ID: 1133550582

View in Genome Browser
Species Human (GRCh38)
Location 16:6850844-6850866
Sequence GTGCAATTGCTCAATTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133550582 Original CRISPR GTGCAATTGCTCAATTATAT GGG (reversed) Intronic
900031646 1:377092-377114 GTGCAATTGCTGAGTCATGTGGG - Intergenic
900052197 1:605292-605314 GTGCAATTGCTGAGTCATGTGGG - Intergenic
900965510 1:5955352-5955374 GTAGGATTGCTGAATTATATGGG - Intronic
901347780 1:8562313-8562335 ATGCCATTGTTAAATTATATTGG - Intronic
901722558 1:11211417-11211439 GTGCAATGGCACAATTATGGGGG + Intronic
905386009 1:37604795-37604817 ATGCAATTGGTCAAATATACAGG + Intergenic
908049708 1:60215778-60215800 GTGCAATTCCTAAAAAATATTGG - Intergenic
909010088 1:70324519-70324541 TGGCAACTGCTTAATTATATAGG - Intronic
910991108 1:93057678-93057700 GTGGGATTGCTGGATTATATGGG - Intergenic
913024725 1:114826030-114826052 GTGCAATTGCTGGGTTTTATTGG - Intergenic
915906284 1:159880074-159880096 GTGCATTTGCTCTGTCATATAGG + Intronic
917830458 1:178878641-178878663 GTGAAATTTCTCAAATATATGGG + Intronic
919228505 1:194740411-194740433 GTGCAATTAGGTAATTATATAGG - Intergenic
922956651 1:229607637-229607659 GATCAATTGCTGAATCATATAGG - Intronic
923627484 1:235625953-235625975 GTGCAATTGCTATAGCATATGGG + Intronic
924417495 1:243872439-243872461 GTGCAATAGCTGGACTATATGGG + Intergenic
1063584774 10:7342363-7342385 GTGCAATTCCTAAATTCTGTAGG - Intronic
1065282812 10:24157033-24157055 GTGGAATTGCTGGATCATATAGG + Intronic
1067053006 10:43035644-43035666 GTGAAATTGCTGGATTATAGGGG - Intergenic
1067368325 10:45657558-45657580 GTGGAATTGCTGAATTGCATAGG - Intronic
1068624598 10:59228073-59228095 GTGCAAATGTTGAATCATATTGG - Intronic
1071738132 10:88325166-88325188 GTGGAATTGCTGGATCATATGGG + Intronic
1073936043 10:108633251-108633273 GTGAAATTGCTGAAACATATGGG + Intergenic
1079346529 11:19657329-19657351 TTCCAACTGCTCAATTGTATTGG - Intronic
1079721094 11:23815738-23815760 GGGCTATTTCTCAATTATTTTGG - Intergenic
1079759966 11:24317061-24317083 GTGGAATTGCTGGATCATATGGG + Intergenic
1080650377 11:34217800-34217822 ATGCAGTTGCTGAATTGTATTGG + Intronic
1089164103 11:116461496-116461518 GAGCCATTGCTCAATCATCTAGG + Intergenic
1089357630 11:117865334-117865356 GTGGAATTGCTGGATCATATGGG - Intronic
1089831920 11:121336493-121336515 GTTCAATTGGTCCATTATATTGG - Intergenic
1093502293 12:19827055-19827077 GTCCAATTGTCCAATTACATAGG - Intergenic
1093975530 12:25416681-25416703 GTGGATTTGCTTAATTTTATGGG + Intronic
1095361062 12:41340046-41340068 GTGAAATTGCTGGATCATATAGG - Intronic
1097465495 12:59919682-59919704 GAGAAATTGGTCAATTATTTAGG + Intergenic
1098488306 12:71047020-71047042 GTGCAATGGCCCAAGTAAATAGG - Intergenic
1101811233 12:108109795-108109817 GTGGAATTGCTGGATCATATAGG + Intergenic
1103002793 12:117398208-117398230 GTGAAATTACTCAATCATACAGG - Intronic
1104470697 12:129027260-129027282 GTGGAATTGCTGAATCATATGGG - Intergenic
1106604929 13:31219916-31219938 AAGCAAATGCTCAATAATATTGG - Intronic
1106626656 13:31427489-31427511 TTGCAACTGCTAAATTTTATTGG + Intergenic
1107042650 13:35966257-35966279 GTGGAATTGCTGGATTGTATGGG - Intronic
1107288002 13:38818153-38818175 GTGGGATTGCTGAATAATATGGG - Intronic
