ID: 1133567171

View in Genome Browser
Species Human (GRCh38)
Location 16:7006820-7006842
Sequence AACCCTCAGCTCCCAAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133567166_1133567171 24 Left 1133567166 16:7006773-7006795 CCCTATGCAGAAGAGAACACTTA 0: 1
1: 0
2: 2
3: 29
4: 300
Right 1133567171 16:7006820-7006842 AACCCTCAGCTCCCAAGCAGTGG 0: 1
1: 0
2: 2
3: 25
4: 180
1133567167_1133567171 23 Left 1133567167 16:7006774-7006796 CCTATGCAGAAGAGAACACTTAG 0: 1
1: 0
2: 2
3: 11
4: 183
Right 1133567171 16:7006820-7006842 AACCCTCAGCTCCCAAGCAGTGG 0: 1
1: 0
2: 2
3: 25
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133567171 Original CRISPR AACCCTCAGCTCCCAAGCAG TGG Intronic
900612948 1:3552103-3552125 AACCCTCAGGACCCCAGCGGTGG + Intronic
902551639 1:17223064-17223086 GTCCCTCAGCTAGCAAGCAGAGG - Intronic
908827642 1:68148931-68148953 AGGCCTCGGCTCCCAGGCAGGGG + Intronic
915026668 1:152837241-152837263 TGCCCTCAGCTCAAAAGCAGTGG - Intergenic
915067128 1:153234276-153234298 AACCCTCAGCTCATGATCAGGGG + Intergenic
916721758 1:167489718-167489740 AAGCCGCAGCTCCTCAGCAGCGG - Intronic
917697682 1:177543577-177543599 TCCCCTCAACTCCCTAGCAGAGG - Intergenic
918943147 1:191027109-191027131 CACACTAAGCTCCCAGGCAGGGG + Intergenic
919660127 1:200236155-200236177 AACCATCAGCCCCCAGTCAGAGG + Intergenic
919821609 1:201476513-201476535 AGCCCCCAGCTCCCAGGGAGAGG - Intergenic
920180856 1:204131004-204131026 ACCCCTCAGCCCCCACGCAGGGG + Intergenic
920705532 1:208248010-208248032 CACCCTTGGCTCCCAAGCACAGG - Intergenic
924154757 1:241164358-241164380 ACCCCTCAACTTCCAAGGAGGGG - Intronic
1065785417 10:29208539-29208561 AGCCAGCAGCTCCCAAGCTGTGG - Intergenic
1065989167 10:30991204-30991226 TCCCCTCAGCTCCCAAGCTGGGG + Intronic
1066500483 10:35988816-35988838 AACACCCAGCTCCCATTCAGAGG + Intergenic
1069897215 10:71687273-71687295 CACCCCCAGCTCCCATGCTGGGG - Intronic
1072627669 10:97123902-97123924 AAGCCTCAGCTCTCAAGCAGAGG + Intronic
1074776089 10:116769372-116769394 AGCACCCAGCTGCCAAGCAGTGG + Intergenic
1081792126 11:45795571-45795593 AACCCCCAGTTCCCAGGGAGTGG + Intergenic
1083084283 11:60126381-60126403 AACCCTCAACTTCCAGGAAGGGG - Intergenic
1083942331 11:65903155-65903177 ACCCCACCGCCCCCAAGCAGTGG + Intergenic
1084965792 11:72743844-72743866 AACCCCCAGCCCTCAGGCAGGGG + Intronic
1085274970 11:75292544-75292566 AAGCAGCAGCTCCCAAGCTGGGG + Intronic
1086703152 11:89922624-89922646 GACCCTCAGCTGCCGACCAGTGG - Intergenic
1087430603 11:98048285-98048307 TAACCTCAGCTCACAACCAGAGG + Intergenic
1088903468 11:114136285-114136307 CACCCTCAGCCCCCAAACAGTGG - Intronic
1089547350 11:119239049-119239071 AACCTTCACCTCCCAAGCTCAGG + Intronic
1094646443 12:32329032-32329054 AACCTCCAGCTCCAAAGCTGGGG - Intronic
1096087162 12:48873401-48873423 AATGCTCAGCTCCCAGGAAGAGG - Intergenic
1096628184 12:52907809-52907831 AACCCTGAAGTCCCAGGCAGGGG - Intronic
1096692899 12:53332087-53332109 ACCCCTGATCTTCCAAGCAGCGG + Intronic
1100378292 12:94038116-94038138 ATCCCACAGCTCCCAAGTAGTGG + Intergenic
