTTGCCGG - Intronic
917833022 1:178913861-178913883 CCAAGGTGCTCCCAGGCTGCTGG + Intronic
922252815 1:223865001-223865023 CTGAGGCCTTTCCAGGGTGGGGG - Intergenic
922921951 1:229312791-229312813 CAAAGGTGTTCACATGGTGCAGG - Intergenic
923939890 1:238809915-238809937 CTAAGGTGTGGCCAGGGAGAGGG + Intergenic
924331797 1:242946913-242946935 CTGAGGTGCTTCCAGACTGCTGG - Intergenic
1063143370 10:3275180-3275202 CTAAGGGGTGCCCAGGTTGCTGG + Intergenic
1064933055 10:20649130-20649152 CTAATCTGTCTCCAGGGTGCAGG - Intergenic
1065571379 10:27073539-27073561 CTAAAGTGTTTTCAGGGGGAAGG - Intronic
1068320616 10:55409330-55409352 CAAAGATGATGCCAGGGTGCTGG - Intronic
1070820925 10:79353839-79353861 CTAATCTGTGGCCAGGGTGCTGG + Exonic
1070897240 10:79995371-79995393 CCAAGGTGTTTCCAGTCTGCTGG + Intergenic
1075738920 10:124681575-124681597 CCAAGGTGACTCCAGGCTGCTGG + Intronic
1079480902 11:20878903-20878925 TTAAGGTGCTTACAGTGTGCTGG + Intronic
1079627466 11:22633679-22633701 CTAAGGTCTTTTCAGGGTGAAGG + Intronic
1080839898 11:35974468-35974490 CTAAGCTGTATCCAGGCTCCTGG - Intronic
1089370718 11:117954386-117954408 GTAAGGTGTTCCCTGTGTGCTGG + Intergenic
1090217566 11:124983659-124983681 CTAAGGTGTTCCCAGGCTGCTGG + Intronic
1091239165 11:134040979-134041001 CATAGGTGTTTGCAGGGAGCTGG + Intergenic
1093101912 12:15038116-15038138 CTGAGGTGTTTCCAGAGTGTTGG + Intergenic
1095259458 12:40082063-40082085 CTGAGGTGTTCCCAGTCTGCTGG + Intronic
1096283104 12:50273983-50274005 CTAAGGTGTTTCCAGGATCCAGG - Intronic
1096456064 12:51788030-51788052 CTAAGGTTTTTTCAGGGCACAGG - Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1098725152 12:73955308-73955330 CTAAGTAGTTTCCAGGGTCTTGG - Intergenic
1101346015 12:103886707-103886729 GTGAGGACTTTCCAGGGTGCTGG + Intergenic
1104565645 12:129878916-129878938 AGATGGTGTTTCCAGGGTCCAGG - Intronic
1104867065 12:131962054-131962076 CTAAGGTATTTCTAAGGTGTTGG + Intronic
1107892287 13:44924825-44924847 CCAGGGTGATTCCAGGGTTCTGG - Intergenic
1108139883 13:47409258-47409280 CTGAGGTGGTTCCAGGATGCAGG - Intergenic
1108683701 13:52801032-52801054 CATAGGGGTTTCTAGGGTGCTGG - Intergenic
1109694272 13:65932868-65932890 CTGAGGGGTTTCCAGCCTGCTGG - Intergenic
1111611151 13:90609366-90609388 CTAGGGTCTTCCCAGGGTTCTGG - Intergenic
1113294924 13:108948528-108948550 CTACTGTGTCTCCAGGGTGCAGG - Intronic
1113960466 13:114123033-114123055 CGAAGGTGTGTCCAGGGTGTAGG - Intronic
1114803017 14:25799682-25799704 GAAAGGTGGTTCCAGGGAGCAGG - Intergenic
1115761093 14:36580107-36580129 GCAAGCTGTTTCCAGAGTGCAGG - Intergenic
1115955719 14:38777096-38777118 CTGAGGTGGTTCCAGTGTCCTGG - Intergenic
1116334619 14:43640851-43640873 CTGAGGTTTTACCAGGGTGAAGG - Intergenic
1119778233 14:77261177-77261199 CCCAGGTGATTCCAGTGTGCAGG + Intergenic
1121675134 14:95746353-95746375 CCCAAGTGTTTCCAGTGTGCAGG + Intergenic
1121711593 14:96042806-96042828 CTGGGGTGTTTCCAGGGTAGGGG - Intronic
1122113272 14:99515860-99515882 CCCAGGTGTTCCCTGGGTGCTGG - Intronic