1109253412 13:60048640-60048662 CTGCAATTGCTGAGTAATATGGG - Intronic
1109253421 13:60048779-60048801 CTGCAATTGCTGAGTAATATGGG - Intronic
1109253430 13:60048918-60048940 CTGCAATTGCTGAGTAATATGGG - Intronic
1109376837 13:61506535-61506557 GTGGAATTGCTGGATCATATGGG - Intergenic
1111567193 13:90031873-90031895 GTGGAATTGCTTGATCATATTGG - Intergenic
1114754420 14:25243381-25243403 GTGCATTTTATCATTTATATGGG + Intergenic
1114866929 14:26606920-26606942 GTGGAATTGCTGAGTCATATGGG - Intergenic
1115040939 14:28926188-28926210 GTGCAATTGCTGGATTATATGGG + Intergenic
1116020777 14:39457636-39457658 GGGCAATTGCTCATTTAGGTAGG + Intergenic
1116661410 14:47715719-47715741 TTGCTATTGCTCAATTTTATTGG + Intergenic
1119994617 14:79239622-79239644 GTGGGATTGCTGAATCATATGGG - Intronic
1122671396 14:103375337-103375359 GTGGAATTGCTCAGTTGTAGGGG + Intergenic
1125393253 15:39218790-39218812 GTGGGATTGCTGAATCATATTGG - Intergenic
1125867054 15:43062109-43062131 GTGGAATTGCTGGATCATATGGG - Intronic
1125988436 15:44079580-44079602 GTGCAATTGCTAGATCATATGGG - Intronic
1133550582 16:6850844-6850866 GTGCAATTGCTCAATTATATGGG - Intronic
1138324167 16:56148283-56148305 GTGCATTTGCTCCATTACATAGG + Intergenic
1138753527 16:59454006-59454028 GTGCAATTCCTCAATTAGAGAGG + Intergenic
1138860216 16:60746731-60746753 TTGCAATTGCTAGATTGTATTGG - Intergenic
1140347699 16:74230212-74230234 GAACATTTGCTGAATTATATAGG - Intergenic
1150547020 17:66169583-66169605 CTGTAATTTCTTAATTATATAGG + Intronic
1151045144 17:70911212-70911234 GTGGAATTGCTGGATTATATTGG - Intergenic
1152948007 17:83208621-83208643 GTGCAATTGCTGAGTCATGTGGG + Intergenic
1153080023 18:1211589-1211611 GTGGAATTGCTGAATCATATAGG + Intergenic
1155581255 18:27309416-27309438 GTGCAATTACTGGGTTATATAGG + Intergenic
1165084368 19:33333169-33333191 GTGAAATTGCTGGATCATATAGG - Intergenic
928959291 2:36906868-36906890 GTGCAATGGCGCAATCATCTCGG - Intronic
929388197 2:41436513-41436535 GTGAAATTGCTGGATCATATAGG + Intergenic
930183850 2:48391324-48391346 GTAGAATTGCTGAATCATATGGG + Intergenic
936957120 2:118033735-118033757 GTACAACTGCCCAATAATATAGG - Intergenic
936980444 2:118260084-118260106 ATTCAATTGTTCAAATATATTGG + Intergenic
937498735 2:122454100-122454122 GTGAAATTGCTAGATTAAATTGG - Intergenic
939229980 2:139412145-139412167 GTGGAATTCCTGAATTATAAGGG + Intergenic
939891395 2:147741148-147741170 GTGAAATTGCTGGATCATATGGG + Intergenic
940200526 2:151145077-151145099 GTGCAATTGCTTGATTGTAGGGG - Intergenic
940696283 2:156983672-156983694 CTGCAGTTGCTTAATTCTATAGG - Intergenic
941594866 2:167463594-167463616 GTGCTATTGCTTTATCATATAGG - Intergenic
942834978 2:180283852-180283874 GTGGGATTGCTGGATTATATGGG + Intergenic
943194543 2:184728294-184728316 GTGCAATTTCTCAATGTTATGGG + Intronic
943319335 2:186428371-186428393 CTGCCATTGTTCAAATATATTGG - Intergenic
945387660 2:209222825-209222847 TTTCATTTGCTCAATTATAGTGG + Intergenic
1170125460 20:12958378-12958400 GTGCAATTTCTGCATAATATGGG + Intergenic
1171019405 20:21571853-21571875 TTGTGATTGCTCAATTATAGTGG - Intergenic
1173453242 20:43184022-43184044 GTGGAATTGCTGGATTTTATGGG + Intronic
1174010453 20:47445457-47445479 GTGCAATTGCTGGATCATGTAGG - Intergenic
