ID: 1133549721

View in Genome Browser
Species Human (GRCh38)
Location 16:6842439-6842461
Sequence TTGTATATAAATATAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 427}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133549721 Original CRISPR TTGTATATAAATATAGAGCA AGG (reversed) Intronic
900758281 1:4453080-4453102 TTTTATAGAAATAGAGAGTAGGG + Intergenic
901573568 1:10181863-10181885 TTATATATATATATATAACATGG + Intergenic
904763921 1:32827348-32827370 CTGTATCTTAATATATAGCATGG - Intronic
904984355 1:34532613-34532635 ATGTATTTATATATAGAGCTAGG + Intergenic
907172500 1:52482257-52482279 TTGTATATGAGTATAGAAAAAGG - Intronic
908375561 1:63536056-63536078 TTGTATGTAAGTCAAGAGCAGGG + Intronic
908936168 1:69378709-69378731 ATGTATATAAATAAAAAACAAGG - Intergenic
909212528 1:72842785-72842807 TGGTATATATATATATACCATGG + Intergenic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
910054707 1:83018889-83018911 ATGTATACACATATATAGCAGGG - Intergenic
910592862 1:88946759-88946781 TTCTATATAAGCATAGAGCTTGG + Intronic
911551493 1:99287245-99287267 TGGTATATATATATACACCATGG - Intronic
911903246 1:103531203-103531225 TGGTATATATATATATAACATGG - Intronic
911908450 1:103599464-103599486 ATATATATATATATATAGCAAGG - Intergenic
911914470 1:103680000-103680022 ATATATATATATATATAGCAAGG + Intronic
912143896 1:106767919-106767941 TTGTATAAAAATATACATCATGG + Intergenic
912157118 1:106934581-106934603 TTGTCTATAAATATAATACATGG - Intergenic
912764115 1:112393543-112393565 TTGTAAATAAATTTAGAGTCTGG - Intergenic
913496626 1:119433648-119433670 ATGTATATAAGTACAGAGAATGG + Intergenic
913498335 1:119448478-119448500 GTGTATATTAATACAGAGAATGG + Intergenic
914004839 1:143723435-143723457 ATGTATTTAAATTTAGATCAGGG + Intergenic
917026132 1:170644510-170644532 CTGTATATAAAACTAGAGAAAGG - Intergenic
917465129 1:175269554-175269576 TTGTATATAAAGACAAATCATGG - Intergenic
917729880 1:177864086-177864108 TTTTATATAAATAAATAGAAAGG - Intergenic
918760291 1:188396135-188396157 ATGTATATATATATATAACATGG + Intergenic
918870664 1:189969631-189969653 TTATATATTAAAATACAGCATGG - Intergenic
919342896 1:196336461-196336483 TTGTATATAATTATAGGCCATGG - Intronic
920646729 1:207809192-207809214 TTGCATATAAAAAAAGAGAAAGG - Intergenic
920875943 1:209835906-209835928 TTGTATATAAATATAGGCACAGG - Intronic
921895507 1:220395641-220395663 CTGTAGATAAAAATAAAGCAGGG - Intergenic
922367244 1:224877590-224877612 TGGTATATATATATACACCATGG + Intergenic
923608032 1:235463011-235463033 TGGTATATATATATATACCATGG + Intronic
924604754 1:245523477-245523499 TTGTTTATAAATTTAGACTATGG - Intronic
1063760909 10:9074979-9075001 TTTTATTTAAATATAAAGCATGG - Intergenic
1065132923 10:22640850-22640872 TTCTACATAAACATAGAGCAAGG + Intronic
1065364313 10:24920315-24920337 GTGTATATATATATATACCATGG + Intronic
1065445683 10:25795930-25795952 TTGATTATAAATATAGTGCTTGG - Intergenic
1065814457 10:29471466-29471488 CTGTACATCAATATAAAGCAAGG - Intronic
1065939043 10:30547163-30547185 ATGTATAAAAATATACAGAATGG - Intergenic
1066136078 10:32447334-32447356 TTATATATACATAGAAAGCAAGG - Intronic
1066312988 10:34216180-34216202 TTGCATACAAATATTGAGCTGGG - Intronic
1066466099 10:35651721-35651743 TTGAAAATAAATATATAGCCAGG - Intergenic
1067519671 10:46988406-46988428 TTGTATATATTTAAAGAGCTAGG - Intronic
1067642577 10:48063433-48063455 TTGTATATATTTAAAGAGCTAGG + Intergenic
1068545369 10:58338245-58338267 TTATATGTAAAGACAGAGCATGG + Intronic
1068953291 10:62799837-62799859 TTTTATATTAGTATAGAACATGG - Intergenic
1069295276 10:66836130-66836152 TTGTAGCTTAATATAGATCATGG - Intronic
1070005141 10:72416940-72416962 TTTTAAACAAATATAAAGCAAGG - Intronic
1070697639 10:78574671-78574693 CTGTATTTACATAGAGAGCAAGG + Intergenic
1071051294 10:81451813-81451835 TTGTATAGATATATATACCATGG + Intergenic
1071932045 10:90483479-90483501 ATATATATAAATATACACCATGG - Intergenic
1072233881 10:93436893-93436915 TTCCATGAAAATATAGAGCAAGG - Intronic
1072988816 10:100169483-100169505 TGGTATATAAATATATGGAAAGG + Intronic
1073778259 10:106809665-106809687 TTATATATATATATAGTGAAGGG - Intronic