1122428211 14:101623818-101623840 CTAAGGTGACTCCAGGGTCTGGG - Intergenic
1122954488 14:105064155-105064177 CTAAGCTGTTTCACGGTTGCTGG + Intronic
1126250072 15:46556990-46557012 TTACTGTGTTTCCAGGATGCAGG - Intergenic
1126335978 15:47586946-47586968 CCAGGGTGTTTCCAGTGGGCTGG + Intronic
1128283277 15:66415007-66415029 CTCAGGGGTTACCATGGTGCTGG - Intronic
1128632358 15:69279815-69279837 CCCAGGTGATTCCAGTGTGCAGG - Intergenic
1129115426 15:73362941-73362963 CCGAGGTGCTTCCAGGATGCTGG - Intronic
1129385880 15:75195933-75195955 CACAGCTGTTTCCAGGGTGGTGG - Intronic
1130136531 15:81186124-81186146 CTGAGGGCTTTCCAGGGTTCAGG - Intronic
1131913047 15:97229939-97229961 CTAAATTGTTTCCAGGTTGTTGG - Intergenic
1133545273 16:6800273-6800295 CTAAGGTGTTTCCAGGGTGCTGG - Intronic
1135398802 16:22151401-22151423 CAAATGTGTTTCCAGGCTGGAGG - Intronic
1137492276 16:48943222-48943244 CTGAGGAGTGTCCAGGGTTCTGG - Intergenic
1138181676 16:54944824-54944846 CAAATGTGGTTCTAGGGTGCAGG + Intergenic
1139899836 16:70319304-70319326 CTAAGGTGGTTTCCTGGTGCAGG + Intronic
1139996773 16:70988255-70988277 ATTATGTGTTTTCAGGGTGCTGG - Intronic
1141162030 16:81635742-81635764 ATAAGGAGTTTTCAGGGTGGCGG + Intronic
1142032326 16:87844713-87844735 CTGAGGTGTTTCCAGGGCTGGGG - Intronic
1142432018 16:90034105-90034127 CTAAGGTTCTTCCTGGCTGCTGG + Intronic
1149269917 17:54967137-54967159 TTTAGGTGATTCCAGCGTGCAGG - Intronic
1149604970 17:57918059-57918081 TCAAGGTGTTACCAGGGAGCTGG + Intronic
1151141228 17:71993767-71993789 CCAAGGTGTTCCCAGTCTGCTGG - Intergenic
1152006891 17:77688000-77688022 CTCAGGTGTTTGCGGCGTGCTGG + Intergenic
1152720411 17:81920900-81920922 CTGAGGTGTTTCCATGCTGCGGG - Exonic
1160432929 18:78824696-78824718 CAAAGGTGCTTTAAGGGTGCGGG + Intergenic
1160537752 18:79604052-79604074 CTGAGGGGTTTCCAGGGTGTGGG - Intergenic
1160793235 19:932604-932626 CGATGGCGTTCCCAGGGTGCTGG + Exonic
1163202742 19:15780230-15780252 CTGGGGTGTCTCCAGGCTGCTGG - Intergenic
1163561275 19:18020929-18020951 CTACTGTGTGTTCAGGGTGCTGG - Intergenic
1164763487 19:30745463-30745485 CCAAGGTGTGTCCATGGTCCTGG - Intergenic
1165762242 19:38328230-38328252 CTCAGGTGTCTCCAGGGAGCAGG + Exonic
1166111228 19:40624134-40624156 CAAAGGTGTGGCCCGGGTGCGGG - Intronic
1166585930 19:43949034-43949056 CCAAGGTGTTCCCAGGCTGCTGG + Intergenic
1167003125 19:46757426-46757448 CTCAGTTGCTTCCAGGATGCGGG + Exonic
929264630 2:39904398-39904420 CTCAGATGTTTCCAGGCAGCAGG - Intergenic
930723939 2:54664601-54664623 CGAAGGTGTCTCCTGGGTTCTGG - Exonic
931596027 2:63944479-63944501 CTAAGGTGTGAGCAGGGTGTAGG - Intronic
932442220 2:71744720-71744742 TTATTGTGTTTCCAGGGTCCTGG + Intergenic
933583065 2:84149253-84149275 CCAAGGTGATTCCAATGTGCAGG + Intergenic
947501756 2:230675979-230676001 GCAAGGTCTTTGCAGGGTGCTGG - Intergenic
948006675 2:234615262-234615284 CTTAGTTGTTTCCTGGGTGGGGG - Intergenic
948169696 2:235891099-235891121 CTGAGGGGTTCCCAGGGTGCAGG + Intronic
