ID: 1133545620

View in Genome Browser
Species Human (GRCh38)
Location 16:6803491-6803513
Sequence GATTATACACAGATTGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133545620_1133545622 1 Left 1133545620 16:6803491-6803513 CCCAGTGCAATCTGTGTATAATC 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1133545622 16:6803515-6803537 AGATTTCCAGATTTCCTAAATGG 0: 1
1: 0
2: 2
3: 26
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133545620 Original CRISPR GATTATACACAGATTGCACT GGG (reversed) Intronic
901643078 1:10702823-10702845 GATTATAAGCATATTGCACAGGG + Intronic
904503541 1:30932141-30932163 GAATATACACTGAATGCACAGGG + Intronic
910550879 1:88473357-88473379 GATTAGACACAGATACCACTTGG + Intergenic
911683878 1:100750481-100750503 GAATAAAAACAGATTGCATTTGG - Intergenic
912026447 1:105180322-105180344 TCTTATAAACAGAATGCACTGGG - Intergenic
912715240 1:111978862-111978884 GATTATACATAGCAAGCACTTGG - Intronic
916013476 1:160727516-160727538 GATCATACACAGTTTGCATTAGG - Intergenic
922660712 1:227428286-227428308 GATTCTGCGCAGACTGCACTTGG - Intergenic
1069245368 10:66198299-66198321 GATTATATGCAGATTAAACTTGG - Intronic
1073676351 10:105651107-105651129 GATTATACATAGTTTGGGCTTGG - Intergenic
1075237257 10:120742098-120742120 GACAAGACACAGATTGCTCTGGG - Intergenic
1076381713 10:130028242-130028264 GATTCTACACAGGGTGCATTTGG - Intergenic
1078281685 11:9908664-9908686 GATTATGAACAGATGGCATTTGG - Intronic
1085756659 11:79207360-79207382 GATAATACACATAAAGCACTTGG - Intronic
1087196007 11:95304910-95304932 GATTGTACACAGAATGCATGAGG + Intergenic
1090154793 11:124425819-124425841 GATTAGACACAGTTTCCCCTGGG + Intergenic
1091135876 11:133188968-133188990 GAATATACAGAGTTTGTACTGGG - Intronic
1100510076 12:95261957-95261979 GATTGTGCACAGAGTGCACATGG - Intronic
1102387325 12:112520502-112520524 CAATATTCACAGATTGCATTAGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107416723 13:40207953-40207975 GATTATTAACAGTTTGCACAAGG - Intergenic
1108687906 13:52836803-52836825 GTTAAAACACAGATTGCACTGGG - Intergenic
1109416523 13:62047170-62047192 GGTTATACAAAGATTCCATTTGG - Intergenic
1112301005 13:98230334-98230356 CAATAAACATAGATTGCACTGGG - Intronic
1112844220 13:103618056-103618078 GATTATACACACTGAGCACTTGG - Intergenic
1116878476 14:50139075-50139097 GATTTAACACAATTTGCACTTGG - Intronic
1128801110 15:70497725-70497747 GATTGTCCACAGAGTGCACTTGG - Intergenic
1129964256 15:79719872-79719894 GATGATACCCAGGTTGCATTGGG - Intergenic
1131586269 15:93696767-93696789 TATTCTACTCAGATTCCACTGGG - Intergenic
1133545620 16:6803491-6803513 GATTATACACAGATTGCACTGGG - Intronic
1133639951 16:7707214-7707236 GATTATACCAGGTTTGCACTGGG - Intronic
1140784742 16:78329591-78329613 TATTTTACATAGGTTGCACTGGG - Intronic
1148632334 17:49120880-49120902 GGTTCTAAACAGATTGCCCTAGG - Intergenic
1152915891 17:83035605-83035627 GATAAAACACAGAGTCCACTGGG + Intronic
1157380303 18:47208630-47208652 GATTTCACACAGATTACACTGGG + Intergenic
1158022292 18:52857621-52857643 GATTATTCACAGAAGTCACTGGG - Intronic
1160478195 18:79212303-79212325 GATTATACAAATATTGTACCAGG + Intronic
1164322493 19:24162229-24162251 GACTATACACAGTTTGGAGTGGG + Intergenic
1167835900 19:52069419-52069441 TATGATACAGAGATTGTACTTGG + Intronic
925339647 2:3127235-3127257 GATTCTGGACAGAATGCACTGGG - Intergenic
933358557 2:81247340-81247362 GTTTATGTACAGATTGCAGTTGG + Intergenic
936466973 2:112762390-112762412 GAGTCTACTCAGACTGCACTGGG - Intronic
937737293 2:125307541-125307563 GATTATACACAGCTTGATATAGG + Intergenic
937757121 2:125553475-125553497 GAATATACACAGTTTGAAGTGGG + Intergenic
938878843 2:135563643-135563665 GATTATAAACGTATTCCACTGGG - Intronic
939591698 2:144072135-144072157 GATCATTCACAGCTTGAACTTGG - Intronic
