ID: 1133571876

View in Genome Browser
Species Human (GRCh38)
Location 16:7049110-7049132
Sequence TCCCAAATTATTTTCTCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133571876 Original CRISPR TCCCAAATTATTTTCTCTCC GGG Intronic
901564040 1:10097441-10097463 TTCCACATTTTTTTCTCTACTGG + Intronic
901616916 1:10547691-10547713 TCCCAAATTATCTTATTTTCAGG + Intronic
905255414 1:36678630-36678652 TCCCAGAGCATTTTCTCTCTTGG + Intergenic
905459878 1:38115675-38115697 TCCCAAACCTTTTCCTCTCCAGG + Intergenic
908158504 1:61382304-61382326 TCCCAAAGCATTTTCTATGCTGG + Intronic
909013724 1:70361311-70361333 TAGCAAATTAATTTCTCTCCTGG + Intronic
909164309 1:72198702-72198724 TATCAGATTATTTTCTCTACTGG - Intronic
909520183 1:76559005-76559027 TCTGAAATTATTTTCCTTCCTGG + Intronic
910461078 1:87448564-87448586 CCCCAAATTATATTTTATCCAGG + Intergenic
910493199 1:87795914-87795936 ACCCATATTTTTTGCTCTCCAGG - Intergenic
912489882 1:110056732-110056754 GCCTAAATTTTTTTCTCTTCTGG + Intronic
914318316 1:146534915-146534937 CCCCAAATTATATTTTATCCAGG + Intergenic
914496044 1:148198442-148198464 CCCCAAATTATATTTTATCCAGG - Intergenic
914727510 1:150340412-150340434 TCCAAAATAATCTTCTCTCTTGG - Exonic
914809672 1:151017790-151017812 TCCCATTTTCCTTTCTCTCCAGG + Exonic
915323198 1:155067275-155067297 TCCCAGGTTTTCTTCTCTCCAGG - Intronic
915405000 1:155653317-155653339 TAACAAATACTTTTCTCTCCTGG + Intergenic
915551760 1:156639405-156639427 TCCCAAATAATGAGCTCTCCAGG + Intergenic
916427611 1:164696196-164696218 TCCCAGATCCTTTTGTCTCCTGG - Intronic
916779768 1:168012119-168012141 TCCCAACTTATTTCTTGTCCTGG - Intronic
917139139 1:171817381-171817403 TCCCTAATTATTTCCTTTCTTGG - Intergenic
917495093 1:175533368-175533390 TCCCACATTCTTTCCTCTCAGGG + Intronic
917615708 1:176741864-176741886 TTTCAAATTATATTCTCTACTGG + Intronic
917736302 1:177923757-177923779 ACTCAAATTATTTTCACTCCAGG + Intergenic
918239165 1:182606681-182606703 TCCCAAATTATCTTCCCAGCAGG + Intergenic
918681467 1:187360216-187360238 TACCAAATTACCTTCTCACCAGG + Intergenic
920110805 1:203585915-203585937 TACCAAGTTATTTTCTGTGCAGG + Intergenic
920911684 1:210223951-210223973 TCAAAAATTAATTTGTCTCCAGG + Intergenic
921970609 1:221144550-221144572 GACCAACTTATTTTCTCTTCTGG - Intergenic
922370235 1:224902706-224902728 TCCCCAGTTTTTTTCTCTCTTGG + Intronic
923133250 1:231095724-231095746 TCCCATATTGTTTACTCTGCGGG + Intergenic
924692661 1:246366478-246366500 TGCCCAAGTATTTTCTCTGCAGG - Intronic
924771083 1:247080016-247080038 TTTCTAATTATTTTCTCTACAGG + Intergenic
1062838165 10:650075-650097 TGTCAAGCTATTTTCTCTCCTGG - Exonic
1063022329 10:2141953-2141975 TCCCAGAGGACTTTCTCTCCAGG + Intergenic
1063139403 10:3243101-3243123 TCTCAAGTTATTGTCTCTCTGGG + Intergenic
1063403116 10:5767152-5767174 ATCCAAATGATTTTCTATCCTGG - Intronic
1063650423 10:7930707-7930729 ATCAAAATTATTTTCTCACCTGG - Intronic
1065544291 10:26803175-26803197 TCCTAATTTATTTACTCTTCTGG - Intronic