948333839 2:237192758-237192780 CTAAGGGGTTTCCCAGGTACTGG + Intergenic
1168915018 20:1478466-1478488 ATCAGGTGGTTCCAGGGAGCTGG - Exonic
1170808590 20:19655512-19655534 CTAAGGTGTGCCCAGAGGGCTGG + Intronic
1171409269 20:24935251-24935273 CTCAGGGGTCTCCTGGGTGCCGG - Intergenic
1175460514 20:59148882-59148904 GTAAGCTGTGTCCAAGGTGCAGG - Intergenic
1181467496 22:23118028-23118050 CTAAGGGGCTTCCAGCTTGCTGG - Intronic
1181510504 22:23386789-23386811 CTAAGCCGCTCCCAGGGTGCGGG - Intergenic
1181626313 22:24124505-24124527 CTAAGGTGTGCACAGTGTGCAGG - Intronic
1184285000 22:43465538-43465560 CGAAGGGGCTCCCAGGGTGCTGG + Intronic
1184369395 22:44072979-44073001 CTTATGTGTCTCCTGGGTGCTGG + Intronic
1184380900 22:44144237-44144259 CTCAGGTGTCTCCAGGGACCAGG + Intronic
1185026717 22:48418188-48418210 CTGAGGTGGTTCTAGGGTGTGGG + Intergenic
949358800 3:3209764-3209786 CAAAAGTGTTTCCAAAGTGCTGG + Intergenic
950419755 3:12891879-12891901 CTAAGGGATGTCCAGGGAGCAGG - Intergenic
952173510 3:30835765-30835787 CTGATGTGTTTCAAGGGTGTTGG + Intronic
957255021 3:77825638-77825660 CTGAGGGGCTTCCAGGCTGCTGG + Intergenic
959640418 3:108626800-108626822 CTAAAGTGTTTCCTGGAGGCTGG + Intronic
960537125 3:118826702-118826724 CAAAGCTGTTTGCAGAGTGCTGG - Intergenic
962506394 3:136050649-136050671 CTAGGGTGTTGCCAGGCAGCAGG + Intronic
964296430 3:155239388-155239410 CCAAGGTGTTCCCAGACTGCTGG + Intergenic
965683021 3:171271483-171271505 CATAAGTGTTTCCAGGGTGAAGG - Intronic
966657867 3:182379742-182379764 ATAAGGTTTTTCTAGGGTGGTGG + Intergenic
966701649 3:182860064-182860086 CAAAGGAATTTCCAGGGTGATGG - Intronic
967341857 3:188407328-188407350 GTAAAGTGTTTCCTGGGCGCAGG - Intronic
973300821 4:48581930-48581952 CTCAGGTATTGCCAGGCTGCTGG - Intronic
973379662 4:49311442-49311464 CGTAGGTGATTCCTGGGTGCGGG - Intergenic
978238392 4:106487690-106487712 GGAAGGTGTTTCCAGAGTGAGGG - Intergenic
981466300 4:145076206-145076228 CCACAGTGTTTCCAGTGTGCTGG - Intronic
987861309 5:23491769-23491791 CCAAGGTGTTTCCAATCTGCTGG + Intergenic
993793580 5:92237489-92237511 CTGAGGTGTTCCTAGGCTGCTGG + Intergenic
994652056 5:102541410-102541432 CTAAGGTGGTTCCTGGGTGGGGG + Intergenic
996592090 5:125159432-125159454 CTACGCTATTTCCAGGGTCCTGG - Intergenic
997188073 5:131901604-131901626 CCAAGGTGTTCCCAGACTGCTGG - Intronic
999349005 5:150848991-150849013 CAAAGGTGTGGACAGGGTGCAGG + Intronic
1000041380 5:157487532-157487554 CACAGGTGTTTCCTGGGTGGCGG - Intronic
1000521448 5:162299787-162299809 CCAAGGTGTTTCTAGTCTGCTGG + Intergenic
1001969302 5:175940671-175940693 CTTAGGTGTCTGCAGTGTGCAGG + Intronic
1002248134 5:177903078-177903100 CTTAGGTGTCTGCAGTGTGCAGG - Intergenic
1002887292 6:1308995-1309017 CAAAGCTGTTTCCAGGTTGCTGG + Intergenic
1003202177 6:3971703-3971725 ATCAGGTGTTTCAAAGGTGCTGG - Intergenic
1004268685 6:14173955-14173977 CTGAGGTGTGTCCGTGGTGCTGG + Intergenic
1006911109 6:37564197-37564219 CAAAGGTGTGGGCAGGGTGCAGG - Intergenic