1073811827 10:107160884-107160906 TACTATATAAATTTAGATCAGGG + Intronic
1073877220 10:107938851-107938873 GTGTATATATATATACACCATGG - Intergenic
1074477607 10:113786813-113786835 TAGCATATAAATATAGGGCATGG + Intergenic
1074852733 10:117451685-117451707 TGGTCTATAAATATAAAGCTCGG - Intergenic
1075052880 10:119195907-119195929 TTATATATATATATAGTTCAAGG - Intergenic
1075535900 10:123271892-123271914 ATGTATATATATATAGAAGAAGG - Intergenic
1076153813 10:128187447-128187469 TTCTTTATCAAGATAGAGCAGGG - Intergenic
1076455241 10:130588260-130588282 TTGTATATAATTTTAGAAGATGG + Intergenic
1077346586 11:2060678-2060700 TTATAGAGAAGTATAGAGCATGG - Intergenic
1077742440 11:4861489-4861511 ATGTATATATATATAGAGAGAGG + Intronic
1078707105 11:13755145-13755167 TGGTATATATATATACACCATGG + Intergenic
1079557874 11:21783310-21783332 TTTTATGTAAAAATATAGCAAGG + Intergenic
1082160545 11:48883963-48883985 TTATATATAAATATAGTTAAAGG + Intergenic
1082161821 11:48896443-48896465 TTATATATAAATATAGTTAAAGG - Intergenic
1082167406 11:48964889-48964911 TTATATATAAATATAGTTAAAGG - Intergenic
1082236159 11:49821771-49821793 TTATATATAAATATAGTTAAAGG + Intergenic
1082242538 11:49888034-49888056 TTATATATAAATATAGTTAAAGG - Intergenic
1082655316 11:55848177-55848199 ATGCAAATAAATACAGAGCATGG + Intergenic
1082657024 11:55868837-55868859 TTATATATAAATATAGTTAAAGG - Intergenic
1082736168 11:56858435-56858457 TTGTGCAAAAATATAGAGAAAGG + Intergenic
1085214668 11:74818363-74818385 CTGTATATTAAAACAGAGCACGG - Intronic
1085854113 11:80156744-80156766 ATGTATATAAGAATAGAGCAGGG - Intergenic
1085978048 11:81684321-81684343 TTTTATATAAATTTACAGCATGG + Intergenic
1086260394 11:84932719-84932741 TAGTATATATATATATACCATGG - Intronic
1086794795 11:91086218-91086240 TTGTTTAGAAATACAGAGGAAGG + Intergenic
1087368853 11:97255275-97255297 TTTTATAGAAATGTAGAGAATGG + Intergenic
1087501253 11:98956997-98957019 TTCTATATATATAATGAGCAGGG - Intergenic
1088217236 11:107524509-107524531 TGGTATAGAAAAATAAAGCATGG - Intronic
1088363496 11:109016128-109016150 TTGTTTATGAACTTAGAGCAAGG + Intergenic
1088473121 11:110208118-110208140 TTGTAGATAAAAATAGATCTGGG - Intronic
1088507989 11:110544624-110544646 TTTTATATTAAAATATAGCAGGG + Intergenic
1089771420 11:120805910-120805932 TGGTATAAAAATTCAGAGCATGG + Intronic
1090102630 11:123816333-123816355 TTGTATAGTAATTAAGAGCATGG + Intergenic
1091339113 11:134796459-134796481 GTGTATCTAAACATAGAGCGGGG - Intergenic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1092609959 12:10161993-10162015 TAGTATATTAATATAAAGCGAGG + Intronic
1092891093 12:12969937-12969959 CTGTATATAAATACAGTGGAAGG - Intergenic
1093254402 12:16848836-16848858 TTGTATATACAAACTGAGCATGG - Intergenic
1093823827 12:23656764-23656786 TTTTATATAAATATATATAATGG + Intronic
1093888981 12:24496857-24496879 TTGTATATTCATAAAGAGCAAGG - Intergenic
1094749599 12:33390561-33390583 TTTTATATATATATAGAGGGTGG - Intronic
1095456446 12:42390835-42390857 TTGTATATAAAAATAGAGATGGG + Intronic
1095563896 12:43597868-43597890 TTGTCTATAAATATAGAGCTTGG + Intergenic
1096326289 12:50665134-50665156 ATATATAGAAATATAGAGCAGGG - Intronic
1097652015 12:62310589-62310611 TTGTATATATATATAAACAATGG - Intronic
1098485062 12:71011075-71011097 TTATATATATATATATAGCGGGG - Intergenic
1099600686 12:84733365-84733387 TTGTATAGAAATAAAGATAATGG - Intergenic
1099688315 12:85917961-85917983 TTGTGTATCAATGTAGAGAAAGG + Intergenic
1100604371 12:96139309-96139331 TGGTATATATATATATACCATGG - Intergenic
1100794183 12:98163170-98163192 TTGTATCCAAATACAAAGCAAGG - Intergenic
1101544937 12:105703718-105703740 CTGTATATAAATCTAGCTCACGG - Intergenic
1103148064 12:118612445-118612467 TTATATATATATATATAGCTGGG + Intergenic
1103174416 12:118849849-118849871 TTTTAAAAAAATATAGAGAATGG - Intergenic
1103577712 12:121890930-121890952 TTAAAAACAAATATAGAGCACGG - Intronic
1104237336 12:126951643-126951665 TTGTTTATAAATATAGAGACAGG - Intergenic
1104304834 12:127600263-127600285 TTGTCTATAAAGATAGAGTGAGG + Intergenic
1104453997 12:128894880-128894902 TTATATATATATATATAACATGG + Intronic
1104680245 12:130745961-130745983 TTGTATTTAAATATTGTACATGG - Intergenic
