ID: 1133556974

View in Genome Browser
Species Human (GRCh38)
Location 16:6915008-6915030
Sequence AAGCCGACTTACACCACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133556974_1133556976 -3 Left 1133556974 16:6915008-6915030 CCCAGGGTGGTGTAAGTCGGCTT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1133556976 16:6915028-6915050 CTTTGCTCATCCGTAGATGAAGG 0: 1
1: 0
2: 0
3: 4
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133556974 Original CRISPR AAGCCGACTTACACCACCCT GGG (reversed) Intronic
903168000 1:21534538-21534560 AAGCCCACATCCACTACCCTAGG - Intronic
905540157 1:38754307-38754329 AAGGCCACTTACCCCACCATGGG - Intergenic
906868194 1:49446611-49446633 ATGCCAGCATACACCACCCTGGG - Intronic
909486804 1:76183592-76183614 AAGTGTACTTACACAACCCTAGG + Intronic
910667080 1:89737269-89737291 AAACCTACTTACACAAACCTAGG + Intronic
912366589 1:109138691-109138713 AAGCAGCATTTCACCACCCTGGG - Intronic
916859503 1:168787807-168787829 AAGCCAACTTACTTCTCCCTCGG + Intergenic
921060698 1:211581665-211581687 AAGCCGTCTTACTCAACCCAGGG - Intergenic
1063743481 10:8853008-8853030 AAGCCAGCGTACTCCACCCTGGG - Intergenic
1068151154 10:53133953-53133975 AAGCCAACTTAAACCACTATAGG + Intergenic
1093718630 12:22412694-22412716 AAGCCGGCTTAAACTTCCCTTGG - Intronic
1094397781 12:30026206-30026228 GAGCGGACTTACACAAACCTAGG - Intergenic
1097785757 12:63757154-63757176 AAGCTAACTTATATCACCCTTGG + Intergenic
1100915072 12:99411167-99411189 AAACCGCCTTACAAAACCCTGGG + Intronic
1104892216 12:132145504-132145526 AGGCCCACATACGCCACCCTGGG - Intronic
1113817612 13:113185187-113185209 AAGCCCAATTCCACCACACTGGG + Intronic
1119186077 14:72643528-72643550 AAGCCCAGTAACACCACCATAGG - Intronic
1133556974 16:6915008-6915030 AAGCCGACTTACACCACCCTGGG - Intronic
1135645270 16:24156262-24156284 AAGCCAACTTTAGCCACCCTTGG - Intronic
1141622079 16:85241713-85241735 AAGCCCTCCCACACCACCCTAGG - Intergenic
1144442144 17:15293101-15293123 AATCCCACTTACGCCACCCAAGG - Intergenic
1149342307 17:55699459-55699481 AAGCCAACTCCCACCACCCTAGG + Intergenic
1152136421 17:78506619-78506641 AAGGACACTTACCCCACCCTAGG + Intronic
1154501915 18:15001476-15001498 AGGCCGACTGTCACCTCCCTGGG - Intergenic
1158616046 18:58987932-58987954 AAGCCTACTCCCACCACCCTAGG - Intergenic
1167773333 19:51537574-51537596 AAGCCAGCATATACCACCCTGGG - Intergenic
938501096 2:131831645-131831667 AGGCCGACTGTCACCTCCCTGGG - Intergenic
940227727 2:151417814-151417836 AAGAGGACTTACACAAACCTAGG + Intronic
944932045 2:204529824-204529846 AAGCAGAGTTACCCAACCCTAGG - Intergenic
945466900 2:210180633-210180655 AACCCAACTGAAACCACCCTAGG - Intergenic
1174206601 20:48844744-48844766 GAGCCGAATTACCCAACCCTGGG + Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1183516555 22:38270228-38270250 AAGACGACTTCCAGCACCCCAGG + Intronic
963519515 3:146346697-146346719 AAGGCGACATACATCATCCTCGG - Intergenic
964952738 3:162316904-162316926 AAGCCGACTTAAAAGACCTTAGG - Intergenic
978008617 4:103651423-103651445 AAGCTGACTTAAAACACTCTGGG - Intronic
984892924 4:184509484-184509506 AAGACTACTTACTCCATCCTCGG + Intergenic
1001582322 5:172807278-172807300 AAGCCTGCTGAAACCACCCTTGG - Intergenic
1014706468 6:124753771-124753793 AACCCCAATTACACCTCCCTGGG - Intronic
1023055360 7:36286021-36286043 AAGCCTCCTAACACCACCCTGGG + Intronic
1024548815 7:50543489-50543511 AAGCACACTTCCACCATCCTTGG - Intronic
1034329286 7:150269052-150269074 AAGCCGTCCTGCACCACCCATGG + Intronic
1034668768 7:152840808-152840830 AAGCCGTCCTGCACCACCCATGG - Intronic
1046566820 8:115912308-115912330 AACCCAACTTGCACCACCTTAGG - Intergenic
1049090023 8:140507572-140507594 AAACTGCCTTGCACCACCCTGGG + Intergenic
1061456448 9:130701604-130701626 ATGCTGACTTTCACAACCCTGGG + Intronic
1061624393 9:131833111-131833133 AAGCCATCTTACACCACACAGGG - Intergenic
1062498569 9:136842871-136842893 AGGCCGACTGTCACCTCCCTGGG + Intronic
1186888378 X:13937751-13937773 CAGCCGCCTTACACCAGCCTCGG + Intronic
1187635915 X:21228092-21228114 AAGAAAACTGACACCACCCTCGG + Intergenic
1200686564 Y:6264494-6264516 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200992112 Y:9355743-9355765 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200994764 Y:9376021-9376043 CAGCCGCCTCACACCACCCCCGG - Intronic
1200997428 Y:9396367-9396389 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200999940 Y:9464903-9464925 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201002601 Y:9485213-9485235 CAGCCGCCTCACACCACCCCCGG - Intronic
1201005256 Y:9505497-9505519 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201007917 Y:9525826-9525848 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201010534 Y:9546017-9546039 CAGCCGCCTCACACCACCCCCGG - Intergenic