ID: 1133546605

View in Genome Browser
Species Human (GRCh38)
Location 16:6813761-6813783
Sequence CTGCAGGTGCCTGCTGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 276}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133546605_1133546612 14 Left 1133546605 16:6813761-6813783 CCAATGGCAGCAGGCACCTGCAG 0: 1
1: 0
2: 2
3: 41
4: 276
Right 1133546612 16:6813798-6813820 CCTGAAGAATGAGTGAAGGGAGG 0: 1
1: 0
2: 1
3: 26
4: 287
1133546605_1133546610 11 Left 1133546605 16:6813761-6813783 CCAATGGCAGCAGGCACCTGCAG 0: 1
1: 0
2: 2
3: 41
4: 276
Right 1133546610 16:6813795-6813817 ATTCCTGAAGAATGAGTGAAGGG 0: 1
1: 0
2: 3
3: 40
4: 351
1133546605_1133546613 17 Left 1133546605 16:6813761-6813783 CCAATGGCAGCAGGCACCTGCAG 0: 1
1: 0
2: 2
3: 41
4: 276
Right 1133546613 16:6813801-6813823 GAAGAATGAGTGAAGGGAGGAGG 0: 1
1: 1
2: 10
3: 106
4: 1053
1133546605_1133546609 10 Left 1133546605 16:6813761-6813783 CCAATGGCAGCAGGCACCTGCAG 0: 1
1: 0
2: 2
3: 41
4: 276
Right 1133546609 16:6813794-6813816 GATTCCTGAAGAATGAGTGAAGG 0: 1
1: 0
2: 2
3: 17
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133546605 Original CRISPR CTGCAGGTGCCTGCTGCCAT TGG (reversed) Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900602952 1:3510925-3510947 GTGCAGGTGCCTGGTACCAGGGG - Intronic
900629777 1:3628160-3628182 CTGCAGGTGCTGGCTGCCATTGG + Intronic
901492395 1:9603144-9603166 CTGCAGGTGCCTGCTCACCATGG + Intronic
901533497 1:9867814-9867836 CTGCAGGATCCTGCTGTCAGAGG - Intronic
902810489 1:18885389-18885411 CAGCTGATGTCTGCTGCCATGGG + Exonic
902929453 1:19720448-19720470 CTGCAGGTGCCTTCTGCTCCAGG + Intronic
903392294 1:22972951-22972973 CTCAGAGTGCCTGCTGCCATGGG + Intergenic
903557149 1:24202354-24202376 CTGCACGTGCCTGCTGGCTTTGG - Intergenic
905683989 1:39895940-39895962 CAGCAGGTGCCTGCTGGCTCTGG - Exonic
906322129 1:44823350-44823372 CCGCAGGTTCCGGCTGCCCTGGG + Exonic
908323427 1:63000337-63000359 CCGCAGCTGCCTGCAGCCAGAGG - Intergenic
908885749 1:68786508-68786530 CTGCAGTTGCCTTCTGGCTTTGG - Intergenic
909527595 1:76644204-76644226 CTGCTTCTGCCTTCTGCCATGGG - Intergenic
910034305 1:82772175-82772197 CAGCAGTTGCCTCCGGCCATGGG + Intergenic
910679962 1:89852880-89852902 CTGGAGGTGCCTACTGGCTTGGG + Intronic
911299720 1:96157338-96157360 CTGCATGTGCCTGTGGCCATTGG + Intergenic
912239964 1:107896064-107896086 CTGCAGGTGCTTGTGGCCATGGG - Intronic
912393411 1:109320687-109320709 CAGAAGGTGCCAGGTGCCATGGG - Intronic
914254926 1:145954150-145954172 CTTCTGGTGGCTGCTGACATTGG - Intronic
916142678 1:161712958-161712980 CCTCAAGTCCCTGCTGCCATTGG + Intronic
916573944 1:166050823-166050845 CTGAAGGCTCCTGCTGCCTTGGG - Intergenic
919956820 1:202425685-202425707 CTTCATGTGGCTGCTGCCAAGGG + Exonic
922503295 1:226111894-226111916 CTCCTGCTGCCTGCGGCCATGGG - Intergenic
923300045 1:232631842-232631864 CTACAGGTGCCTGCCACCACAGG - Intergenic
1063174926 10:3542895-3542917 CTTCACTTGTCTGCTGCCATGGG + Intergenic