1105555538 13:21444758-21444780 CTGTATAAAAATATAGGGCTGGG + Intronic
1106572712 13:30941862-30941884 GTGTATATATATATACACCATGG - Intronic
1106639662 13:31570726-31570748 GTGTATATAACTATATAGAAGGG - Intergenic
1106772115 13:32971655-32971677 ATGTGTAGAAATATACAGCAAGG - Intergenic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1108380908 13:49853260-49853282 CTGGATATAAAAATAGAGGATGG - Intergenic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1109090244 13:58033451-58033473 TTTTACATGAATATAGAACAAGG - Intergenic
1109145682 13:58776543-58776565 TGGTATATATATATATATCATGG + Intergenic
1109278236 13:60325734-60325756 TTGCACATAGTTATAGAGCAAGG + Intergenic
1109402326 13:61850493-61850515 TTATATTTAAATATAAAGTATGG + Intergenic
1109516222 13:63445152-63445174 ATGTATATATATATAGAGAGAGG + Intergenic
1109917996 13:69017024-69017046 TTGGATATTAAAATACAGCAGGG + Intergenic
1110727935 13:78847645-78847667 TTGTCTAAAAATATACAGCAAGG - Intergenic
1110755801 13:79172325-79172347 ATGTATATATATATATACCATGG - Intergenic
1111390601 13:87589926-87589948 TTGTAAATATATAGAGAGGAAGG + Intergenic
1111466343 13:88616412-88616434 TTGTATATTGATAAATAGCAAGG + Intergenic
1111581516 13:90229657-90229679 TTGTATAGATGTATACAGCATGG - Intergenic
1111814764 13:93137910-93137932 TTAAAAATAAATATAGAACAAGG - Intergenic
1112922205 13:104627867-104627889 TGGTATATACATATAGAGCATGG + Intergenic
1115318109 14:32048126-32048148 TGGTATATTAATATAAATCAAGG + Intergenic
1115897806 14:38109425-38109447 TCATTTCTAAATATAGAGCATGG - Intergenic
1116252919 14:42509783-42509805 TGGTATATATATATATACCATGG + Intergenic
1116342532 14:43742930-43742952 TTGCATTTATAAATAGAGCATGG - Intergenic
1116368051 14:44093899-44093921 TGGGATACAACTATAGAGCAAGG - Intergenic
1116455339 14:45114586-45114608 CTGTATATAATTATAGTGCGTGG + Exonic
1117100382 14:52339984-52340006 TTTTATATTTATATAGACCAGGG - Intergenic
1117259870 14:54020976-54020998 TGGTATATATATATACACCATGG + Intergenic
1117697369 14:58379026-58379048 TGGTATATATATATACACCATGG - Intergenic
1117932780 14:60862223-60862245 TTTTAAATAAATATTAAGCAAGG + Intronic
1118269977 14:64333942-64333964 TTATATATAAATATATATTAAGG + Intronic
1118477553 14:66132464-66132486 ACATATATAAATATATAGCACGG + Intergenic
1118561530 14:67088999-67089021 TTGCATATACATCTTGAGCAAGG - Exonic
1119552288 14:75523756-75523778 AAGTATATAAATATTGAACAGGG + Intronic
1120473384 14:84955773-84955795 TTTGATATATATATATAGCATGG + Intergenic
1120569753 14:86102116-86102138 ATGTATATATATATATACCAGGG + Intergenic
1120708549 14:87770136-87770158 TTATTTAGAAATATAGAGGAAGG + Intergenic
1121689441 14:95865594-95865616 TTTTAAATATATATTGAGCATGG + Intergenic
1121862651 14:97333379-97333401 TAATATATAAATATATATCATGG + Intergenic
1122106033 14:99455712-99455734 CTGTATATAAATACAAAGCAGGG + Intronic
1123887397 15:24740185-24740207 TTCTTTTTAAATATACAGCATGG - Intergenic
1124631080 15:31337703-31337725 TTGTATCTAAATATAGAAAAAGG + Intronic
1124800663 15:32829806-32829828 TTCTATCTAGATATAGAACATGG - Intronic
1124862864 15:33459759-33459781 TAGTATACAAATTTAGAGCAAGG - Intronic
1125126218 15:36224608-36224630 TTTTATATAAAAATAAAGTATGG + Intergenic
1125359283 15:38848629-38848651 ATATATATATATATAGAACAGGG + Intergenic
1125986721 15:44060425-44060447 TTGTAGATATATATGGTGCAGGG - Intronic
1126596693 15:50390418-50390440 ATATATATATATATATAGCATGG + Intergenic
1127877636 15:63124236-63124258 TTGGCTATGATTATAGAGCAAGG + Intronic
1128189152 15:65674024-65674046 TTCTTCATAAATATACAGCAAGG + Intronic
1130227039 15:82066902-82066924 TTCTATATAAATGTAGAATATGG - Intergenic
1131351409 15:91703864-91703886 ATGTATAGAAATATAGAGAAAGG - Intergenic
1132361717 15:101221485-101221507 TTGTTTATATATATAGAGAGAGG - Intronic
1133549721 16:6842439-6842461 TTGTATATAAATATAGAGCAAGG - Intronic
1135199612 16:20425787-20425809 TGGTATATAAATATATATAATGG - Intronic
1137286662 16:47021736-47021758 TTTTACATAAATAGAGAGCCGGG - Intergenic
1138670731 16:58612201-58612223 TGATATTTAAATTTAGAGCAAGG - Intronic
1138788984 16:59879974-59879996 TAGTAGATACATATATAGCATGG - Intergenic
1139510420 16:67425073-67425095 TGGTATGCAAATATCGAGCAGGG - Intergenic