1178082879 21:29083141-29083163 GGGCAATTCCTCAATTTTCTTGG + Intronic
1184026380 22:41860318-41860340 ATGCAAATGCTCAATAAAATTGG + Intronic
951771210 3:26259592-26259614 GTGCAAAGGCTCAAATAAATAGG + Intergenic
952442620 3:33347540-33347562 GTGGAATTGCTGGATCATATGGG + Intronic
955012212 3:55029155-55029177 GTGCAATGGATCCATTATACAGG - Intronic
956936418 3:74107027-74107049 GTGCAATTGCTGGGTCATATGGG - Intergenic
957548575 3:81673431-81673453 GTACATTTTCTCATTTATATTGG - Intronic
957916963 3:86697833-86697855 GTGGGATTGCTGAATCATATGGG - Intergenic
958532731 3:95354437-95354459 TTGCAATTGTACAACTATATGGG + Intergenic
958827351 3:99047394-99047416 GTGAAATTGCTGGATCATATGGG - Intergenic
959818073 3:110699596-110699618 GAGCAATTTATGAATTATATGGG - Intergenic
960905963 3:122601797-122601819 ATGCAACTGCTGAATCATATGGG + Intronic
962273000 3:133991871-133991893 GTGCCTTTGCTCAGTCATATTGG - Intronic
968174238 3:196535392-196535414 GTGCAATTGCCAGATAATATGGG + Intergenic
968187458 3:196643017-196643039 GTGCAATGGCACAATCATCTCGG - Intronic
968318102 3:197741522-197741544 GTTCATTTATTCAATTATATAGG + Intronic
970264670 4:14268328-14268350 ATCCAATTGCTTAATTATTTTGG - Intergenic
970800662 4:19969642-19969664 GTGCAATTTCTCAATTAGAGGGG + Intergenic
971193979 4:24454255-24454277 GTATAAGTGCACAATTATATGGG - Intergenic
973017829 4:45163825-45163847 GTGGAATTGCTGGATCATATAGG + Intergenic
973163017 4:47042009-47042031 GTATAATTCCTAAATTATATTGG - Intronic
978129459 4:105177747-105177769 GCGCTATTGCTGAATCATATGGG - Intronic
980699113 4:136400776-136400798 GTAAAATTGCTTAATTTTATGGG + Intergenic
982214617 4:153069981-153070003 AAGCAATTGGTCAATTATTTGGG - Intergenic
984343553 4:178490395-178490417 GTGGAATTGCTCAGTCATAGGGG - Intergenic
984433373 4:179677410-179677432 GAGCAATGGCTCAGATATATAGG + Intergenic
984507029 4:180632855-180632877 AATCACTTGCTCAATTATATAGG + Intergenic
984933037 4:184864891-184864913 ATGCAATTGGTCAATTATTAGGG + Intergenic
986611545 5:9572887-9572909 GTGCAGGTACTCAACTATATAGG - Intergenic
987650188 5:20731064-20731086 GTTCTTTTGCTCAATTATATGGG + Intergenic
988745371 5:34130403-34130425 GTTCTTTTGCTCAATTATATGGG - Intergenic
991263064 5:64687373-64687395 TACCAATTGCTCAATTCTATTGG + Intergenic
992241308 5:74772530-74772552 TTGCAACTGCTCAATTCTAGGGG - Intronic
992842231 5:80707386-80707408 GTGGAATTGCTGGATTATGTGGG + Intronic
993207986 5:84909935-84909957 GTGCATTTGCTAAACTACATGGG - Intergenic
993704629 5:91155535-91155557 CTGCAATTGCCCAAATATACTGG - Intronic
996433753 5:123411089-123411111 TTGCAATTCCTCAATGACATAGG - Intronic
997107760 5:131040634-131040656 GTGGAATTGCTGGATAATATAGG - Intergenic
998070582 5:139194981-139195003 GTGCAATGGCACAATGATCTCGG + Intronic
999861772 5:155655625-155655647 GTTCAATTGCTCAACTTAATAGG + Intergenic
1001161681 5:169322737-169322759 GTGGAATTGCTCAGTTCTTTAGG - Intergenic
1002742174 5:181441776-181441798 GTGCAATTGCTGAGTCATGTGGG + Intergenic
1005543487 6:26838155-26838177 GTTCTTTTGCTCAATTATATGGG - Intergenic
1008718082 6:54313871-54313893 GTGCAATTTCTATATTATTTTGG + Intronic
1009014317 6:57880324-57880346 GTTCTTTTGCTCAATTATATGGG - Intergenic
1009304264 6:62068058-62068080 GTGAAATTGCTGGATTATATGGG + Intronic