1063614867 10:7592834-7592856 CTGAAGGTGCCGGCTGGGATGGG + Intronic
1063876144 10:10480921-10480943 TTACAGGTGCCTGCTACCACTGG - Intergenic
1064175015 10:13067137-13067159 TCGCAGGTGCCTGCAGCCATTGG - Intronic
1064733354 10:18356056-18356078 CTCCAGGGGCCTGCAGCCTTGGG - Intronic
1065774908 10:29110571-29110593 CTGCCTGTGCCTGCTACCTTTGG + Intergenic
1066352152 10:34645718-34645740 CTGCAGGTGCCTGTTCTCACTGG + Intronic
1067581561 10:47449783-47449805 CTGCTGGAGCTTGCTGACATTGG - Intergenic
1067795203 10:49316207-49316229 CTGCAGGTGCCTGCCGTGCTGGG - Exonic
1069907229 10:71738985-71739007 CAGCAAGCGCCTCCTGCCATGGG - Intronic
1070306660 10:75243667-75243689 GTGCAGGTGCCTGTTTCCACTGG + Intergenic
1071293990 10:84206149-84206171 CTGCAGGTGCATGCTGCCAGAGG + Intronic
1072658634 10:97348340-97348362 CTGCAAGTGACTGCTGCCCTTGG + Intergenic
1074039706 10:109776212-109776234 CTGCAGGTGCTGGCTGCTAATGG - Intergenic
1074896854 10:117784673-117784695 CTGCAGGTGTCTCCTGTCAGAGG - Intergenic
1076154569 10:128193757-128193779 TTACAGGTGTCTGCTGCCATAGG + Intergenic
1076476532 10:130757617-130757639 CTGGAGCTGCCTGCTGTCCTTGG + Intergenic
1077407205 11:2388017-2388039 CTGCTGGTGCCAGCAGCCACGGG - Intronic
1078637958 11:13069449-13069471 CTGCAGATGCCTCCTGCCAGGGG + Intergenic
1080451121 11:32379830-32379852 CTGCTGGTGCCTGGGGTCATGGG - Intergenic
1080800138 11:35602810-35602832 CTGCCGCTCCATGCTGCCATGGG + Intergenic
1081987293 11:47315245-47315267 CTTCATGTGCCGGCTGCCACTGG - Exonic
1083402514 11:62433766-62433788 CTGCAGGTGTTTGTTGCCCTTGG + Intronic
1083886342 11:65575183-65575205 CTGCAGGTGTCAGCTGCCCTGGG - Intergenic
1084229853 11:67743678-67743700 CTGCAGGTGCCTCTTGGCCTAGG + Intergenic
1084690710 11:70724418-70724440 ATGCATGTGCCTGTGGCCATAGG + Intronic
1086714870 11:90051957-90051979 CTGCAGGTGGCCGCTGTCCTTGG + Intergenic
1088205270 11:107385625-107385647 CTGCAGGTAACTGCAGCCACAGG - Intronic
1089432755 11:118436858-118436880 CTGCAGGTCTCGGCCGCCATCGG + Exonic
1091621690 12:2093835-2093857 CTGCAGTTGCAGGCTGCCAGGGG + Intronic
1091679476 12:2516507-2516529 CGTCAGGTGCCTGCTGCCTCAGG + Intronic
1092394473 12:8113556-8113578 CTGCAGATGGCTGCTGCTAAGGG - Intergenic
1093101959 12:15038411-15038433 TTCCTGGTGGCTGCTGCCATAGG - Intergenic
1093383558 12:18523517-18523539 CTGTAGGTGCCTCCTAGCATGGG + Intronic
1094011052 12:25810209-25810231 CTACAGGTGCCTGCCACCACGGG - Intergenic
1094129579 12:27060862-27060884 CTGCTGGTGTCTGCTGCCTCTGG - Intronic
1099513634 12:83569048-83569070 CTGCATGACCCTGCTGCAATGGG - Intergenic
1100606110 12:96153322-96153344 AAGCAGGTGCCTGCTGGCCTGGG - Intergenic
1101946835 12:109143796-109143818 GTGCTGGTGCCTGCTGCCTCTGG + Intronic
1103366581 12:120388754-120388776 CAGCAGGTGCCTGGCCCCATGGG + Intergenic
1103718969 12:122963397-122963419 CAGCTGGTGCCAGCTGACATTGG + Intronic
1103810943 12:123613301-123613323 GTGCAGGTGCATGCGGCCTTTGG + Intronic