1007808579 6:44470068-44470090 CCAAGGAGTGTCCAGGCTGCTGG + Intergenic
1009740836 6:67744038-67744060 TTATTGTGTTTCCAGGGTTCAGG + Intergenic
1009992786 6:70864480-70864502 CTAACATGTCTCCAGGGTGCTGG - Intronic
1011182343 6:84635154-84635176 CCATGGTGCTGCCAGGGTGCTGG - Intergenic
1014218912 6:118780483-118780505 CTATGGTGGTTCCACGGTGATGG - Intergenic
1019789968 7:3005362-3005384 CTAAGGTGTAGCCAGGTTCCTGG - Intronic
1024438210 7:49383704-49383726 TTAAGGTGATTTCTGGGTGCAGG + Intergenic
1026491591 7:70868513-70868535 CAAAACTGTTTCCAGGGGGCAGG + Intergenic
1028019393 7:85750798-85750820 CCAAGGTGTTTCCAGTGTGCTGG - Intergenic
1032380364 7:131473664-131473686 CTGCGGAGTTTCCAGAGTGCTGG + Intronic
1033368159 7:140687019-140687041 CCAGGATGTTTCCAGGGTGAAGG - Exonic
1034529110 7:151684352-151684374 CTCAGCTGCTTCCACGGTGCTGG - Intronic
1034922833 7:155097921-155097943 CTCAGGTGTTGCCAGTGTGATGG - Intergenic
1034937574 7:155209879-155209901 GAAAGGTGTGTGCAGGGTGCGGG - Intergenic
1036374804 8:8191080-8191102 CTAAGTTGGTTGCAGGGTTCTGG - Intergenic
1036876098 8:12474564-12474586 CTAAGTTGGTTGCAGGGTTCTGG + Intergenic
1037388299 8:18365837-18365859 ATATGGTGTTTGCAGTGTGCTGG - Intergenic
1037765101 8:21767883-21767905 CTAAGGTGTGAGCAGGGTGTTGG - Intronic
1038685068 8:29708795-29708817 CTAAATTGTTTCCAGGGGCCGGG - Intergenic
1039254750 8:35706679-35706701 CTCAGGTGACTCCAAGGTGCAGG + Intronic
1039742631 8:40396451-40396473 GAAAGGTGTTGGCAGGGTGCAGG + Intergenic
1041906947 8:63043770-63043792 CTAAGGTGCTCCCAGTCTGCTGG - Intergenic
1048509152 8:135046733-135046755 CTAAGGTGTTCCTAGGATGTGGG + Intergenic
1049244486 8:141554718-141554740 CTGAGGTGTGTCCATGGTGTTGG + Intergenic
1051116161 9:13697243-13697265 CCGAGGTGTTTCCAGACTGCTGG + Intergenic
1052519041 9:29520035-29520057 CTATGGTTTTTCCTGGGGGCAGG + Intergenic
1055368111 9:75567438-75567460 CCAAGGTGTTCCCAGTCTGCTGG + Intergenic
1057496803 9:95567661-95567683 CTATGGTGTGTACAGGGTGTGGG + Intergenic
1059381985 9:113933989-113934011 CTAGGGTGTTACCTGGGAGCAGG + Intronic
1061389968 9:130311983-130312005 CTAGGGTGTTTGCCAGGTGCTGG + Intronic
1185455917 X:310845-310867 CACAGGTGTTTCCAGGGTCTCGG + Intronic
1186472545 X:9832717-9832739 CTAACGTGTGTGCAGGTTGCAGG + Intronic
1186660421 X:11664116-11664138 CTAAGGGGTTTCCGTGGTGTGGG - Intronic
1187457686 X:19457280-19457302 CTCAGCTGTTTCCTGGCTGCTGG - Intronic
1188771245 X:34157426-34157448 CTGAGGTGCTCCCAGGCTGCTGG + Intergenic
1189186376 X:39058996-39059018 CTAAGGTGTTTCTATGCTGATGG + Intergenic
1190506338 X:51129974-51129996 CTGAGGTGCTCCCAGGCTGCTGG + Intergenic
1195270261 X:103221471-103221493 CTGAGGTGTTCCCAGACTGCTGG - Intergenic
1195335610 X:103850745-103850767 CTAGGGAGCTTCTAGGGTGCTGG - Intergenic
1197705983 X:129634767-129634789 CTAATGGGTTGCCAGGGTGATGG - Intergenic
1197992339 X:132331768-132331790 CTAATGTGTCCACAGGGTGCTGG - Intergenic
1201229138 Y:11846078-11846100 CTGAGGTGCTTCCAGACTGCTGG - Intergenic