1140157668 16:72449712-72449734 TTGTATATATATAGAGAGACAGG + Intergenic
1143413504 17:6727441-6727463 GTGTATATATATATAAAACATGG - Intergenic
1144161261 17:12561126-12561148 TGGTATATATATATACACCATGG - Intergenic
1144560715 17:16318569-16318591 TTATATATATATAAAGAGTAGGG - Intronic
1146232453 17:31125316-31125338 TTGTATATATATATATATCTGGG + Intronic
1146556880 17:33832766-33832788 ATGTATATAAATATATTCCAAGG + Intronic
1149197940 17:54145480-54145502 TTGTTTATAAATTTGGTGCATGG + Intergenic
1149354708 17:55827996-55828018 GTGTATATTAATATAGTGCCTGG + Intronic
1149509271 17:57225072-57225094 TTGTATTTATTTATAGAGCTGGG + Intergenic
1149669682 17:58395328-58395350 TTGTATATACATTTAAAGCTAGG - Intronic
1150287198 17:63961098-63961120 CTGTATGTAAATATAGGGCACGG - Intronic
1150307111 17:64095051-64095073 TTGTATAGAAATATAAGTCAAGG + Intronic
1150431202 17:65118825-65118847 TGGTATATATATATATACCATGG - Intergenic
1153383181 18:4460976-4460998 TTGTATATATTTATGGAGCATGG + Intergenic
1153493750 18:5676393-5676415 TTGTATATATATACATACCACGG - Intergenic
1155270445 18:24136760-24136782 TTATATAGAATTATATAGCAAGG + Intergenic
1155682004 18:28499650-28499672 TTATATATAAATATAATGTATGG + Intergenic
1155924038 18:31634664-31634686 TTCTAGTTAAATATAGAGGATGG - Intronic
1156283174 18:35661881-35661903 TTTTATACTAAAATAGAGCATGG + Intronic
1156421476 18:36958246-36958268 TTGTATATACATATTCAACATGG - Intronic
1156518812 18:37704182-37704204 GTGAACATAAAAATAGAGCAGGG + Intergenic
1156542519 18:37929067-37929089 GTGTATATATATATATACCATGG - Intergenic
1156648600 18:39197865-39197887 TAGTATATAAATAAATATCATGG + Intergenic
1157417811 18:47520662-47520684 TTTTATATATATATAGGGGAGGG - Intergenic
1158736914 18:60092672-60092694 TTATATATATATATTGAGCTGGG - Intergenic
1158795007 18:60835117-60835139 TTGTATGTAAATATAGTGCAAGG + Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1160215729 18:76928205-76928227 TTATAAATACATATTGAGCACGG - Intronic
1162205330 19:9051593-9051615 ATGTATTTAAACATAGAGAAAGG + Intergenic
1164448516 19:28338214-28338236 TGGTATATATATATATACCATGG - Intergenic
1166039653 19:40194058-40194080 TTGTATATCAACAGAGAGCTTGG + Intronic
1166990496 19:46689909-46689931 TTCTATTTAAATATAGAGATGGG + Intronic
1167438940 19:49497081-49497103 TTGCAAGTAAATGTAGAGCATGG + Intronic
1168044436 19:53784188-53784210 TTGTTTAAAAATATAGAGATGGG - Intergenic
925429755 2:3780889-3780911 TTATATATAAATAACCAGCAAGG - Intronic
925654553 2:6131763-6131785 GTGTGTATAAATATAGAAAAGGG - Intergenic
925757064 2:7143511-7143533 TTTTATATAAATATGAAACAAGG - Intergenic
927169562 2:20357565-20357587 ATATATATAAATATAAAGCCAGG + Intergenic
927374144 2:22393739-22393761 TTCTGTATAAATAAAGAGAAAGG + Intergenic
928002381 2:27535962-27535984 TTTTATATCCATATAGAGAAAGG + Intergenic
928044387 2:27913582-27913604 GTGTATATATATGTAAAGCATGG - Intronic
928116465 2:28548580-28548602 TTATATATATATATATAGAAGGG - Intronic
929442571 2:41976236-41976258 TTTGACAAAAATATAGAGCAAGG + Intergenic
929745880 2:44657924-44657946 TTTTATATAAAAACAGAGTATGG - Intronic
930827771 2:55711574-55711596 TTTTATTTAATTGTAGAGCATGG + Intergenic
930903487 2:56536692-56536714 TTGTATATTATTATACAGAATGG - Intergenic
931093837 2:58917562-58917584 TTACATATAAATATAAATCATGG + Intergenic
931502144 2:62881024-62881046 TGGTATATATATATACACCATGG + Intronic
933409670 2:81909773-81909795 TTGTCTATAAGTCCAGAGCATGG - Intergenic
933524924 2:83425160-83425182 ATGTATATAAAAATATAACAAGG - Intergenic
935109754 2:100081591-100081613 TTGTCTGTGAATATAGAACATGG - Intronic
935138733 2:100332648-100332670 TTGTACATCAATTAAGAGCAAGG + Intergenic
935489781 2:103703685-103703707 ATGTATATATATATAGAGAGAGG + Intergenic
936125220 2:109783618-109783640 TTGTCTGTGAATATAGAACATGG + Intergenic
936219473 2:110587850-110587872 TTGTCTGTGAATATAGAACATGG - Intergenic
936561620 2:113543486-113543508 TAGTAGATAAATATGAAGCATGG - Intergenic
936766187 2:115851330-115851352 TTGTATATAAATTTAATGTAAGG - Intergenic
937424027 2:121782469-121782491 TGGTATATATATATATACCATGG - Intergenic
937803722 2:126112360-126112382 ATTTAGATAAATATAGAGAAAGG + Intergenic
