ID: 1133550872

View in Genome Browser
Species Human (GRCh38)
Location 16:6853477-6853499
Sequence GTCCTCGAGCACCACACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133550872_1133550878 28 Left 1133550872 16:6853477-6853499 CCTACAGTGTGGTGCTCGAGGAC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1133550878 16:6853528-6853550 TGGTAGATGCTTTCAGAATTTGG 0: 1
1: 0
2: 2
3: 15
4: 178
1133550872_1133550879 29 Left 1133550872 16:6853477-6853499 CCTACAGTGTGGTGCTCGAGGAC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1133550879 16:6853529-6853551 GGTAGATGCTTTCAGAATTTGGG 0: 1
1: 0
2: 1
3: 16
4: 191
1133550872_1133550874 -5 Left 1133550872 16:6853477-6853499 CCTACAGTGTGGTGCTCGAGGAC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1133550874 16:6853495-6853517 AGGACAATCCCTGTCTGCTTGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1133550872_1133550877 8 Left 1133550872 16:6853477-6853499 CCTACAGTGTGGTGCTCGAGGAC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1133550877 16:6853508-6853530 TCTGCTTGGGACTCTGACAGTGG 0: 1
1: 0
2: 0
3: 7
4: 205
1133550872_1133550873 -6 Left 1133550872 16:6853477-6853499 CCTACAGTGTGGTGCTCGAGGAC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1133550873 16:6853494-6853516 GAGGACAATCCCTGTCTGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133550872 Original CRISPR GTCCTCGAGCACCACACTGT AGG (reversed) Intronic
900602494 1:3509166-3509188 GTCCTGGAGCACGGCAATGTGGG + Exonic
900684571 1:3939911-3939933 GTCCTCCAGCACGTCACTGTGGG + Intergenic
901173276 1:7279707-7279729 GTCCCAAAGCCCCACACTGTGGG - Intronic
902389607 1:16095509-16095531 GTCCCCGGTCACTACACTGTTGG + Intergenic
904239293 1:29133749-29133771 GGCCTCGAGTACCAGGCTGTTGG - Intergenic
908029836 1:59987521-59987543 GCCCTCCAGGACCACACAGTCGG + Intronic
1065565008 10:26999429-26999451 GTCCACAAGCAGCACACTTTGGG - Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1071447244 10:85759953-85759975 GTCCCCAGGCACCACACTTTGGG - Intronic
1075527397 10:123198244-123198266 GTCCTTAAGCACCGCACTGCAGG + Intergenic
1075795610 10:125117362-125117384 GCCACCGAGCACCACACAGTGGG + Intronic
1076366514 10:129924496-129924518 ACCCTTGAGCACCCCACTGTGGG + Intronic
1076425187 10:130362725-130362747 GTCCCTGAGCAGCACCCTGTGGG - Intergenic
1078616705 11:12872557-12872579 TTTCTCCATCACCACACTGTTGG - Intronic
1081887620 11:46512477-46512499 CTCCTCTAGCACCACACTTGCGG + Intronic
1084291251 11:68170018-68170040 GTCCTCTCTCACCACACAGTTGG + Intronic
1089329911 11:117682026-117682048 GTCATCGAGAACCACTCTGTAGG - Intronic
1099955769 12:89351743-89351765 GTCGTAGAGCACCACTGTGTCGG + Exonic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101945599 12:109134164-109134186 GTCCCCAAGCACCACCCAGTCGG + Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1104037390 12:125107114-125107136 GTCATCCAGAAACACACTGTGGG - Exonic
1104146672 12:126040657-126040679 GTCCTCTAGGACCACAGTGATGG - Intergenic
1107015393 13:35704796-35704818 GTCTTCGAGATCCACAGTGTGGG - Intergenic
1109226535 13:59702925-59702947 GTCCTCAAACACTACCCTGTGGG + Intronic
1109970545 13:69762531-69762553 GTCCTTGAGGTCCACACTGCAGG + Intronic
1119010205 14:70977716-70977738 GGCCTCGTGAACCCCACTGTTGG - Exonic
1124237277 15:28001765-28001787 GTCCTCCAGCACCACATTCTGGG - Intronic
1131272828 15:90957281-90957303 GGCCTCGGGCACCACATTCTGGG - Exonic
1132658294 16:1050397-1050419 GTCCACGAGCAGCAGACAGTCGG + Intergenic