1065906508 10:30258125-30258147 TCTAAAATTAGTTTCTCCCCAGG + Intergenic
1068347163 10:55796187-55796209 TCCTAAATTTGTTTCACTCCTGG - Intergenic
1068626745 10:59257332-59257354 GCCCAAATTAGTTTCTTTCTGGG + Intronic
1072137873 10:92564178-92564200 TCTCAAATTTTTTTCTTTCTTGG - Intronic
1073630592 10:105144551-105144573 TCCCAAATTATTGTCTTGGCAGG + Intronic
1073635993 10:105199700-105199722 TCCCAATTTTTTTTCTTTACTGG + Intronic
1073706212 10:105987285-105987307 AGCAAAATCATTTTCTCTCCAGG - Intergenic
1073842437 10:107513427-107513449 TCCAAATTTATTTTGTCACCTGG - Intergenic
1075204913 10:120438615-120438637 GCCCATATTATTTTCTATCATGG - Intergenic
1075597865 10:123745456-123745478 TCCCAAACAAGTGTCTCTCCTGG + Intronic
1078279997 11:9891774-9891796 CCACAAATTATTTTTTCCCCTGG - Intronic
1078367127 11:10715952-10715974 TACCAGAGTCTTTTCTCTCCAGG + Intergenic
1078558143 11:12347544-12347566 TCCCAAATTATTTACTTTATGGG - Intronic
1078686362 11:13535939-13535961 TTCCAAAGTATTTGCTCTCTTGG - Intergenic
1079922251 11:26447391-26447413 TGGCAAATTATTTTCTCTCTTGG - Intronic
1082899968 11:58237359-58237381 ACCCAAGTTATTTTCTCTAATGG + Intergenic
1086155682 11:83663210-83663232 TCTTAAATTATTTTGTCTCTAGG - Intronic
1086195863 11:84138583-84138605 TCACAAAATATTTTGTCACCTGG + Intronic
1086197961 11:84164569-84164591 TCCCTCATTATTTTCTTGCCAGG - Intronic
1086791477 11:91043892-91043914 TCCCAAATTATTTTGGCTCCAGG + Intergenic
1087466677 11:98516759-98516781 TTACAAATTATTTTGTCACCCGG + Intergenic
1087593919 11:100229459-100229481 TCCTAAATTAGTTTCTATCCAGG - Intronic
1088024460 11:105161060-105161082 TCCTCACTCATTTTCTCTCCCGG - Intergenic
1088941744 11:114466227-114466249 ACCAAAATTATTTTCACTGCAGG - Intergenic
1090089004 11:123677672-123677694 TCCCAAAGAATTTTTTCTCAGGG - Intergenic
1090577407 11:128121243-128121265 GCCCAAATTATTTTCTTTCTTGG - Intergenic
1091020026 11:132091087-132091109 TCAAAAATTATTTTCTCTTCTGG + Intronic
1094029593 12:25995772-25995794 GGTCAAATTATTTTCCCTCCTGG - Intronic
1095932746 12:47645065-47645087 TCCCAATTTATGTTCTGTCTTGG - Intergenic
1096186923 12:49587511-49587533 TCCCCAATAAATCTCTCTCCAGG - Exonic
1096760055 12:53834007-53834029 TCCCAAATTTACATCTCTCCTGG - Intergenic
1096902085 12:54894129-54894151 TCCCTAATTATTTTCTGTGAGGG - Intergenic
1097443505 12:59640431-59640453 TTCTAAATTATTTTTTCTCTGGG - Intronic
1097974279 12:65667786-65667808 TCTCATATTTTTTTTTCTCCTGG - Intergenic
1098647009 12:72915531-72915553 TGCCATAGTATTTTCTCTTCTGG + Intergenic
1098762566 12:74443450-74443472 TCTCAAATCAGTTTCTCTCTAGG - Intergenic
1101258910 12:103009182-103009204 TCCTGATTTATTTGCTCTCCAGG + Intergenic
1101705835 12:107220337-107220359 TTCCAATTTGTGTTCTCTCCTGG - Intergenic
1102781030 12:115564720-115564742 ATGAAAATTATTTTCTCTCCAGG + Intergenic
1103489776 12:121308209-121308231 TCTCAGATTATGTTCTCTCTGGG - Intergenic
