ID: 1133561119

View in Genome Browser
Species Human (GRCh38)
Location 16:6951269-6951291
Sequence AAACTGACCCCTCAGAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 330}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133561119_1133561121 -9 Left 1133561119 16:6951269-6951291 CCCATCTTCTGAGGGGTCAGTTT 0: 1
1: 0
2: 0
3: 13
4: 330
Right 1133561121 16:6951283-6951305 GGTCAGTTTCAGCTGTCTGTAGG 0: 1
1: 0
2: 1
3: 11
4: 145
1133561119_1133561124 26 Left 1133561119 16:6951269-6951291 CCCATCTTCTGAGGGGTCAGTTT 0: 1
1: 0
2: 0
3: 13
4: 330
Right 1133561124 16:6951318-6951340 GTCATTGTCATTATTGTCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 238
1133561119_1133561122 -5 Left 1133561119 16:6951269-6951291 CCCATCTTCTGAGGGGTCAGTTT 0: 1
1: 0
2: 0
3: 13
4: 330
Right 1133561122 16:6951287-6951309 AGTTTCAGCTGTCTGTAGGCTGG 0: 1
1: 0
2: 1
3: 9
4: 153
1133561119_1133561125 27 Left 1133561119 16:6951269-6951291 CCCATCTTCTGAGGGGTCAGTTT 0: 1
1: 0
2: 0
3: 13
4: 330
Right 1133561125 16:6951319-6951341 TCATTGTCATTATTGTCTGAGGG 0: 1
1: 0
2: 2
3: 27
4: 239
1133561119_1133561123 2 Left 1133561119 16:6951269-6951291 CCCATCTTCTGAGGGGTCAGTTT 0: 1
1: 0
2: 0
3: 13
4: 330
Right 1133561123 16:6951294-6951316 GCTGTCTGTAGGCTGGATACTGG 0: 1
1: 0
2: 0
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133561119 Original CRISPR AAACTGACCCCTCAGAAGAT GGG (reversed) Intronic