1103946311 12:124528643-124528665 CACCCTCATCTCTCCAGCAGAGG + Intronic
1104627046 12:130366081-130366103 AACCCTCTGCTTCCCAGCATTGG + Intronic
1105251084 13:18698584-18698606 CACTCTCAGCTCCCAGGCGGGGG + Intergenic
1106031357 13:26008091-26008113 AACCCACAGGGCCCTAGCAGAGG + Intronic
1107677111 13:42808948-42808970 AATCCTCAACTCCCAAGCGATGG + Intergenic
1110741233 13:78999911-78999933 GAACCTCAGCTCACATGCAGAGG - Intergenic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1113682834 13:112256115-112256137 AACCCTCTGCTCAAAAGCAAAGG + Intergenic
1114257162 14:21012897-21012919 AACCCTCAGCTTGAAAGCAAAGG - Intergenic
1123429360 15:20201883-20201905 AACCTTCAGCTCCAAGGAAGAGG - Intergenic
1125364689 15:38901464-38901486 ATGCCTAAGCTCCCAAGCAGTGG + Intergenic
1126962236 15:54009974-54009996 AATCCTCTGCTCCCCATCAGAGG + Intergenic
1128217739 15:65945851-65945873 TACCCGCAGCTCACAGGCAGGGG + Intronic
1129188588 15:73924974-73924996 ACACCTCAGCTCCCCAGCATGGG - Intergenic
1130709937 15:86270144-86270166 AACCCTCTGAACCCAAGCAAAGG - Intronic
1132098524 15:99006108-99006130 GACCCACAGCTCCTAGGCAGCGG - Intronic
1132603738 16:785077-785099 GACCCACAGCTCCCAAGCTGGGG + Exonic
1133156054 16:3877102-3877124 ACCCCTCAGCTCCTAGACAGAGG + Intronic
1133567171 16:7006820-7006842 AACCCTCAGCTCCCAAGCAGTGG + Intronic
1135136815 16:19891064-19891086 GACCATGAGGTCCCAAGCAGAGG - Intergenic
1136854960 16:33647846-33647868 AACCTTCAGCTCCAAGGAAGAGG + Intergenic
1137744044 16:50807834-50807856 TTCCCCCACCTCCCAAGCAGAGG - Intergenic
1139869347 16:70092528-70092550 AACCATTAGGTCCAAAGCAGTGG + Intergenic
1140386036 16:74539685-74539707 AACCATTAGGTCCAAAGCAGTGG - Intronic
1141141237 16:81498121-81498143 AACCTGCTGCTCCCTAGCAGTGG + Intronic
1141257834 16:82419380-82419402 ATCCCTCAGTTCACAAACAGGGG + Intergenic
1142076250 16:88119871-88119893 AACCATCCTGTCCCAAGCAGTGG - Intergenic
1203116538 16_KI270728v1_random:1496331-1496353 AACCTTCAGCTCCAAGGAAGAGG + Intergenic
1142875187 17:2848162-2848184 AACCCACAGATCCCACTCAGTGG - Intronic
1143711201 17:8736425-8736447 AACCCTCAGGTCCCACTCAGTGG + Intronic
1145097615 17:20044401-20044423 AACACACATCTCCCAAGTAGAGG - Intronic
1148150420 17:45393739-45393761 AGCCCTCCTCCCCCAAGCAGAGG - Intergenic
1148203069 17:45762815-45762837 AAGCCTCTGCTCCCACTCAGGGG + Intergenic
1148753087 17:49957129-49957151 CACCCTCAGCTTCTAAGCACAGG - Intergenic
1149572444 17:57682840-57682862 ACTCCTCTCCTCCCAAGCAGAGG + Exonic
1150591764 17:66568930-66568952 AGCCTTCAGTTGCCAAGCAGTGG + Intronic
1151559667 17:74863475-74863497 AAGCCTCAGCTCCTAAGCTTAGG - Intronic
1152482268 17:80562387-80562409 ACCACCCAGCCCCCAAGCAGGGG - Intronic
1154437764 18:14360330-14360352 CACTCTCAGCTCCCAGGCGGGGG - Intergenic
1156045957 18:32877604-32877626 ATCCCACAACTCCCAATCAGTGG + Intergenic
1156156049 18:34302856-34302878 ATCCATCAGCTCCCAAACAAGGG - Intergenic
1156652571 18:39241937-39241959 AACACTCAGTTCCTAAGCTGCGG + Intergenic