1103885131 12:124194790-124194812 TCCCAATTTATTATCTTCCCAGG + Intronic
1104095012 12:125548948-125548970 TCCCAAGTTATTTTCTCACAGGG - Intronic
1104322877 12:127768504-127768526 TCCCAAATTAGTTTCTCTATTGG - Intergenic
1104786160 12:131449295-131449317 TGCCCAATTATTTTCTCTATCGG + Intergenic
1106171277 13:27290751-27290773 TCCCAAATCATTGTCTCCCCGGG + Intergenic
1106729938 13:32530676-32530698 GCCAAAATTATTTCTTCTCCTGG - Intronic
1106904298 13:34388889-34388911 TCTCAAAATGTTTCCTCTCCTGG + Intergenic
1107548013 13:41452121-41452143 TCCTAGGATATTTTCTCTCCTGG - Intergenic
1107782288 13:43916515-43916537 AACCAAATTTTTTTCTCTGCAGG - Intergenic
1107867343 13:44715646-44715668 TGCCAAAATATTTTTTCTCCTGG - Intergenic
1109254807 13:60066980-60067002 TCAAAAATTATTTTCTTGCCTGG + Intronic
1110460510 13:75739841-75739863 TCCCCACTTATTCTCTCTTCAGG + Intronic
1110622435 13:77612126-77612148 TTTCCAATTATTTTCTCTCCAGG + Intronic
1110950702 13:81486701-81486723 TCCAAAATTTTTTTCTATTCTGG + Intergenic
1111298523 13:86316118-86316140 TTAAAAATTATTTTATCTCCAGG + Intergenic
1111410116 13:87864664-87864686 GTCCAAATTATTTTCTCTTCAGG - Intergenic
1113263201 13:108589165-108589187 TACCAACTTATTTTTTCTCAAGG + Intergenic
1114471285 14:22964558-22964580 TCACACATTATTTACCCTCCTGG - Intronic
1114719362 14:24863792-24863814 TGCAAATTTATTTTCTCTGCAGG - Intronic
1116867795 14:50045325-50045347 AACCAAATTTTTATCTCTCCAGG + Intergenic
1116963308 14:50989165-50989187 TTCCAAATCCTTTACTCTCCTGG + Intronic
1117198030 14:53360833-53360855 TCTCAAATTATTTTGACTTCAGG + Intergenic
1117878792 14:60285602-60285624 TCTCAAATTTTTTTCTTCCCAGG + Exonic
1117951939 14:61091449-61091471 TCCCAAACTATTTTTTCTCAGGG - Intergenic
1118878707 14:69808178-69808200 TACCAAGTTATTTTCTCACCTGG + Intergenic
1118893261 14:69926137-69926159 ACACAAATTATGTCCTCTCCTGG + Intronic
1119005438 14:70922930-70922952 TACCAATTTATATTCTCTCCAGG + Intronic
1119019041 14:71090554-71090576 TCCCAAATTAATATTTCCCCAGG - Intronic
1119809385 14:77503725-77503747 TGCCAAATTATTTTCTCACGTGG + Intergenic
1119921703 14:78452555-78452577 TCCCACATTATTATCTCTCAAGG + Intronic
1120114904 14:80603768-80603790 TACTCAATTATTTTCTCTCTTGG - Intronic
1120692141 14:87604603-87604625 TCCCAAATTTATTTCAGTCCAGG - Intergenic
1125018461 15:34961174-34961196 TTTTAAATTATTTTCTCTCTGGG - Intronic
1125181588 15:36885754-36885776 TCTCTAATTATGTTCCCTCCTGG + Intergenic
1126262891 15:46715003-46715025 TGCCAAATTGTTTTCTATCCTGG - Intergenic
1126582929 15:50257709-50257731 CCCCACATTATTTTCTCTTTTGG - Intronic
1126858656 15:52862819-52862841 TCCAAAGTTGTTCTCTCTCCAGG + Intergenic
1127212024 15:56783311-56783333 TTACAAATTATTTTCCCACCTGG - Intronic
1128534335 15:68479334-68479356 TCCCACAGTATTTTCAGTCCAGG - Intergenic
1128730537 15:70017806-70017828 CCCCAATTTATTTCCTCACCTGG - Intergenic
1129199417 15:73990049-73990071 TGCCAAATTATCTTCTCTTTGGG - Intronic