1012376358 6:98566259-98566281 GTGCCATTTCTGAATTTTATTGG + Intergenic
1012708167 6:102561300-102561322 GTAGAATTGCTCAGTTACATAGG - Intergenic
1012865332 6:104611694-104611716 GTGCATTTGGCCTATTATATTGG - Intergenic
1012871657 6:104680004-104680026 GTGCAATTGGTGAATTGTATTGG - Intergenic
1013320416 6:108982494-108982516 GTGGAATTGCTGTATCATATGGG + Intergenic
1013695157 6:112693469-112693491 GTTCATTTGTACAATTATATTGG - Intergenic
1016305263 6:142677515-142677537 GTGCAATCGCTTCATTATATGGG - Intergenic
1017628961 6:156377386-156377408 GTGAAACTGCTCAAGTCTATGGG + Intergenic
1019247309 6:170717514-170717536 GTGCAATTGCTGAGTCATGTGGG + Intergenic
1022635229 7:32126013-32126035 GTCAAATTTCTCAATCATATTGG - Intronic
1023917791 7:44603400-44603422 GTGTAATTTCTGAGTTATATGGG - Intergenic
1023973657 7:45010952-45010974 ATGGAATTGCTGAATTTTATGGG + Intronic
1024879198 7:54066720-54066742 GTGAAGTTGCTCAAATATTTGGG + Intergenic
1025970766 7:66322748-66322770 GTGGAATTGCTGAATTATATGGG + Intronic
1026791890 7:73338502-73338524 GTGCAATTGCTGGATTGTGTGGG + Intronic
1027964304 7:84986102-84986124 TTGCAAATTCTCAATTTTATTGG - Intergenic
1029976957 7:104843900-104843922 GTGCATTTGCTCATGTAGATGGG - Intronic
1030622357 7:111804059-111804081 GTGGAATTGCTGGATCATATGGG - Intronic
1030954265 7:115831719-115831741 GTACTATTACTCAATTATAGAGG - Intergenic
1031337965 7:120560787-120560809 GAGTAATTGCTCAAATTTATTGG + Intronic
1032866199 7:135927031-135927053 CTGCAATTGCTTATTTATGTAGG + Exonic
1035500827 8:90421-90443 GTGCAATTGCTGAGTCATGTGGG - Intergenic
1035969410 8:4230531-4230553 GGCCAGTTGCTCAATTATATTGG + Intronic
1042043913 8:64626086-64626108 ATGCAATTTCTCATTTTTATAGG + Intronic
1052760654 9:32587620-32587642 ATGCAATTGCTCCATAATGTAGG - Intergenic
1053574333 9:39343623-39343645 GTGAGATTGCTGGATTATATGGG + Intergenic
1053838901 9:42171871-42171893 GTGGGATTGCTGGATTATATGGG + Intergenic
1054095899 9:60902313-60902335 GTGAGATTGCTGGATTATATGGG + Intergenic
1054117359 9:61178252-61178274 GTGAGATTGCTGGATTATATGGG + Intergenic
1054590396 9:67004314-67004336 GTGAGATTGCTGGATTATATGGG - Intergenic
1055536860 9:77256497-77256519 GTCCAGTTGGTCAATTTTATTGG + Intronic
1056259296 9:84831993-84832015 ATGCAATTTCTGAATTATTTTGG - Intronic
1059676055 9:116540838-116540860 TTCCAATTTCTCAATTATTTTGG - Intronic
1203608083 Un_KI270748v1:72991-73013 GTGCAATTGCTGAGTCATGTGGG + Intergenic
1186713238 X:12223014-12223036 ATGGAATTGCTGAATCATATAGG + Intronic
1188724594 X:33566775-33566797 GTGGAATTGCTAGATCATATTGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190765148 X:53470013-53470035 GTGGAATTGCTAGATCATATTGG + Intergenic
1190958937 X:55226298-55226320 GTGCAATAGTTCAATTAGCTGGG + Intronic
1191872261 X:65757963-65757985 GTGGAATTTCTGAATTATTTAGG + Intergenic
1192716261 X:73645430-73645452 GTGGGATTGCTGGATTATATGGG + Intronic
1193301840 X:79898328-79898350 GTGGAATTGCTGAATCACATGGG - Intergenic
1195501073 X:105600319-105600341 GTAGAATTGCTGAATTTTATAGG + Intronic
1197054933 X:122106468-122106490 GTGAGATTGCTGGATTATATGGG - Intergenic
1198254951 X:134916203-134916225 GTGCAGTGGCACAATGATATTGG - Intergenic
1199324502 X:146481517-146481539 GTGGGATTGCTGAATCATATGGG + Intergenic