1157311921 18:46559406-46559428 AACCCACAGCCCCCACCCAGGGG + Intronic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1158109393 18:53923654-53923676 AAACCTCAGATCCCCAGCAGAGG + Intergenic
1158225825 18:55199961-55199983 AACTCTCAGCTCCCAGAGAGGGG - Intergenic
1160449251 18:78950843-78950865 AAAGCTCAGCTCCAAAGCTGTGG + Intergenic
1161141911 19:2653287-2653309 GACCCTCAGCTCCCAAACCTGGG + Intronic
1161981906 19:7634250-7634272 TTCCCTCAGTGCCCAAGCAGGGG + Intronic
1162061302 19:8097080-8097102 AACCACCTGCTCCGAAGCAGTGG - Intronic
1163424646 19:17234941-17234963 AACCATCAGCTATCTAGCAGTGG - Intronic
1163677222 19:18661122-18661144 AGGCCTCAGCTACAAAGCAGGGG - Intronic
1163699238 19:18778892-18778914 GACCCTGAGCTGCCAAGAAGGGG - Exonic
1164930877 19:32174875-32174897 AACACTCAGCTCCCATACTGTGG + Intergenic
1164989172 19:32672475-32672497 AAGCCCCAGCTCCCAGGGAGAGG + Intronic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
924982719 2:237904-237926 AAACCACAGCTGCCATGCAGGGG + Intronic
925291423 2:2751016-2751038 AAACCTCAGCTCCCCCGCGGGGG - Intergenic
926044989 2:9703758-9703780 AGACCTCAGCTGCCCAGCAGTGG + Intergenic
926159082 2:10475336-10475358 GACCCCCAGCCCCCACGCAGAGG - Intergenic
926905233 2:17799405-17799427 CACCCTCAGCTGCCCAGCACTGG - Intronic
928374294 2:30762541-30762563 ATCCCTCATCTCCCAGCCAGGGG - Intronic
929857541 2:45650026-45650048 AATCCCCAGCTCCCCGGCAGCGG + Intergenic
931386284 2:61800588-61800610 AACTCTCAGCTCTCAAACAGTGG - Intergenic
931737949 2:65214984-65215006 AACACACAGCTTCCAATCAGTGG - Intergenic
932462565 2:71892527-71892549 AGCTCTCAGCCCCCAAGGAGGGG + Intergenic
932568668 2:72925061-72925083 AACCCTCGGGCCCCAAGCAGGGG - Intronic
935061113 2:99608615-99608637 GACCCTCAGCTCCCCAGCCGAGG + Intronic
936525244 2:113236809-113236831 AGCCCTCATCTCCCCAGGAGAGG + Intronic
936651801 2:114436234-114436256 ATCCCACATCTCCAAAGCAGTGG - Intergenic
938031883 2:128002006-128002028 AACCTCCACCTCCCAGGCAGAGG + Intronic
939166980 2:138650748-138650770 ATCCCTCAGCTGCCAACCCGAGG + Intergenic
939675341 2:145065493-145065515 ACCCACCAGCTCCCAAGCTGAGG + Intergenic
940500206 2:154484613-154484635 AAATCTCAGCTCCCAAAAAGTGG + Intergenic
940639482 2:156332197-156332219 AGTCCTCAGCTCCCAAACTGTGG + Intronic
940676471 2:156729781-156729803 AGTCCTCAGCACCCAAACAGAGG + Intergenic
942668652 2:178349965-178349987 AACCCTAAGCTGCCATGGAGAGG - Intronic
948230630 2:236346577-236346599 AGTTCTCAGCTCCGAAGCAGAGG - Intronic
948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG + Intergenic
949081719 2:242105998-242106020 ACCTCTTAGCTCCCAAGGAGAGG + Intergenic
1170707065 20:18753837-18753859 GACCATCAGCTCTCAAGCAAAGG + Intronic
1174277994 20:49417512-49417534 AAGCCTCAGCTCCCAGGAAGGGG + Intronic
1174615526 20:51832551-51832573 AACCCACAGCTCCCATGGGGTGG + Intergenic
1174863774 20:54116129-54116151 AGGTCACAGCTCCCAAGCAGGGG - Intergenic
1174997772 20:55590030-55590052 AACCCCAAGCTCCACAGCAGAGG - Intergenic
1175127497 20:56763373-56763395 GGCCCCCAGCTCCCAAACAGAGG - Intergenic
1175973689 20:62699688-62699710 CACCCTCACCTCCCAGCCAGAGG + Intergenic