1131675706 15:94668108-94668130 TCAGAAATTCTCTTCTCTCCAGG - Intergenic
1131913206 15:97231893-97231915 TCGCAAACTGTTTTCTCTCCAGG + Intergenic
1133157955 16:3889205-3889227 TACACAATTATTTTCTTTCCGGG - Intergenic
1133571876 16:7049110-7049132 TCCCAAATTATTTTCTCTCCGGG + Intronic
1133636394 16:7670029-7670051 TCCCAAAAAAGTTTCTCTTCTGG - Intronic
1135841667 16:25882395-25882417 TTCCAACTCATTTCCTCTCCTGG - Intronic
1136422942 16:30147979-30148001 TTCCAAAATATTTTCACCCCAGG + Intergenic
1138149229 16:54640456-54640478 TGAAAATTTATTTTCTCTCCTGG + Intergenic
1139112746 16:63911564-63911586 TCCCAAGTTATTAGCTTTCCTGG - Intergenic
1143075899 17:4342998-4343020 CCCCGCTTTATTTTCTCTCCAGG + Intronic
1146239682 17:31208327-31208349 TTGCTATTTATTTTCTCTCCTGG - Intronic
1147182185 17:38693375-38693397 TCCCCCATCATTTTCTCCCCTGG - Intergenic
1147212415 17:38879621-38879643 TCCCAAATTTTTTTTTCCCTGGG - Intronic
1150161064 17:62898568-62898590 TCCCAAATTAAATTCTCCTCGGG + Intergenic
1150634695 17:66904665-66904687 TCCCTAAAAATTTTCTGTCCAGG - Intergenic
1151115973 17:71735682-71735704 TAACAAATTATTTTCCTTCCTGG + Intergenic
1152845634 17:82597950-82597972 TCCCAGTTTCTTTTCACTCCAGG + Intronic
1153951471 18:10061146-10061168 TCCAAAATTTTCTTCTTTCCTGG - Intergenic
1154057535 18:11025778-11025800 CCCCTCATCATTTTCTCTCCTGG + Intronic
1154475594 18:14753108-14753130 TTTCAAATTATTTTCACTCAAGG - Intronic
1157855755 18:51104217-51104239 TTCCATTTTATTTTCTCTACTGG + Intergenic
1159483629 18:69025410-69025432 TCCAAAGCTATTTTCTCTCTTGG - Intronic
1159613147 18:70548604-70548626 TCAGAAAGTATTTTCTCTCAAGG - Intergenic
1159668015 18:71187811-71187833 GCCAAATTTACTTTCTCTCCTGG + Intergenic
1160088090 18:75798757-75798779 TCCCATGTTATTTTCTTTCTGGG - Intergenic
1160148459 18:76382811-76382833 TCCCAAATGATCCGCTCTCCTGG - Intronic
1160160651 18:76467410-76467432 GCCCAAATCATTTCCTCTCTGGG - Intronic
1161543990 19:4868691-4868713 TCCCAAATTATTTATCCTCTTGG + Intergenic
1164687835 19:30180363-30180385 TCCCTATTTTTGTTCTCTCCAGG + Intergenic
1166413578 19:42575101-42575123 ACACAAATTTTTCTCTCTCCAGG - Intergenic
1166633861 19:44432164-44432186 GCCAAAAATATCTTCTCTCCAGG + Intronic
925511577 2:4632405-4632427 TCCTAAATTTGTTTCTCTTCTGG - Intergenic
927426029 2:22982194-22982216 TTCCAAATTATATTTTCACCAGG - Intergenic
927569609 2:24146629-24146651 TACCATATTATTTACCCTCCCGG + Intronic
927598750 2:24421804-24421826 ATCCAAATTGTCTTCTCTCCAGG + Intergenic
929302619 2:40323388-40323410 TCTCAAATTATTTCTTCACCTGG + Intronic
931172284 2:59816090-59816112 CACCTAATTTTTTTCTCTCCTGG + Intergenic
931859318 2:66337593-66337615 GCCCAACTTCTTTTCTCTTCAGG + Intergenic
932166335 2:69511078-69511100 TCCAAAGTTATTTTATCTCTAGG - Intronic
932422387 2:71608800-71608822 TCCCAGAATATTTCCTCTCTAGG - Intronic
933580043 2:84115803-84115825 TTCTAAGTTATTTTCTTTCCTGG - Intergenic
934158297 2:89223653-89223675 TCCCCAGATGTTTTCTCTCCAGG - Intergenic