939768437 2:146283565-146283587 ATGTATATATATTTAGAGCTGGG - Intergenic
940796377 2:158083785-158083807 ATGTATATATATATACACCATGG - Intronic
941139673 2:161763768-161763790 TAGTTTATAAAGAGAGAGCATGG + Intronic
941767963 2:169318653-169318675 TTCTTTATAAATGTGGAGCAGGG - Intronic
942405824 2:175653784-175653806 GTGTATATATATATATACCATGG + Intergenic
943727437 2:191266712-191266734 TTGTTTATAATTAAAGAGCAAGG - Intronic
944330504 2:198460617-198460639 TAGAATATAAATATAGACAAAGG - Intronic
945523572 2:210860307-210860329 ATGTAATTAAAAATAGAGCAGGG + Intergenic
945523892 2:210864500-210864522 CTGGATTTAAATATAGAGCAAGG + Intergenic
946907175 2:224428640-224428662 TTGTGTATAAAGAGAGAGAATGG - Intergenic
946930921 2:224670261-224670283 TTATATATAAATATATATAAAGG + Intergenic
947677353 2:231994567-231994589 ATGTATGTAACTATAAAGCAGGG - Intronic
1168872291 20:1140245-1140267 TAGGATAAACATATAGAGCAAGG + Intronic
1168908436 20:1425629-1425651 CTGTAAATAAATACACAGCAAGG - Intergenic
1169427163 20:5505252-5505274 TTCTATATATATGTAGAGAAAGG + Intergenic
1169922618 20:10751548-10751570 TTGTATATAGATATAGTTCCTGG + Intergenic
1170166708 20:13367076-13367098 TTTTATATAAATATTTAGCTAGG + Intergenic
1170270199 20:14518711-14518733 TTATATAAAAATATAAAGCCTGG + Intronic
1172142699 20:32734528-32734550 TTTTATATATATATAGAAAATGG - Intronic
1175343766 20:58254319-58254341 TGGTATATATATATATACCATGG + Intergenic
1176921727 21:14695705-14695727 TTGTATATATTTAGAAAGCAGGG + Intergenic
1176925961 21:14749056-14749078 GAATATATAAATCTAGAGCATGG + Intergenic
1177399769 21:20587636-20587658 TGGTATATAAATATACACCCAGG + Intergenic
1177468058 21:21515901-21515923 TTGCCTATAAAAATAGACCATGG + Intronic
1177524754 21:22276757-22276779 TTGTATATATATACATACCATGG - Intergenic
1177575863 21:22955066-22955088 TTGTTTATAAATAAATAGTAAGG + Intergenic
1177624146 21:23637074-23637096 TTGTATATGAAAATAGATAAGGG + Intergenic
1178176664 21:30107977-30107999 TTTTAAATAAATATAGAGCTGGG - Intergenic
1178558123 21:33611871-33611893 CTGTATATAAATAAATGGCATGG + Intronic
1178985751 21:37301425-37301447 TTGTATTTTAATATAGAGACGGG + Intergenic
1179268400 21:39826482-39826504 TTATATATATATATAGAAAAAGG - Intergenic
949190721 3:1245320-1245342 ATATATATATATATATAGCATGG + Intronic
949216365 3:1573755-1573777 ATGTATCTAAATATAGAAAAAGG + Intergenic
949845370 3:8364831-8364853 ATGTAAATAATTTTAGAGCAAGG + Intergenic
951631228 3:24722992-24723014 TGGTATAGAAATTGAGAGCATGG + Intergenic
953672935 3:44977665-44977687 GTGTATACAAAAATATAGCAGGG - Intronic
954574256 3:51666615-51666637 TTGTAGATAAAAATTGAACAGGG + Exonic
955212755 3:56957260-56957282 TTAAAAATAAATATAGATCATGG - Intronic
955592028 3:60547411-60547433 TTGTTTATAAAGAGAGAGTAGGG - Intronic
956343047 3:68247873-68247895 TTCTATACAAATAAAGAGAAAGG - Intronic
957244599 3:77701664-77701686 TTTTGTATAAAAATACAGCAGGG + Intergenic
957523596 3:81351986-81352008 TTTTCTTTAAAAATAGAGCATGG + Intergenic
957836500 3:85598786-85598808 ATATAGATAAATATAGAGAATGG - Intronic
957885323 3:86280784-86280806 TGGTATATATATATATACCATGG - Intergenic
957932226 3:86895466-86895488 TTGTATATAAAAAGTGATCAAGG - Intergenic
958101269 3:89014455-89014477 TACCATATAAATAAAGAGCAAGG - Intergenic
958482659 3:94663211-94663233 CCGTATATAAATAAAGTGCAAGG - Intergenic
958529489 3:95308801-95308823 TCTTATATAAATATACAGTAGGG + Intergenic
958623233 3:96590044-96590066 GTCTATATAAATATAGACTATGG + Intergenic
959561094 3:107782386-107782408 GTGTATATATATAAAGAGCAAGG - Intronic
959823421 3:110764740-110764762 TGGTATATAGATATATACCATGG + Intergenic
960186684 3:114649915-114649937 GTGTATATAAATTCAAAGCATGG - Intronic
960206949 3:114913754-114913776 TTGTATATAATGAGAGAGAAGGG + Intronic
960322734 3:116256555-116256577 TTGTATATAATTACAGATAAAGG - Intronic
961617722 3:128196407-128196429 TTGTATTTAAATATATATAAAGG - Intronic
963431942 3:145218037-145218059 TTGTATATAAATATAAAACCTGG + Intergenic
963794116 3:149614294-149614316 GTGTATCTAAACATAGAGAAAGG - Intronic
964060181 3:152512625-152512647 GTGTATATATATATATAGTAGGG - Intergenic
964707070 3:159630465-159630487 TGGTATATATATATACACCATGG + Intronic