1176369297 21:6052829-6052851 AATCCTCACCCCCAAAGCAGTGG + Intergenic
1179754222 21:43485712-43485734 AATCCTCACCCCCAAAGCAGTGG - Intergenic
1179996787 21:44977871-44977893 CACTCTCAGCTCCCAGGCGGGGG + Intergenic
1180841882 22:18962890-18962912 CTGCCTCAGCTCCCAAGTAGCGG + Intergenic
1181059615 22:20275978-20276000 CCGCCTCAGCTCCCAAGTAGCGG - Intronic
1181884014 22:26004730-26004752 CATCCTCAGCTCCCAGCCAGAGG + Exonic
1183111070 22:35648899-35648921 AGCCCTCGGATCCCCAGCAGTGG - Intronic
1183153423 22:36055498-36055520 AACCCTTACCCCCCAGGCAGAGG - Intergenic
1184750052 22:46480289-46480311 CCCCCTCACCTCCCAAGAAGAGG + Intronic
1184993843 22:48188270-48188292 ATCCCTCAGCATCCCAGCAGAGG + Intergenic
952943182 3:38458630-38458652 TACCCTGAGCTCCCAAGCAGAGG - Intronic
953976290 3:47383989-47384011 AACCCTCAGCTCCAATTCACTGG - Intronic
955610004 3:60746749-60746771 AACCCTCAGCCCCTACCCAGTGG - Intronic
955903903 3:63786806-63786828 AACACTCAGCTCTCAAACTGGGG - Intergenic
961035346 3:123638004-123638026 AACCCTCAGCCCCCACCCACTGG + Intronic
961472802 3:127127053-127127075 AACCCGCTGGTCCCAAGCAGAGG + Intergenic
961595048 3:128009320-128009342 AGCCATCAGCACCCAAGCAGTGG - Intergenic
963543469 3:146624903-146624925 AAACCTCAGGTCCCAAGAAGAGG + Intergenic
968637803 4:1691064-1691086 AACCCTCAGGTTCCTACCAGCGG - Intergenic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
968938528 4:3626000-3626022 CACCCTCAGCAACCAAGCAGGGG - Intergenic
969394297 4:6910340-6910362 GACCCTCAGTCCCCAGGCAGCGG + Intronic
970574765 4:17416582-17416604 AAAACTCAGCACCCAAGAAGAGG - Intergenic
971521633 4:27559733-27559755 CTCCCTCAGCTTCCAAGCATTGG - Intergenic
971537177 4:27767842-27767864 AATCCCCAGCTCCCAAGAGGTGG - Intergenic
979295750 4:119030980-119031002 AAGCCTCTGCCCCCAAGCTGAGG - Exonic
982203697 4:152981481-152981503 AGTCCCCAGCTCACAAGCAGAGG + Intergenic
984863197 4:184257772-184257794 AACCTCCAGCTCCCAATCAGGGG + Intergenic
985627759 5:998721-998743 GGCCCTCAGCTCCCAGGAAGAGG + Intergenic
985936546 5:3101896-3101918 AACACTCAGGTCCCCAGCAGTGG - Intergenic
986760568 5:10876297-10876319 ATCCCTTAGGTCCCAAGCAGAGG + Intergenic
990166244 5:52996432-52996454 AACCTGCAGCTTCTAAGCAGGGG - Intronic
991046894 5:62232319-62232341 AACCTTCAGCTCCAAGGAAGAGG - Intergenic
994723585 5:103408508-103408530 AAGCCTCTGCTCTCCAGCAGTGG - Intergenic
996186214 5:120478540-120478562 ACCTCTCACCTCCCAACCAGTGG + Intronic
996241772 5:121212978-121213000 ACCACTCAGCGCCCAAGCAGTGG - Intergenic
998148167 5:139742179-139742201 AACTCACAGCTATCAAGCAGGGG - Intergenic
999321221 5:150616236-150616258 ACGCCTCCGCCCCCAAGCAGGGG - Intronic
1001242564 5:170081542-170081564 AACCTTCTGCTCCAAGGCAGGGG - Intronic
1002073189 5:176692823-176692845 CACCCCCAGCTCCTGAGCAGGGG + Intergenic
1004920120 6:20368408-20368430 GACCCTCAGCTCAGAAGCATGGG + Intergenic
1006671922 6:35735079-35735101 AACCCTCACTTCCTAAGCACAGG - Intergenic
1006964192 6:37965541-37965563 AACCCTCACCTGGGAAGCAGTGG - Intronic
1007390052 6:41545847-41545869 CACCCCCAGCCCCCACGCAGTGG + Intergenic