1104761781 12:131301077-131301099 CTGCAGATCCCAGCTGCCCTGGG - Intergenic
1104782268 12:131429425-131429447 ATGCAGGTGCCTGTTTACATTGG + Intergenic
1105247522 13:18666557-18666579 CTGCAGGACCCGGCTGCCAAAGG + Intergenic
1105617248 13:22030035-22030057 CTGCATGTGACTGCGGCCACGGG - Intergenic
1107759128 13:43657542-43657564 CTGCAGCAGCCTGTTGACATGGG - Intronic
1108229228 13:48319512-48319534 CTGCAGGGGGCTGCTGGCTTCGG + Intronic
1108234536 13:48389663-48389685 CAGCAGGTGCCTGGAGCTATAGG + Intronic
1110832976 13:80053108-80053130 TTGCAGGTGCCTGCCACCACTGG - Intergenic
1111495506 13:89044011-89044033 CTGTAAGTGCATCCTGCCATGGG + Intergenic
1112067913 13:95814223-95814245 CTGAAGGTGCAAGCTGCCAGTGG - Intronic
1112315724 13:98360564-98360586 CTGCAGGTGCCAGCAGCTGTGGG - Intronic
1112450174 13:99501083-99501105 CCGCAGGTGCTTTCTGTCATAGG + Intergenic
1113762298 13:112857984-112858006 ATGCACCTGCGTGCTGCCATGGG - Intronic
1115059198 14:29169442-29169464 CTGCAGGTGACTTCTGCTGTGGG - Intergenic
1116102884 14:40464650-40464672 ATGCACATGCCTGCAGCCATTGG - Intergenic
1118736968 14:68708116-68708138 CTGCCAGTGGCTGCTGGCATGGG + Intronic
1121131884 14:91454810-91454832 CTACAGGTGCGTGCCACCATGGG - Intergenic
1121341439 14:93107555-93107577 CTGCAGGTGGCCTCTGCCACAGG + Intronic
1121868756 14:97387622-97387644 CTGCAGGCTCCTGCTGGCACAGG - Intergenic
1202904017 14_GL000194v1_random:58311-58333 CTGAAGGTGCCAGCAGCCTTGGG - Intergenic
1123459698 15:20458727-20458749 CTGCAGCTGCCTGGTTCCACAGG + Intergenic
1123658364 15:22541693-22541715 CTGCAGCTGCCTGGTTCCACAGG - Intergenic
1124265928 15:28234564-28234586 CTGCAGCTGCCTGGTTCCACAGG + Intronic
1124312229 15:28636185-28636207 CTGCAGCTGCCTGGTTCCACAGG - Intergenic
1124441085 15:29686945-29686967 CTGGAGTTGATTGCTGCCATTGG - Intergenic
1126461205 15:48916912-48916934 CTGGAGGTCCCTTCTGCCAATGG + Intronic
1127297277 15:57619959-57619981 TTTCAGGTCCCTCCTGCCATAGG + Intronic
1128154957 15:65386250-65386272 CTCCAGATGCCTGCAGCCAAGGG - Intronic
1128741306 15:70085694-70085716 CTGCAGGGTCCTGCTGCTGTTGG - Intronic
1129194567 15:73956214-73956236 CTGCAGGGGGCTGCTGCCCTGGG - Intergenic
1131357940 15:91761980-91762002 CTCCAGGTGTCTGCTGCCAATGG - Intergenic
1131460577 15:92614789-92614811 CTGCAGGTGCCTGGCACCACCGG - Intergenic
1132772784 16:1573720-1573742 CTGCTGGTGGCTGCTGCCTGGGG + Intronic
1133035446 16:3031492-3031514 CAGCAGGTGTGTGCTGCCATGGG - Intronic
1133053075 16:3129542-3129564 CTGCGGGCGCCTGCTGTCACAGG + Intergenic
1133546605 16:6813761-6813783 CTGCAGGTGCCTGCTGCCATTGG - Intronic
1134671679 16:16060342-16060364 CTCCAGGTGACTGGTGCCAGTGG + Intronic
1135396163 16:22133060-22133082 CTGCAGGTGGCCGCTTCCACTGG + Exonic
1136501283 16:30670661-30670683 CTGGAGGCGCCTGCTGCTTTGGG - Exonic
1136629805 16:31483283-31483305 CTGCTGGTGGCTGCTGGCTTTGG + Intronic
1138033523 16:53580060-53580082 AGGGAGGTGCGTGCTGCCATCGG + Intergenic
1138525953 16:57607357-57607379 CTGCAGTCGCCTGGGGCCATCGG + Intergenic