940014629 2:149091031-149091053 GATTATACACAGACTAAAGTAGG + Intronic
941989078 2:171537268-171537290 GATCACACACAGATTGCAGAAGG + Intronic
944015916 2:195037190-195037212 ATTTATATACAGATTCCACTGGG - Intergenic
944051824 2:195478654-195478676 CATTATACAGTGATTGGACTTGG + Intergenic
1173219722 20:41122088-41122110 GAAAATAAACAGATTGCCCTGGG + Exonic
1177812565 21:25940098-25940120 GATTATAGAGAAATTGCAGTAGG - Intronic
955845825 3:63161735-63161757 GATTATACTCAGATTCATCTGGG + Intergenic
955860687 3:63326499-63326521 GATTATACTGAGATTGCAATGGG + Intronic
956990188 3:74753163-74753185 AATAATACACATATTGAACTTGG + Intergenic
958135346 3:89482488-89482510 GATCAGACACAGATTGAACCAGG + Intergenic
960784497 3:121357045-121357067 GATCATACCCAAATTGCCCTTGG + Intronic
961470400 3:127107712-127107734 CCTTCTACACAGAGTGCACTGGG + Intergenic
962331693 3:134484472-134484494 AATTATACACAGATTGGTGTGGG + Intronic
967090223 3:186128616-186128638 CATTTTACACTGATAGCACTGGG - Intronic
969497380 4:7533851-7533873 GATGATACATAGAATGCACAGGG + Intronic
970128367 4:12839860-12839882 CATTAAACACTGATTTCACTAGG + Intergenic
970318049 4:14847890-14847912 GCTGGTCCACAGATTGCACTTGG + Intergenic
970575261 4:17420856-17420878 AATTATTAACAGTTTGCACTAGG - Intergenic
975086740 4:70350443-70350465 GAATATTCACAGATTGGTCTAGG - Intergenic
975584286 4:75934749-75934771 GAATATAGACAGTTTACACTTGG - Intronic
979270099 4:118749398-118749420 GATTATATATAGATTTTACTTGG + Intronic
984037151 4:174683697-174683719 AATTATATACAGATTGCTCAAGG + Intronic
984298295 4:177882364-177882386 GATTATACAATGAATGCACAAGG + Intronic
990510112 5:56481878-56481900 AATTATACACAGTTTCCACAAGG + Intronic
995315936 5:110774366-110774388 GATATCACTCAGATTGCACTAGG + Intergenic
997543752 5:134687401-134687423 CAGTATACACACATTGCATTTGG + Intronic
999009104 5:148015536-148015558 GATAATACACATAAAGCACTTGG + Intergenic
1005484613 6:26287758-26287780 GATTGTACACTAAGTGCACTGGG + Intergenic
1008683050 6:53894731-53894753 GATTATTTACAGATTGCTTTTGG + Intronic
1010658113 6:78536540-78536562 GATTACACAAATAATGCACTTGG - Intergenic
1011753109 6:90473032-90473054 GATTCTGAACAGATTGCACAAGG + Intergenic
1012635529 6:101534528-101534550 GAGTTTCCACAGATTGCATTAGG - Intronic
1013803666 6:113973185-113973207 GATTATAGACAGAATTCTCTTGG - Intronic
1017529864 6:155278847-155278869 GATGATACACAGAAAGCAGTTGG + Intronic
1022567717 7:31420212-31420234 GATTATACTTAAATTGCAATGGG - Intergenic
1024542027 7:50483340-50483362 GATTAAACACAGTTTGGACATGG + Intronic
1027633377 7:80637397-80637419 AATTATAAAGAGATTGCACATGG + Intronic
1029293514 7:99520508-99520530 GATTAAACACTGATAGTACTTGG + Intronic
1033545220 7:142393351-142393373 GATTATAGAGCCATTGCACTAGG + Intergenic
1035902447 8:3471892-3471914 GTTAATACACACATGGCACTTGG + Intronic
1037029166 8:14080915-14080937 GATTGTACATGGATTTCACTTGG - Intergenic
1037564505 8:20106123-20106145 GGTTACACACATATTCCACTTGG - Intergenic
1038964186 8:32552692-32552714 GATTATTCACAGAATGAAATAGG + Intronic
1042742628 8:72067734-72067756 GATGATACAGAAATAGCACTTGG + Intronic
1045066305 8:98449278-98449300 GAAGATACACAGATTACACATGG + Intronic
1045397934 8:101780244-101780266 GATTATATAAAAATTGCACTGGG + Intronic
1046877096 8:119267391-119267413 AATTATACACAGAGTGCTATAGG + Intergenic
1058323473 9:103663769-103663791 GGTTATACACAAATTACAATAGG + Intergenic
1186294954 X:8139068-8139090 GATTAAACAAAGAATGCATTGGG + Intergenic
1189208631 X:39263814-39263836 GATTACACACAGTTTGCATGAGG - Intergenic
1195130214 X:101843724-101843746 GATTGTTCACAGAATGCATTTGG - Intronic
1195176056 X:102316549-102316571 GATTGTTCACAGAATGCATTTGG + Intronic
1195182808 X:102370544-102370566 GATTGTTCACAGAATGCATTTGG - Intronic