1008621159 6:53272745-53272767 ACCCCTCAGCCCCCATGCAGTGG - Intronic
1011596355 6:89020359-89020381 ATCCCTCAGATCACAAGCTGGGG - Intergenic
1011906973 6:92382935-92382957 AACAGTCTGCTCCAAAGCAGGGG + Intergenic
1012989539 6:105911230-105911252 GACCCTGAGCTCCTGAGCAGAGG + Intergenic
1016757321 6:147701083-147701105 AACCCTAACTTCCCATGCAGAGG - Intronic
1017027559 6:150194778-150194800 AAACATCAACCCCCAAGCAGTGG - Intronic
1017434268 6:154401209-154401231 AACCCTAATCTCCAAAGCAATGG + Exonic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1019317594 7:396637-396659 AATCCTCATCTGCCAACCAGGGG + Intergenic
1019336537 7:485483-485505 AAGCCACAGCTCCCAGGCTGGGG + Intergenic
1020119068 7:5492569-5492591 CACCCTCAGGTCCCAAGGTGAGG - Intronic
1022543319 7:31160168-31160190 GACCCTCTGCTCACAGGCAGAGG - Intergenic
1024896233 7:54265448-54265470 AACCCTCAGCTTCCAGGGACTGG - Intergenic
1025104152 7:56157138-56157160 GACACTTACCTCCCAAGCAGAGG + Intergenic
1026260375 7:68749635-68749657 AACCCTCAGCCCTCACGCACAGG - Intergenic
1029605929 7:101599402-101599424 AAGCCACAGCACCCATGCAGGGG + Intergenic
1031286749 7:119880013-119880035 AGCTGTCAACTCCCAAGCAGGGG + Intergenic
1035775416 8:2183759-2183781 AACCATCAGCTCCCTCTCAGAGG - Intergenic
1038397619 8:27258686-27258708 TACCCCCAGCTCGCAAGCTGTGG - Intergenic
1039508136 8:38067159-38067181 AACCCCCAGCTGCAAATCAGAGG + Intergenic
1039987950 8:42463792-42463814 ATCCCTGAGCTGCCAGGCAGGGG - Intronic
1048805882 8:138240848-138240870 AACACTCATCTCCCAAGCCAAGG - Intronic
1048882821 8:138884228-138884250 AACCCTGAGCTCCTCAGCAGGGG + Intronic
1049973853 9:843068-843090 AACCCTCTGCTCCCAAGGCGCGG - Intronic
1050540613 9:6666336-6666358 AAGCAGCAGCTCCCAAGAAGAGG + Intergenic
1051852635 9:21527635-21527657 AACACTCAGCTCCCAACCTCAGG + Intergenic
1051968743 9:22862362-22862384 AACCCTCAGCTCTCATGAAATGG + Intergenic
1053482227 9:38424202-38424224 CGCCCTCGGCTCCCAGGCAGCGG + Exonic
1054452213 9:65409336-65409358 CACCCTCAGCAACCAAGCAGGGG + Intergenic
1054737509 9:68770328-68770350 AAATCTCAGCTCCTAAGGAGGGG + Intronic
1055193620 9:73559367-73559389 AACCTTAAGCCACCAAGCAGGGG - Intergenic
1057919765 9:99087554-99087576 AAACCTCAGCTCCCACCAAGTGG + Intergenic
1059365859 9:113786002-113786024 CACCCACAGTTCCCATGCAGGGG + Intergenic
1059534019 9:115064394-115064416 AACACACAGCTCCCATGCAGAGG - Intronic
1060154235 9:121308141-121308163 AACCCACAGCTCCCTTGAAGGGG + Intronic
1061855477 9:133439787-133439809 AACTCTCAACTCCCACTCAGTGG - Intronic
1062502845 9:136858653-136858675 AGCCCTCAGGGCCCGAGCAGAGG - Intronic
1062570197 9:137181421-137181443 ACCCCACAGCTCACAAGCGGTGG + Intronic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1189166555 X:38866625-38866647 AACCCCCAGGCCCCAGGCAGAGG - Intergenic
1189276272 X:39788282-39788304 AACTTTCAGCTCACCAGCAGTGG + Intergenic
1190427782 X:50348839-50348861 GACCCTCAGCTCCAGAGCTGTGG - Intronic
1195620449 X:106949410-106949432 CACCCTCTGCTCCCATGTAGAGG + Intronic
1200299073 X:154954184-154954206 CACCCTCAACTCCCAAGCCCTGG - Intronic