1140785418 16:78336650-78336672 TTCCAGCTGCCTGTTGCCATGGG + Intronic
1141486227 16:84342083-84342105 CTGAAGTGGCCGGCTGCCATCGG - Intergenic
1141586613 16:85038073-85038095 CTGCAAGTCCCTGCTTCCATGGG + Intronic
1141662262 16:85447760-85447782 GTGCAGGTGGCTGCTCCCTTTGG - Intergenic
1142621662 17:1169245-1169267 CTGCTGGTGACTTCTGCCATGGG - Intronic
1143256182 17:5559680-5559702 CTGCAGGGGGCTGCTGGAATTGG - Exonic
1144779361 17:17800062-17800084 CTGCAGGTTCCTGGTGCCGCGGG + Intronic
1147324227 17:39662728-39662750 CTGCTGGTGCCAGCTGCAAGGGG + Intronic
1147388206 17:40094022-40094044 CTGCAGGAGCTTGGTGCCATGGG - Exonic
1147418953 17:40312509-40312531 CTGCACGTCCCTCCTGCCAGGGG - Intronic
1147441982 17:40453033-40453055 CTGCAGGCACCTGCGGTCATGGG - Exonic
1147459157 17:40557582-40557604 CTGAAGGAGGCTGCTGCCTTTGG + Intronic
1147646368 17:42036711-42036733 CTGCAGGGGCCCCCTGCAATTGG + Intronic
1149287409 17:55180121-55180143 CTGCAGGTGCCTCCTCCATTGGG + Intergenic
1150564858 17:66329658-66329680 CAGGAGGTCCCTACTGCCATAGG + Intronic
1151023072 17:70642055-70642077 TTGAAGGTTCCAGCTGCCATGGG + Intergenic
1152155009 17:78627214-78627236 GGACATGTGCCTGCTGCCATCGG + Intergenic
1152205539 17:78972614-78972636 CTGCAGCTGCCTGGCCCCATAGG + Exonic
1152461882 17:80445915-80445937 CTGCAGGGGCCTCCTGCCAGGGG + Intergenic
1152529187 17:80907016-80907038 CTGCAGATGCCTGAGGCCACTGG - Intronic
1153467389 18:5404132-5404154 CTGCCTGGCCCTGCTGCCATGGG + Intronic
1153658724 18:7307774-7307796 CTGCAGCTGCCTCCTGCCAAGGG + Intergenic
1153698533 18:7668635-7668657 ATGCAGCTGCCTCCTGCCAGTGG + Intronic
1154321409 18:13356293-13356315 CTGCGGGCGCCTGCTGCCAAAGG - Intronic
1156098645 18:33566370-33566392 CCGCTGGTGCCTGCAGTCATTGG + Intergenic
1157724330 18:49952265-49952287 CTGCAGGGGCCTGATAACATTGG - Intronic
1158876895 18:61742717-61742739 CAGCAGGTGCTGGCTGCCCTTGG - Intergenic
1160428921 18:78798038-78798060 CTGCAGGTGTCTAATGTCATAGG + Intergenic
1161152301 19:2716301-2716323 CTGCTGGTGCTGGCTCCCATCGG + Exonic
1161344258 19:3760128-3760150 CTGCCGGGGCCTCCTGGCATAGG + Exonic
1161454461 19:4363110-4363132 CTGCACGTTGCTGCTGCCACAGG - Intronic
1161848835 19:6728282-6728304 CTGCATGTGCATGCTGCAGTCGG - Intronic
1165342884 19:35225104-35225126 CTGCAGCTGCCTGCCGCCGGTGG + Exonic
1167265363 19:48480442-48480464 CGGCAGGTGCCTGTGGCCAAGGG - Intronic
1167317146 19:48771090-48771112 CTGCTGGTGCCAGCTGCCAAGGG - Intergenic
1168243442 19:55098462-55098484 CTGCACATGGCTGCTGCCAAGGG + Intronic
1168244293 19:55103427-55103449 CTGCACGTGGCTGCTGCCAAGGG - Exonic
925060561 2:886739-886761 CTGGAAGGGCCTCCTGCCATCGG - Intergenic
925386074 2:3462771-3462793 ATGCAGGTGCCTGCCACCTTAGG + Intronic
925573679 2:5337931-5337953 CTGCAGGTACCTGAAGCCCTAGG + Intergenic
925868686 2:8250903-8250925 CTGGAGGTGTCTCCTGCCAGAGG + Intergenic
925996496 2:9297962-9297984 GTGCTGGTGCCTGCTGCCTGTGG + Intronic
926441183 2:12890356-12890378 CCGGAGGTGCCTGATGGCATTGG - Intergenic