965207001 3:165732771-165732793 TTAAATAAAAATTTAGAGCAGGG - Intergenic
965518870 3:169652792-169652814 TGCTCTATTAATATAGAGCATGG - Intronic
967071660 3:185967714-185967736 TTCTAAAAAAATATAGACCAGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967470859 3:189860421-189860443 TTGTTTATACACATAGACCAGGG + Intronic
967859141 3:194138411-194138433 ATATATACAAATATAGTGCATGG - Exonic
968404780 4:330384-330406 TAGGTTATAATTATAGAGCAAGG + Intergenic
969993614 4:11289808-11289830 TTGAATAGAAATGGAGAGCAGGG + Intergenic
970056046 4:11973027-11973049 TAATATGTAAATATATAGCAGGG + Intergenic
970297482 4:14646085-14646107 TTGAATACCAACATAGAGCAGGG + Intergenic
970602891 4:17654353-17654375 TTTTATATATATATAGAGGGAGG + Intronic
971687040 4:29784340-29784362 TTGTATAGATATATAAAGAAAGG + Intergenic
971843429 4:31886393-31886415 TTCCATATATATATATAGCAGGG - Intergenic
971915315 4:32862561-32862583 TTGCCTATAAAAATAGAGCTAGG + Intergenic
971947430 4:33299424-33299446 ATGTATTTACATATACAGCATGG - Intergenic
972002113 4:34050598-34050620 ATGTATATAAAGGAAGAGCAAGG + Intergenic
972262970 4:37429185-37429207 TTTTATAAAAATACAAAGCAAGG - Intronic
972506892 4:39728312-39728334 TTATATATAGATATTGAGCTGGG + Intronic
972944186 4:44233638-44233660 TTCTATATAAAAATAAAACAAGG - Intronic
974064907 4:57068791-57068813 TTGTGTTTAAATTTAGAACATGG + Intronic
974084786 4:57248226-57248248 TTATATATATATATAAAACATGG + Intergenic
975113538 4:70653092-70653114 ATGTATTTCAATATAGACCATGG + Intronic
976048528 4:80982774-80982796 TGGTATATATATATATATCATGG + Intergenic
976829906 4:89303750-89303772 TTATATATAAATATATATAATGG - Intronic
977136374 4:93309937-93309959 TTGTTTATACATATTGTGCAGGG + Intronic
977401003 4:96532339-96532361 CTGTATTGAAATATAGAGAATGG + Intergenic
978019834 4:103793866-103793888 TGGTATATATATATACACCATGG + Intergenic
978312031 4:107395292-107395314 GTATATATAAATATATAGCAGGG - Intergenic
978746417 4:112199779-112199801 TTTTCTTTAAATATAGAGCATGG + Intergenic
979313713 4:119234526-119234548 GTGTATATAAAAATAGTTCATGG + Intronic
979646732 4:123078513-123078535 TTGTATAGAGGTAAAGAGCATGG + Intronic
979865832 4:125752020-125752042 TTGTATAACAATAAAAAGCAAGG + Intergenic
980012183 4:127608989-127609011 TTGATTATAAATTTGGAGCAAGG + Intergenic
980015092 4:127640841-127640863 TTTTATATGATTATAAAGCATGG + Intronic
980015725 4:127647801-127647823 TTGTATATAAATGTAGGAAAAGG - Intronic
980504506 4:133697870-133697892 TTGTATATAAGTTTACAGAATGG + Intergenic
980555919 4:134404600-134404622 ATGTATATAAAAATATAGCTGGG - Intergenic
980615567 4:135219007-135219029 CTGTATATTAAAATGGAGCATGG - Intergenic
980883992 4:138742244-138742266 TTCTCTATAAATATAGAAAAGGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
982369295 4:154616853-154616875 TTGTGTATAAAAATAGCCCAGGG + Intergenic
983725968 4:170926306-170926328 ATTTATATACATATAGAACAAGG + Intergenic
984993181 4:185401697-185401719 TTGTGTATACAAATAGAGCAAGG + Intronic
986390474 5:7281278-7281300 TTATATATAAATATAAAGATGGG - Intergenic
986995060 5:13597503-13597525 ATGTATATATATATATAGCAAGG - Intergenic
987498832 5:18680233-18680255 TAGTATATATATATATAGAAAGG + Intergenic
987504023 5:18746838-18746860 TTATATATACATATAGTGAAAGG - Intergenic
987667861 5:20968241-20968263 TTGCATATAACTAATGAGCAAGG - Intergenic
987915238 5:24204356-24204378 TTGTATTTATATATAGTGAAAGG - Intergenic
988007842 5:25441590-25441612 TTATATATTAATATAGAATAAGG + Intergenic
988190323 5:27922123-27922145 ATGGATATATATATAGTGCAAGG - Intergenic
988300570 5:29420241-29420263 GTGTATATATATAGAGAGAAGGG - Intergenic
988334533 5:29888899-29888921 TTGTATATATAAGCAGAGCATGG + Intergenic
988885156 5:35548683-35548705 ATGTATATTAATATAGATCTAGG + Intergenic
989278905 5:39619738-39619760 TGGTATATATATATACACCATGG - Intergenic
989593326 5:43132047-43132069 TACTATATACATATAAAGCAAGG - Intronic
990785303 5:59412031-59412053 TTGTATATAGATATTGAGTCTGG - Intronic
991770938 5:70040174-70040196 TTGTATTTAAAAATACAGCCAGG - Intronic
991850232 5:70915591-70915613 TTGTATTTAAAAATACAGCCAGG - Intronic
993182043 5:84565489-84565511 TTGATTATAAATGTATAGCATGG + Intergenic