934208969 2:89958771-89958793 TCCCCAGATGTTTTCTCTCCAGG + Intergenic
935709217 2:105882336-105882358 TCAAACATCATTTTCTCTCCTGG + Intronic
937596064 2:123675028-123675050 TCCCTAATTATTTAATCTGCTGG - Intergenic
937858589 2:126690710-126690732 TCCCACATTATTTTCTTCCCTGG + Intronic
937859090 2:126694297-126694319 TCCCACATTATTTTCTGCCCTGG + Intronic
938751778 2:134338511-134338533 TCTCAAATGATATTCTCTCAGGG + Intronic
939171247 2:138698951-138698973 TGCCTAATTATTTACTCTCCGGG - Intronic
939258468 2:139776016-139776038 GCCCAAATTATTTTACCTCATGG - Intergenic
939732166 2:145798218-145798240 CCCCAAGATCTTTTCTCTCCTGG + Intergenic
939957669 2:148540208-148540230 TCCCAAGTCAGTGTCTCTCCTGG - Intergenic
940690079 2:156905543-156905565 TCCTAAGTTATTTTCTTTCACGG + Intergenic
941387825 2:164874728-164874750 TACCAAATAATATTCTCTACTGG - Intergenic
941983623 2:171487880-171487902 ACTCAAATTATTTTCTTCCCAGG + Intergenic
942533769 2:176941232-176941254 TTCCACATTATCTTGTCTCCAGG - Intergenic
942596633 2:177597674-177597696 TCCAAGATTCTTTTCTCTCTTGG + Intergenic
942956568 2:181781042-181781064 TCCCAACTTCTTCCCTCTCCTGG - Intergenic
943315296 2:186379798-186379820 ACTAAAATTATTTTCTCTCTGGG - Intergenic
943581686 2:189691350-189691372 TTAAAAATAATTTTCTCTCCCGG - Intronic
943785474 2:191873594-191873616 TCCCAAATTATTAGGTCTACAGG - Intergenic
943840929 2:192579674-192579696 TCTCAAATTATATTCTTTCTTGG - Intergenic
945368464 2:208986171-208986193 TCCAAAATGTTTTTGTCTCCAGG - Intergenic
945873217 2:215249605-215249627 TACCAACTTATTTTCTCTATAGG - Intergenic
946066527 2:216992363-216992385 GACAGAATTATTTTCTCTCCTGG + Intergenic
946116207 2:217464603-217464625 TCTCTAATTGTATTCTCTCCTGG + Intronic
947996027 2:234528705-234528727 TCCTAAATTGTTTTCACTCAAGG + Intergenic
948897751 2:240935151-240935173 TCCCAGATCACTTCCTCTCCTGG + Intronic
1169069754 20:2717315-2717337 TCCCTATATATTCTCTCTCCAGG - Intronic
1169581863 20:7032583-7032605 TCTCTAATTCTTTTATCTCCAGG + Intergenic
1169643996 20:7788892-7788914 TGCCAAATTATTTTCTATAGTGG - Intergenic
1169661804 20:7986722-7986744 TCCCCAGGTATTTTCTCCCCAGG - Intronic
1172631569 20:36381932-36381954 GCCCAGATTCTTTGCTCTCCTGG - Intronic
1173128608 20:40364966-40364988 ACCCAAATTAATGTCTCTCTTGG - Intergenic
1175629075 20:60517505-60517527 TGCCAACTTATTTTCTGTCCTGG + Intergenic
1178272096 21:31199998-31200020 CCCCAACTTCTTGTCTCTCCAGG + Intronic
1179179903 21:39036204-39036226 TCCCACCTTCTTTTCCCTCCGGG + Intergenic
1181147597 22:20859619-20859641 CGCCAGATTATTTTCTGTCCAGG + Intronic
1181730297 22:24841368-24841390 TCCTAAGATATTCTCTCTCCTGG + Intronic
949462765 3:4311307-4311329 TCCATTATTATTTTGTCTCCAGG - Intronic
949727109 3:7061960-7061982 TCCCACATTACTCTCTCTCCTGG - Intronic
949795767 3:7849072-7849094 TAACAAATTATTTTCTCTTGAGG + Intergenic
950930322 3:16782842-16782864 TCCCAAAATACTTTGTCTTCTGG + Intergenic
951241510 3:20291170-20291192 GCCCACATTATTTTTTCTCTTGG + Intergenic