929044533 2:37776951-37776973 GTGCAGGTGCTTGCTGCCCAAGG + Intergenic
929144935 2:38698356-38698378 CTGTTGGTGCCACCTGCCATGGG - Intronic
929260936 2:39865934-39865956 CTGCAGGTGACAGCTGCCTGTGG + Intergenic
931053716 2:58443474-58443496 GGGCAGGTGCCTCCTGCCAGAGG - Intergenic
932822263 2:74911613-74911635 CTGCAGCTGCCTGCTGACCCTGG + Intergenic
933735611 2:85491535-85491557 CTGAAGTTTGCTGCTGCCATTGG - Intergenic
934622906 2:95826421-95826443 CTGCAGCTGCCTGCTGCCTGAGG - Intergenic
934810865 2:97275682-97275704 CTGCAGCTGCCTGCTGCCTGAGG + Intergenic
934826827 2:97432257-97432279 CTGCAGCTGCCTGCTGCCTGAGG - Intergenic
935515513 2:104032200-104032222 CTGCAGATGACTTCTGCTATAGG + Intergenic
936154544 2:110039674-110039696 CTGCAGGTGCCTGCTGGGCAGGG + Intergenic
936160984 2:110084199-110084221 CTGCACGTGCCTTCTGTCATTGG - Exonic
936183679 2:110287155-110287177 CTGCACGTGCCTTCTGTCATTGG + Intergenic
936190139 2:110331740-110331762 CTGCAGGTGCCTGCTGGGCAGGG - Intergenic
936350081 2:111706004-111706026 CTGCAGGTGGCTGATGCTTTTGG - Intergenic
937006396 2:118520473-118520495 CTGCAGCTGCCTTCTGCATTTGG + Intergenic
938687235 2:133750699-133750721 ATGCAGGTGTCTGGAGCCATGGG - Intergenic
940896905 2:159089620-159089642 TTGCAGATGCCTGCTCACATGGG - Intronic
940906286 2:159172893-159172915 CTGCTGGAGCCAGCAGCCATGGG + Intronic
941720802 2:168810510-168810532 GTGAATGTGCCTGCTGCAATAGG + Intronic
943433503 2:187833638-187833660 CTCCAGTTGGCTTCTGCCATTGG - Intergenic
944102927 2:196048368-196048390 ATGGAGCTGCCTGCTGCCAGTGG + Exonic
945300145 2:208208378-208208400 CTGAAGGTTGCTGCTGTCATGGG + Intergenic
946502183 2:220261328-220261350 CTGCTGCTGAATGCTGCCATGGG + Intergenic
947126354 2:226873078-226873100 CTGCAAGTGCTAGCTGCCACAGG + Intronic
947743724 2:232496996-232497018 CCCCAGGCGCCTGCTGCCAGGGG - Intergenic
1169065812 20:2693544-2693566 CTGGAGGCGCCTGGTGCCGTCGG + Intronic
1170520498 20:17180023-17180045 CTGCAGCTTCCTGCTGTCCTGGG + Intergenic
1170530714 20:17288232-17288254 CAGCAGGTGTCTGCTACCCTAGG + Intronic
1170757963 20:19221497-19221519 CTCCAGGTGCCTCCTACAATAGG + Intronic
1171411874 20:24953066-24953088 CTGCAGCTCCCTGCTGCCTTGGG + Intronic
1172442820 20:34977927-34977949 CTTCCAGTGCCTGCTGCCTTGGG + Exonic
1172599693 20:36175300-36175322 CTGCAGGCTACTGCTGCCATAGG - Intronic
1172923410 20:38507496-38507518 CTGTAGCTCCCAGCTGCCATGGG - Intronic
1174865524 20:54131836-54131858 CAGCTGGTGCCTGCTTCCATTGG + Intergenic
1175339420 20:58218742-58218764 CTGCATGTGGCTGCAGCTATGGG - Exonic
1175546845 20:59783757-59783779 CCGCAGGTGCCTGCAGCAAGGGG + Intronic
1175787309 20:61720130-61720152 CTGCAGGGCCCTCCTGCCTTCGG + Intronic
1175893063 20:62323775-62323797 ATGCAGGTGCCTCCTGCGAGCGG - Exonic
1176454739 21:6898610-6898632 CTGCAGGACCCGGCTGCCAAAGG + Intergenic
1176623388 21:9073078-9073100 CTGAAGGTGCCAGCAGCCTTGGG - Intergenic
1176832911 21:13763658-13763680 CTGCAGGACCCGGCTGCCAAAGG + Intergenic