993678081 5:90841690-90841712 TTGTATATAAATATATTGATAGG - Intronic
995262032 5:110115442-110115464 GTCTATCTAAATATAGAGAAGGG - Intergenic
996435348 5:123428074-123428096 TAGAATATAAATATAGGCCAAGG - Intergenic
996448763 5:123592740-123592762 CTATATATATATATATAGCATGG + Intronic
997013875 5:129906988-129907010 TTGGATATAAAAATAAAGAATGG + Intronic
998564932 5:143208453-143208475 CTGTATATATATAAATAGCATGG - Intronic
999741500 5:154558139-154558161 TTAAATATAAATATAGAGACAGG - Intergenic
999903755 5:156116683-156116705 TTGTGTAACATTATAGAGCATGG - Intronic
1000137160 5:158364001-158364023 TCGTATACACATATATAGCATGG + Intergenic
1000545359 5:162593495-162593517 TTCTATAAATATATGGAGCATGG - Intergenic
1000804587 5:165774039-165774061 TGGTAAATAGATATAGAACAGGG - Intergenic
1001256830 5:170189949-170189971 TGGTATATATATATACACCATGG + Intergenic
1002848938 6:974167-974189 GTGTATATATATATATACCATGG + Intergenic
1005219031 6:23564879-23564901 TTGTATATAAATAAAATGTAAGG + Intergenic
1005334312 6:24778203-24778225 TTTTAAATAAATAAAGAGCCAGG + Intronic
1006825212 6:36929702-36929724 TTGTTTATGATTAGAGAGCATGG - Intergenic
1007919389 6:45592700-45592722 TTGTCTAAGATTATAGAGCAAGG + Intronic
1008058948 6:46976568-46976590 TGGTATATATATATATAGAAAGG + Intergenic
1011262190 6:85481277-85481299 TTATATATAATTACAAAGCATGG + Intronic
1012117078 6:95314625-95314647 GTGTACATGAACATAGAGCATGG + Intergenic
1012219543 6:96631829-96631851 TTGAATAAAAATATAGAGCATGG - Intergenic
1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG + Intergenic
1013874930 6:114813462-114813484 TTGTTTATAAATATAGACAAAGG - Intergenic
1013949348 6:115760733-115760755 TTGTGTAAAATTTTAGAGCAAGG - Intergenic
1013996260 6:116311876-116311898 TTATATGTAAATGTAAAGCAGGG + Intronic
1015341072 6:132101540-132101562 TCATATATAAATATAAACCATGG + Intergenic
1015442257 6:133262779-133262801 CTGTCTATAAAGATAGAACATGG - Intronic
1015802975 6:137079137-137079159 ATGTATATATATATACACCATGG - Intergenic
1017115416 6:150971598-150971620 TTTTAAAAAAATATAGTGCATGG + Intronic
1017135252 6:151142220-151142242 ATGTATATATATATAGACTAAGG + Intergenic
1017611940 6:156196070-156196092 TAGTATATACATATAGAGAGAGG - Intergenic
1017875138 6:158517894-158517916 TTGTATCTAAACATAGAAAAGGG + Intergenic
1018022663 6:159776515-159776537 TTGTACATAAATATTGAGTTGGG - Intronic
1019834495 7:3368893-3368915 TATTATATAAATAAAGAGCAAGG + Intronic
1019838563 7:3415687-3415709 TTATATATAAATATATGGTAAGG - Intronic
1020547462 7:9550926-9550948 TTTTATATAAACATGGAGTACGG - Intergenic
1022552604 7:31255566-31255588 TTGTATATAAATATATTTTATGG + Intergenic
1024602529 7:50996421-50996443 ATGTATATATATATACACCATGG - Intergenic
1027180121 7:75933187-75933209 TTGTATATATTTATAGTGTATGG + Intronic
1028579236 7:92387924-92387946 TTGTGAATAAATAAAGAGAATGG + Intronic
1028728727 7:94120422-94120444 TTGCTTATAAATAAATAGCAGGG + Intergenic
1028819069 7:95184825-95184847 TGGTACATATATATACAGCATGG - Intronic
1030460749 7:109832962-109832984 ATTTATATAAATGTATAGCAAGG + Intergenic
1030519525 7:110580713-110580735 ATGTATATATATATATAGGAAGG + Intergenic
1031418230 7:121518578-121518600 TTGAATATATTTATAGGGCATGG + Intergenic
1032740394 7:134732776-134732798 TTAGATATAAAAATATAGCATGG - Intergenic
1033647130 7:143314170-143314192 GTGTATATAAATATATATAATGG - Intergenic
1033785613 7:144726901-144726923 TTGGCTATGATTATAGAGCAAGG - Intronic
1038750782 8:30293833-30293855 TTGTATATATACATATACCATGG + Intergenic
1039164420 8:34661186-34661208 CTGTATATATATATATGGCAAGG - Intergenic
1039297851 8:36176554-36176576 TTGTATATAAATATTATGCTTGG + Intergenic
1041995416 8:64050950-64050972 TTGTATATAATGAGAGATCAGGG - Intergenic
1042053967 8:64742957-64742979 TTGTAAATAAACATAGAAGAAGG - Intronic
1042714507 8:71757960-71757982 GTGTATATATATATAGAGAAAGG - Intergenic
1042735468 8:71983087-71983109 GTGTATATATATATATAGCTAGG + Intronic
1043620686 8:82188661-82188683 TTATATAAAAATATAGAACTTGG - Intergenic
1043750731 8:83930463-83930485 CTGTATATGTATATAGAGCTCGG + Intergenic
1043821334 8:84869013-84869035 TTATATATATATATAAAGAAAGG + Intronic
1044060794 8:87632260-87632282 TTGAATATACATAGAGAGAAAGG + Intergenic