951369960 3:21833664-21833686 TTCTAAATTATTTTGTTTCCTGG - Intronic
958551132 3:95614665-95614687 TTCCAACTTATTTTTTCTTCTGG - Intergenic
958662535 3:97089084-97089106 TGCCACATTAGTGTCTCTCCTGG - Intronic
959429767 3:106238519-106238541 TCCCAAATTACATTTTCTCTGGG + Intergenic
960967299 3:123114282-123114304 TCCCCCCTTATTTTCCCTCCTGG + Intronic
962541939 3:136391293-136391315 TCCTTATTTTTTTTCTCTCCTGG - Intronic
962855055 3:139337567-139337589 TCCCAAATAACTCTCTCCCCTGG - Intronic
964018577 3:151978534-151978556 TACCAAGTCATTTTCTTTCCTGG + Intergenic
964434685 3:156639168-156639190 TCCCAAAGTATTTTCTTCTCTGG + Intergenic
964879006 3:161403001-161403023 GCCCAAATTATTTTCTCTTTTGG - Intergenic
966016472 3:175145077-175145099 TCCCAAATCCTTCTCTATCCAGG - Intronic
966503142 3:180668569-180668591 TTCCCAGTTATTTTCTCTCATGG + Intronic
966504877 3:180688254-180688276 TTCCTAGTTATTTTCTCTCATGG + Intronic
967160167 3:186729244-186729266 TGCCAAATTATTTTCTATAATGG - Intronic
967487042 3:190045059-190045081 CCTCAACGTATTTTCTCTCCTGG - Intronic
968153834 3:196361771-196361793 TCCCAAATTGTTTGGTTTCCTGG - Intronic
970931815 4:21520744-21520766 TCCTAAATTATTTTCTCAGGTGG - Intronic
972705699 4:41540418-41540440 TCTCAAATTATTCTCTCTACAGG - Intronic
972723705 4:41727016-41727038 TCCCAATTTGTTTTATCTCTGGG + Intergenic
972879840 4:43409837-43409859 TCCCAATTTATAGTCTATCCTGG - Intergenic
973848336 4:54935671-54935693 TTCCAATCTATCTTCTCTCCAGG + Intergenic
974101750 4:57424591-57424613 TTACAAGTCATTTTCTCTCCCGG - Intergenic
975507416 4:75154017-75154039 TCTCAAAATATGTTCTATCCTGG + Intergenic
975867043 4:78734713-78734735 TCTCAAATATTTTTTTCTCCAGG + Intergenic
976111463 4:81678671-81678693 CCCCAAATTAATTTTTATCCTGG - Intronic
976119288 4:81762245-81762267 TCCCAAATCTGCTTCTCTCCTGG + Intronic
976442910 4:85096776-85096798 TAGCATATTTTTTTCTCTCCTGG + Intergenic
977069754 4:92370335-92370357 TTCAAAATTGTTTTCTCTCAAGG - Intronic
977382070 4:96287893-96287915 TCCCAAAGGATTCTCTCTCTAGG + Intergenic
978606389 4:110484693-110484715 TTGAAAATTATTTTCTTTCCTGG + Intronic
979303945 4:119120668-119120690 TACCAATTTATTTTCTCACCTGG - Intergenic
979316524 4:119271484-119271506 TTGCCAGTTATTTTCTCTCCTGG - Exonic
979519353 4:121648855-121648877 TCACAGATTATTTTCTCTTTAGG - Intergenic
979611335 4:122691996-122692018 TGCCAAATGCTTTTATCTCCAGG - Intergenic
981077493 4:140605762-140605784 TCCATATTTACTTTCTCTCCAGG + Intergenic
981817245 4:148844862-148844884 GCCCAAAGTACTTTCTCCCCGGG - Intergenic
982799803 4:159690885-159690907 GCCCAAAATATTGTCTATCCTGG - Intergenic
983116709 4:163826848-163826870 TACCAAATTTTTATCTCTGCTGG - Intronic
984041387 4:174738926-174738948 TGGCAGATTATTTTCTCTCAGGG + Intronic
986679844 5:10222722-10222744 TCCCAAAGTACTTTCTCTGGTGG - Intergenic
986978975 5:13424283-13424305 TTCCAAGGCATTTTCTCTCCTGG - Intergenic
987726520 5:21707939-21707961 TTCCAAATTGTTTTCTCTATTGG + Intergenic