1133550872 16:6853477-6853499 GTCCTCGAGCACCACACTGTAGG - Intronic
1134848303 16:17459951-17459973 GTCTTCAAGCAGCACAATGTGGG - Intronic
1152026717 17:77814463-77814485 GTCCTCCAGCAACACATGGTGGG - Intergenic
1152205758 17:78973656-78973678 GTCCTCGAGCAGCTTCCTGTCGG + Intronic
1152677944 17:81651245-81651267 GTCCCCGCTCAGCACACTGTAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156399567 18:36728258-36728280 GGCCTCCAGCACCACAGTATTGG + Intronic
1156831239 18:41494005-41494027 GGCCTCTAGCATGACACTGTAGG + Intergenic
1160020700 18:75178582-75178604 GGCTTGGAGCACCACACTTTGGG - Intergenic
1160284277 18:77525735-77525757 ATCCTAGCGCACGACACTGTAGG + Intergenic
1161415834 19:4145800-4145822 GTCCTTGAGCACCACCCTTGTGG - Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
930934361 2:56929529-56929551 GTCCTCTTGCACCAAACAGTTGG - Intergenic
931373808 2:61689174-61689196 TTCCTCTGGCACCACACTGGTGG + Intergenic
933553339 2:83802799-83802821 CTCCACCAGCACCACAGTGTGGG + Intergenic
935153531 2:100461559-100461581 GTCCTCTACCATCACACTTTGGG - Intergenic
939118787 2:138091321-138091343 ATCCTCATGCCCCACACTGTAGG - Intergenic
948389550 2:237602102-237602124 TTCCTCCAGGACCACACTGATGG + Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1173848277 20:46201580-46201602 CTCCTCTAACACCACAATGTGGG - Intronic
1178932612 21:36832895-36832917 CTTCTCTAGCACCACACTTTTGG + Intronic
1179483749 21:41695414-41695436 GTGCTCCAGCACCACAGTGTAGG + Intergenic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
960622244 3:119648228-119648250 ATCCTCCAGCACCAGACTGGTGG + Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964440115 3:156699922-156699944 GTCCTTCAGCCCCACACTCTAGG - Intronic
967517546 3:190388122-190388144 GACCTCCAGGACCCCACTGTTGG + Exonic
968958237 4:3730014-3730036 GTCCTCCAGGACCACACCTTGGG - Intergenic
975294144 4:72712625-72712647 GGCCTCAAGCAGCACACTTTGGG + Intergenic
983522423 4:168723646-168723668 GTGCTCTAGCACAACACAGTAGG - Intronic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
986261969 5:6155438-6155460 TTCCTCGGGAACCACACTGCAGG + Intergenic
986595763 5:9420222-9420244 GCCCACTAGCACCACTCTGTTGG - Intronic
998292338 5:140927179-140927201 GTCCTCGAGCACCAGGTCGTAGG - Exonic
998466206 5:142346178-142346200 TTCCTGGAGCAATACACTGTGGG + Intergenic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1001655660 5:173347580-173347602 ATCCTCAAGAACCACACTGAGGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1004093385 6:12528501-12528523 GGCCTTGAGCTCGACACTGTTGG - Intergenic
1004486586 6:16072254-16072276 GTCTTTGAGCACCACACTTTAGG + Intergenic
1005719225 6:28584588-28584610 GTACTCTAGAAACACACTGTGGG - Intronic
1010396664 6:75400685-75400707 GGCCTTTAGCACCAGACTGTTGG - Intronic
1017259323 6:152368853-152368875 GACCTGGAGACCCACACTGTGGG + Intronic
1019167931 6:170111198-170111220 TTCCTCCACCACCCCACTGTGGG + Intergenic
1020563403 7:9761394-9761416 GTCCTTGAGAATGACACTGTTGG + Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1033216245 7:139495638-139495660 CTCATCGAGCTCCACACAGTCGG - Intergenic
1043734150 8:83723635-83723657 CCCCTCGATCACCACATTGTGGG - Intergenic
1049178190 8:141206676-141206698 GTCCTCTGGCACCCCACTGAGGG - Intergenic
1061290209 9:129646458-129646480 GCCCTGGGGCACCACCCTGTGGG + Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1192207027 X:69103102-69103124 GTCTTTGAGCACCAGTCTGTGGG + Intergenic
1199667710 X:150113928-150113950 GGCCTTGAACACCAAACTGTAGG - Intergenic