1044579964 8:93814999-93815021 TTGTATAAAGAAATAGAGAAAGG + Intronic
1044637879 8:94344966-94344988 TTGTATATATTTTTAGAGTATGG - Intergenic
1044769296 8:95613006-95613028 TTGTATATGAAAATAAAGCAGGG + Intergenic
1045760636 8:105602353-105602375 GTCAATATAAATATGGAGCATGG + Intronic
1045812891 8:106244691-106244713 TAGTAAATAAATATACACCACGG + Intergenic
1046424373 8:114027416-114027438 TTCTATATGAACATAGAACAAGG - Intergenic
1047867869 8:129048195-129048217 CTGTATATAAATATATTTCATGG - Intergenic
1048556021 8:135476796-135476818 ATATATAAAAATATAGAGTAAGG + Intronic
1048787520 8:138066088-138066110 GTGTATATATATATATATCAAGG - Intergenic
1049891062 9:71832-71854 TAGTAGATAAATATGAAGCATGG + Intergenic
1050907108 9:11018188-11018210 CTGTTTATAAATATAGAAAAAGG - Intergenic
1051470625 9:17436686-17436708 CTGTAAATAAATATAAACCAAGG - Intronic
1051856361 9:21571314-21571336 TTGAATATAAAAATATACCATGG + Intergenic
1052423242 9:28271129-28271151 TTTCTTATAAATACAGAGCAAGG - Intronic
1053732503 9:41072887-41072909 TAGTAGATAAATATGAAGCATGG + Intergenic
1054695928 9:68358688-68358710 TAGTAGATAAATATGAAGCATGG - Intronic
1055336926 9:75241413-75241435 TTATATATATATATATATCAGGG - Intergenic
1055836948 9:80455004-80455026 TTGAATATGAATTTAGAGAAAGG + Intergenic
1056243847 9:84674605-84674627 ATGTATTTAAATTTGGAGCACGG + Intronic
1056354802 9:85788676-85788698 TTGTATATAGATATAGATATAGG + Intergenic
1056607072 9:88094721-88094743 TTGTAGACAAATAGAGAGCTGGG + Intergenic
1056805767 9:89727490-89727512 TTGTTAATAAATATATAACAAGG - Intergenic
1058116201 9:101086701-101086723 TTGTATATAGATTTTGACCAAGG - Intronic
1059127622 9:111708113-111708135 TTGCGTGTATATATAGAGCATGG + Intronic
1059192186 9:112336608-112336630 TTTTATAAAAATATAGAGACAGG - Intergenic
1059377322 9:113894075-113894097 TTGTATAAAAAAATAATGCAAGG - Intronic
1060620552 9:125061891-125061913 TAGGAAAAAAATATAGAGCAAGG + Intronic
1061713500 9:132503751-132503773 TTATATTTAAAAATAGAGCCGGG + Intronic
1061956466 9:133964305-133964327 GTGTATATATATATATATCAGGG - Intronic
1186964769 X:14775318-14775340 TTGTATTGAAAGATAGAGGAAGG - Intergenic
1187188201 X:17007945-17007967 TTGCATAGAAATTAAGAGCATGG - Intronic
1188721997 X:33533443-33533465 TGGTAAATAAATATACAACATGG + Intergenic
1188949053 X:36345744-36345766 TTGTATAAAAATACTTAGCACGG + Intronic
1188991831 X:36830231-36830253 TGGTATATATATATATACCATGG - Intergenic
1189264671 X:39704985-39705007 TTGGATATATATATACAGCATGG - Intergenic
1190472033 X:50791845-50791867 CAGTATGTACATATAGAGCAAGG + Intronic
1190566883 X:51739517-51739539 TTATATATATATATAAAGAAAGG - Intergenic
1192103737 X:68293087-68293109 TTGTATTTAAGTAAAGAGCCAGG - Intronic
1193054021 X:77130705-77130727 TTATATATATATATACACCATGG + Intergenic
1193814575 X:86089664-86089686 GTGTATATATATATATAGTATGG - Intergenic
1193966486 X:87993296-87993318 TGGTATATATATATATACCATGG - Intergenic
1193989685 X:88291117-88291139 GTGTATATATATATACACCATGG - Intergenic
1194099562 X:89686911-89686933 TTATAAATAAATATACTGCATGG - Intergenic
1194268640 X:91782714-91782736 GTGTCTCTAAATAAAGAGCATGG - Intronic
1195213238 X:102670506-102670528 TTGTTTATTAATATACTGCAGGG + Intergenic
1196237229 X:113296792-113296814 TTGTATATAAAAATAGATACTGG + Intergenic
1197055767 X:122116487-122116509 TTATACGAAAATATAGAGCATGG - Intergenic
1197125164 X:122936789-122936811 TTGTATATAATTATGGGGTAGGG + Intergenic
1197189861 X:123634167-123634189 TTGTATATAAATATGGGGGAAGG + Intronic
1197328021 X:125118003-125118025 TGGTATATATATATACACCATGG + Intergenic
1197439005 X:126467747-126467769 TTTTAGACAAATATAGAGGAAGG + Intergenic
1198638219 X:138724212-138724234 TTGTATAAAAATAGGTAGCATGG + Intronic
1198838127 X:140826297-140826319 ATATATATATATATATAGCATGG - Intergenic
1198840898 X:140856792-140856814 TTTTATAGAAATTTAGAGAAGGG - Intergenic
1199030793 X:142996814-142996836 ATGTCTATAAAGATAGAGGAGGG + Intergenic
1200452566 Y:3348291-3348313 TTATAAATAAATATACTGCATGG - Intergenic
1202301506 Y:23420526-23420548 TGGTATATATATATACACCATGG - Intergenic
1202569305 Y:26250072-26250094 TGGTATATATATATACACCATGG + Intergenic