1177488952 21:21796584-21796606 CTACAGGTGCCTGCCACCATGGG - Intergenic
1179069712 21:38060130-38060152 CAGCACATGCCTGCTGCCGTGGG - Intronic
1179968135 21:44818399-44818421 CCCCAGGTCCCTGCGGCCATGGG - Intronic
1180001988 21:44999291-44999313 CTGCAGGTGCCTGCTACACGTGG - Intergenic
1180063880 21:45403347-45403369 GGGCAGGTGCCTGCTGCCAGGGG - Intergenic
1180787372 22:18554477-18554499 CTGCCCGGGCCTGCTGCCAGGGG - Intergenic
1181026525 22:20130810-20130832 CTGCAGGCCCCTGCTCCCCTGGG - Intronic
1181234367 22:21440828-21440850 CTGCCCGGGCCTGCTGCCAGGGG + Intronic
1181244281 22:21494003-21494025 CTGCCCGGGCCTGCTGCCAGGGG - Intergenic
1182243034 22:28932407-28932429 TTCCTGGTGCCTGCTGCCTTTGG + Intronic
1182526250 22:30922205-30922227 GTGCAGGTGCCTGTGGCCTTTGG - Intergenic
1182620263 22:31614912-31614934 ATGGAGGTGCCCGCTGCCTTTGG - Intronic
1182963620 22:34501366-34501388 GAACAGGTGCCTCCTGCCATGGG + Intergenic
1183537819 22:38413293-38413315 CTGCAGATGCCGGCTGCAAAGGG + Intergenic
1184103010 22:42351418-42351440 GTCCAGCTGCCTGCTGCCGTGGG + Intergenic
1184436955 22:44484940-44484962 CTCCAGTTGCCTGCTGCCCCAGG - Intergenic
1184612578 22:45614307-45614329 CTGCAGGTGCCAGCTCCCCATGG + Intergenic
1184830103 22:46979948-46979970 CTGCAGATGCCTCTTCCCATGGG - Intronic
1185316113 22:50179757-50179779 CTGCAGGGACCTGATGCCCTCGG + Exonic
949141287 3:636397-636419 CTTCAGGTGCCTGCTGTCAGAGG - Intergenic
950369588 3:12517498-12517520 CTGTTGTTGCCTGCTGCCTTTGG + Intronic
953388228 3:42519163-42519185 GTGCAGGTGCCTCCAGCCCTGGG - Intronic
954291484 3:49652309-49652331 CTGCAGGGTCCCACTGCCATCGG - Exonic
954381721 3:50222311-50222333 CTGCCGGAGCCTGCTGCCCATGG - Intergenic
954630307 3:52044441-52044463 CTGCAGGGGCCTGGTGCCAGTGG + Intergenic
955241210 3:57179969-57179991 CTGCAGGAGCCAGCTGCTGTAGG - Intergenic
956876191 3:73466132-73466154 CAGCAGGAGCCTGCTGTAATTGG + Intronic
957216400 3:77325464-77325486 CTGCTGCTGTCTGGTGCCATGGG + Intronic
958116248 3:89221860-89221882 TTGCAAGTTCCTGCTGCCAAGGG + Intronic
958185805 3:90117928-90117950 CAGCAGGAGACTGCTGCTATGGG + Intergenic
962367430 3:134795718-134795740 CTGCTGGTGCCGGCCGCCTTGGG + Intronic
964285503 3:155113417-155113439 CTACAGGTGCCTGCCACCATGGG + Intronic
966871893 3:184295998-184296020 CTGCAGGTGCTTGGTTCCAGAGG + Intronic
968825446 4:2893054-2893076 CTACAGGTGCCTGCCACCACAGG + Intronic
968891291 4:3370123-3370145 CTGCAGTGTCCTGTTGCCATGGG + Intronic
968958984 4:3733332-3733354 CTGCCGGTGGCTGCTGTCCTGGG + Intergenic
968968161 4:3779911-3779933 CTGCAGGTGCCTCCAGACAATGG + Intergenic
969287998 4:6219783-6219805 TTGCAGGTGCCTGTACCCATTGG + Intergenic
969610687 4:8226256-8226278 CTGCTGGCGCCTGCTGGCTTTGG - Intronic
970058243 4:11999947-11999969 CTGAAGTTGCATGCTGCCACTGG + Intergenic
970808803 4:20066876-20066898 GTGCAGCTGCCTGCTTCCAGAGG - Intergenic
970963221 4:21897909-21897931 CACCACGTGCCTGCTGCCAGGGG - Intronic