988342069 5:29985494-29985516 CCCCAAATTATTTTGACTCCTGG + Intergenic
989438428 5:41441472-41441494 GCCAAAATTAGTTTCTCACCTGG + Intronic
990464459 5:56058939-56058961 TTCAAAAGTATTTTCGCTCCCGG + Intergenic
990695237 5:58409000-58409022 TCCCAGATTGATTTTTCTCCTGG - Intergenic
992401080 5:76412014-76412036 TCTCCATTTTTTTTCTCTCCAGG + Intronic
993078945 5:83271798-83271820 TCCCATTTCATTTTCACTCCTGG - Intronic
996423421 5:123286818-123286840 TGCCAAATTGTTTTCTTTACGGG + Intergenic
998143243 5:139711373-139711395 GCCCAAATTATTTTCGATCCCGG - Intergenic
999259727 5:150230585-150230607 GCCCAAAATATTTGCTCTCCCGG + Intronic
1003352818 6:5334826-5334848 TCCAAAAATATTATCTCTCCAGG + Intronic
1003417527 6:5925716-5925738 TCCTAAGTTATTTCTTCTCCAGG - Intergenic
1005272862 6:24184604-24184626 TCCCAAAATATTTTGTTTTCAGG - Intronic
1007184032 6:39952281-39952303 GCCTAAAATATTTTCTCTCTGGG - Intergenic
1008138053 6:47799974-47799996 TTCTCAATTATTTTCTCTCCTGG + Intronic
1009619504 6:66054989-66055011 TTCAAATTAATTTTCTCTCCAGG + Intergenic
1009625519 6:66135674-66135696 TCCCAAATTATTTCTATTCCAGG + Intergenic
1010026240 6:71220801-71220823 TTCCAAATTATTGTGTATCCTGG - Intergenic
1010340772 6:74749779-74749801 TCCCATATTATATTTTCTTCTGG - Intergenic
1010986504 6:82431330-82431352 TCCTAAATTATCTCCTCACCTGG + Intergenic
1011451589 6:87498147-87498169 TCCCATATTCATTTATCTCCTGG - Intronic
1012717637 6:102697899-102697921 TCACAAATCTCTTTCTCTCCAGG + Intergenic
1013329072 6:109080618-109080640 TCCCAAATTGTTTTCCTTCAAGG - Intronic
1014997358 6:128166113-128166135 TACCAAATTATTTTGTCTTAAGG - Intronic
1015692507 6:135940586-135940608 ACCTAAACTACTTTCTCTCCAGG + Intronic
1016147859 6:140697880-140697902 TACCTAACTCTTTTCTCTCCAGG - Intergenic
1017376731 6:153778888-153778910 TCCCAAATTAATATCTCTTCAGG + Intergenic
1017501372 6:155026405-155026427 TCTCAATTTTTTTTCCCTCCTGG + Intronic
1017988165 6:159462833-159462855 TCCCAAATTATTTTCTCCCAGGG - Intergenic
1018363715 6:163097834-163097856 TGCCAACTTATTTTCTCTAAGGG - Intronic
1020227166 7:6289418-6289440 TCCTGCATCATTTTCTCTCCTGG + Intergenic
1020947774 7:14636091-14636113 TGCCAAAGTATTTTCTAACCAGG + Intronic
1021710209 7:23408907-23408929 TCCCCAACTATTTTCGCACCAGG + Intronic
1021842334 7:24731006-24731028 TTCTAAATTATTCTGTCTCCTGG - Intronic
1022734058 7:33059877-33059899 TCCTAAATTTATTTCTTTCCAGG + Intronic
1024295676 7:47840025-47840047 AGCTAAATTATTTTTTCTCCTGG - Intronic
1024485985 7:49920101-49920123 TCTCCTTTTATTTTCTCTCCTGG - Exonic
1025035776 7:55591726-55591748 TTCCCAATTACCTTCTCTCCAGG - Intergenic
1026469244 7:70680983-70681005 CCCTACATTTTTTTCTCTCCTGG + Intronic
1027706533 7:81540982-81541004 CCCCAAATTATATGCTCTCAAGG - Intergenic
1030459380 7:109811952-109811974 TCCCAAAATATTTTCTCCTGAGG + Intergenic
1030575575 7:111282029-111282051 TTCCCAATTATTTTCTCTTTTGG - Intronic