972092232 4:35301618-35301640 CTTCAGGGGCCTGCTGTCAGGGG - Intergenic
972238241 4:37158942-37158964 TTCCAGGTACCTGCTGTCATTGG + Intergenic
977371951 4:96148693-96148715 CTACAGGTGCCTGCCACCACTGG - Intergenic
978274157 4:106928840-106928862 CTGCAGTTGCCAGTTGCCATTGG + Intronic
979711736 4:123787911-123787933 GTGTAGGTGCTTGCTGCCAAAGG + Intergenic
979727887 4:123986358-123986380 CTGGATGTGCCTGTTGCCACTGG + Intergenic
984487929 4:180396284-180396306 CTACAGGTGCCCGCTACCACAGG + Intergenic
985590165 5:760366-760388 CTGCGTGTGTCTGCTGCCGTTGG - Intronic
985854129 5:2411936-2411958 CTGCAGATAGCTGCTGCCACAGG + Intergenic
985952956 5:3237312-3237334 CTTCTGCTGCCTGCTTCCATGGG - Intergenic
986733233 5:10649968-10649990 CTGCAGGTGGCCGCTGTCCTTGG - Exonic
989089694 5:37717325-37717347 CTGCAGTGGCCTTCTGCCATTGG + Intronic
989131996 5:38116021-38116043 CTACAGGTGCCTGCCACCATTGG - Intergenic
989482839 5:41951909-41951931 CTGAAGTTTACTGCTGCCATTGG - Intergenic
990616856 5:57517489-57517511 CAGCATGAGCCTGCTGCCAAAGG - Intergenic
990652627 5:57919220-57919242 CTGCAATTGCCTATTGCCATAGG + Intergenic
996432129 5:123392993-123393015 TTGCTCGTGCCTGCTGCCCTAGG + Intronic
1000228211 5:159290396-159290418 TTGCAGCTGCATGCTCCCATAGG - Intergenic
1000721943 5:164719040-164719062 CTGCTTGTGCCTCCTCCCATTGG + Intergenic
1002417903 5:179130336-179130358 CTGGAGGTGCCGGCTCCCCTTGG + Intronic
1002690723 5:181048152-181048174 CTGCAGGACCACGCTGCCATAGG - Exonic
1004425358 6:15503433-15503455 CAGCAGATGCTTTCTGCCATTGG - Intronic
1006118954 6:31792397-31792419 CTGGAGGTGGCTGCTGCTGTTGG + Exonic
1008682482 6:53887833-53887855 CTGCAGATGCCGGTTGGCATGGG + Intronic
1009689151 6:67004509-67004531 ATGCTGGTGACTGCAGCCATGGG + Intergenic
1010001610 6:70955468-70955490 CTGCAGGCGCTGGCTGCGATAGG - Intronic
1012359762 6:98362396-98362418 CAGCAGGTGCCTGCTGTTGTTGG + Intergenic
1012888458 6:104872389-104872411 CTGAAGGTGCCCCCTGCCCTTGG - Intergenic
1013418713 6:109947247-109947269 CTACAGGTTCCTGCAGCCATAGG + Intergenic
1017483248 6:154879290-154879312 CTGTAGGTACCTGGTGCCATGGG + Intronic
1018461702 6:164004854-164004876 CTGCAGATTCCTACTGTCATTGG + Intergenic
1018786070 6:167108912-167108934 CTGGAGGTGCCTGCTCCTCTTGG + Intergenic
1019435099 7:1018538-1018560 CGCCAGGTGCCTGCTCCCACTGG - Intronic
1019873953 7:3792253-3792275 CTGCAATTGCCTGAGGCCATGGG + Intronic
1024015681 7:45312124-45312146 CTGCTGCTGCCTGCTGCCTCCGG - Intergenic
1024620497 7:51153101-51153123 CTGTGGGTCCCAGCTGCCATGGG + Intronic
1028193217 7:87876095-87876117 CTGCAGCTGCCTTCTGCCCCAGG - Exonic
1029434701 7:100556438-100556460 CTTTGGGTGCCTTCTGCCATTGG + Intronic
1032250940 7:130256735-130256757 CTGCACGAGCCTGCAGCCACTGG - Intergenic
1032650124 7:133868975-133868997 CTCCAGGTGCCTGCTGGGAGAGG - Intronic
1034678807 7:152912096-152912118 CTGCAGCGGCCTCCTGCCCTTGG - Intergenic
1034724380 7:153321835-153321857 AAGCAGGTGCCTCCAGCCATTGG + Intergenic
1034785984 7:153925969-153925991 CTGCAGGTACCTGCTGTGGTCGG - Intronic
1035020506 7:155797484-155797506 GTGCAGGTGGCACCTGCCATTGG - Intergenic
1035117981 7:156540823-156540845 CTCCAGGGGCCTGCTCCCACAGG - Intergenic
1035259531 7:157652742-157652764 CGGCAGGTGCCTGCCCCGATGGG - Intronic
1035703252 8:1653345-1653367 CTGCAGGTGCCTGGGGTCATAGG + Intronic
1035890193 8:3335105-3335127 CTGGAGGTGCCTGCAGTCAATGG + Intronic
1036803240 8:11808515-11808537 CCGCAGGCGGCTGCGGCCATGGG - Intronic
1037651339 8:20841659-20841681 CTGAAGGTGCCTGATGGCCTAGG + Intergenic
1038053894 8:23839445-23839467 CTGCAGGTGTCCTCTGCTATAGG - Intergenic
1039392843 8:37195830-37195852 CTGCAGGAGACTGCTGACAGAGG + Intergenic
1039842160 8:41301868-41301890 TGGCAGGTGCCTGCTGCCGTGGG + Intronic
1042591795 8:70403719-70403741 CGTCAGGTGCCGGCTGCCGTCGG + Exonic
1049201813 8:141343990-141344012 CTCCAGGTGCCCCCTGCCCTTGG + Intergenic
1049709183 8:144056051-144056073 CTGCAGGCCCCTGCAGCCTTGGG + Intronic
1050204375 9:3181607-3181629 CTGCTGGCACCTGCTGCCCTCGG + Intergenic
1056376823 9:86022780-86022802 TTGCAAGTGCCTGCTGCCAGAGG + Intergenic
1056548800 9:87634877-87634899 CTGCACACCCCTGCTGCCATGGG + Intronic
1057514615 9:95710814-95710836 CCACAGGTGCCGGCTGGCATCGG - Intergenic
1059320928 9:113468833-113468855 CTGCAGGTGGCTGTGGACATTGG + Intronic
1060221910 9:121768628-121768650 GAGCAGGTGCCTGTTGCCGTGGG + Exonic
1060782551 9:126423578-126423600 CTGAAATTGCCTGCTGCCGTGGG - Intronic
1062355605 9:136160591-136160613 CTGCAGGTGTCTGCTCCCTAGGG - Intergenic
1062432435 9:136532103-136532125 AGGCAGGTGCCTGCAGCCCTGGG + Intronic
1203746571 Un_GL000218v1:43506-43528 CTGAAGGTGCCAGCAGCCTTGGG - Intergenic
1203563539 Un_KI270744v1:75974-75996 CTGAAGGTGCCAGCAGCCGTGGG + Intergenic
1185659268 X:1714079-1714101 CTCCAGGTCCTTGCTGCCAAAGG - Intergenic
1189854529 X:45210261-45210283 CATCATGTGGCTGCTGCCATGGG + Intergenic
1190549418 X:51563503-51563525 CTGCACATGCCTGCAGCCACTGG + Intergenic
1190581612 X:51896460-51896482 CTCCAGGTCCCTGCAGCCAGTGG - Exonic
1193856836 X:86612654-86612676 CACCAGGTGGCTGCTGCCAGGGG + Intronic
1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG + Intergenic
1195495378 X:105525884-105525906 CTGCAGATGCAGGGTGCCATGGG - Intronic
1195996361 X:110735699-110735721 CTCCAGGTGCCTGATGTCATTGG - Intronic
1195998790 X:110759333-110759355 CTCCTGGTGCCTGCTGCCCATGG + Intronic
1197038245 X:121903957-121903979 CTGCATGCTCCTGCCGCCATTGG - Intergenic
1197555490 X:127947456-127947478 CTGCAGGTGCTTGAAGCCACTGG + Intergenic
1198609184 X:138378790-138378812 CTGAAGGTGCCTCCTCCCACTGG - Intergenic
1199169330 X:144717826-144717848 CTGTGTGGGCCTGCTGCCATTGG - Intergenic
1201159899 Y:11158520-11158542 CTGAAGGTGCCAGCAGCCTTGGG - Intergenic
1201390255 Y:13489979-13490001 CAGCATATGTCTGCTGCCATTGG - Intergenic
1202147660 Y:21816909-21816931 CGGCAGGTGGCTGCTAACATGGG - Intergenic
1202577045 Y:26338853-26338875 CTTCATGTGGCTGCTGCCAAGGG - Intergenic