1030673978 7:112365750-112365772 TTTCTAATTATTTTCTGTCCAGG + Intergenic
1030883546 7:114911854-114911876 TCTCAAATTCCTTTCTCTTCAGG + Intergenic
1031652600 7:124308910-124308932 TCCAAAAATATTTTGTCTCATGG - Intergenic
1032677180 7:134141859-134141881 TCTCAAAGTACTGTCTCTCCTGG + Intronic
1032899826 7:136294730-136294752 TCCCCAAGTATTTTCAATCCAGG - Intergenic
1035584005 8:758234-758256 TCCAAAAATATTTTTTCTTCTGG + Intergenic
1041675290 8:60532320-60532342 TCCCAAATTATTTATGCTCAAGG + Intronic
1041697910 8:60756814-60756836 TGGCAAATTATTTTCTATCAAGG - Intronic
1041876341 8:62691568-62691590 TTCCAAATTTTTTTCTCACTTGG - Intronic
1042274048 8:66984987-66985009 TCCAAAATAATCTTCTCTCTTGG + Intronic
1042298560 8:67250005-67250027 TCTTAAATTATTTTCTCTTCAGG - Intronic
1042692824 8:71522325-71522347 TTCCACATTATTTTCTATGCAGG + Intronic
1042830912 8:73027550-73027572 TCCAAAATTATTTTTTCTTTAGG + Intronic
1043666301 8:82819856-82819878 TCACACATCTTTTTCTCTCCAGG + Intergenic
1044537245 8:93371350-93371372 TCCCCAATTTTTATTTCTCCTGG - Intergenic
1045673767 8:104587255-104587277 TCTCAATTTCTTCTCTCTCCTGG + Intronic
1046093076 8:109526113-109526135 TCCAATATTATTTAATCTCCAGG - Intronic
1047507385 8:125490575-125490597 TACCAGATTATTTTCTATGCTGG + Intergenic
1047725801 8:127683033-127683055 TGCCCAATTTTTTTCACTCCGGG - Intergenic
1050035562 9:1432314-1432336 GAGCAAGTTATTTTCTCTCCGGG + Intergenic
1050745582 9:8872151-8872173 GCCAAAATAATTTCCTCTCCTGG + Intronic
1050866113 9:10501612-10501634 CCCCAAGTTGTTTTCTCTCATGG - Intronic
1051903997 9:22074355-22074377 GCCCAATTTATTTTATCTGCAGG + Intergenic
1053591846 9:39522174-39522196 TTGCAAATTATTTTATTTCCTGG - Intergenic
1053849691 9:42277541-42277563 TTGCAAATTATTTTATTTCCTGG - Intergenic
1054574459 9:66843115-66843137 TTGCAAATTATTTTATTTCCTGG + Intergenic
1054982743 9:71224576-71224598 TCTCATATTTCTTTCTCTCCAGG - Intronic
1055704974 9:78988575-78988597 TCCCAGATTCTTTTGTATCCAGG - Intergenic
1056318101 9:85410641-85410663 GCCCTAAATATTTTCTCTGCTGG - Intergenic
1056637861 9:88346431-88346453 GCAAACATTATTTTCTCTCCTGG - Intergenic
1058606722 9:106731000-106731022 TCTAAAACTATTTTCTCACCTGG + Intergenic
1058695105 9:107552333-107552355 ACCCAAATAATTGTTTCTCCTGG + Intergenic
1059514455 9:114880067-114880089 TCCTTAGTTATGTTCTCTCCTGG - Intergenic
1062661719 9:137639240-137639262 TCCCGTATTATATTCTGTCCTGG + Intronic
1186203170 X:7174675-7174697 TCCCAAATTTATCCCTCTCCTGG + Intergenic
1187323176 X:18260075-18260097 TCCCTTATTATTTTATTTCCAGG + Intronic
1187907650 X:24082576-24082598 TCAAAAATTATTTCCTCTCAGGG - Intergenic
1188916509 X:35918124-35918146 TCCCTAATTTTTTACTCTCAAGG - Intergenic
1189272174 X:39759465-39759487 TCTCTAAATATTTTCTCTCCAGG + Intergenic
1189589442 X:42496105-42496127 TCCCTGATTGTTTTCGCTCCAGG + Intergenic
1190427164 X:50344749-50344771 TCCCAAATTACTATTTCACCTGG - Intronic
1191182305 X:57576655-57576677 TCCCAAGTTAGTTTCACTACAGG + Intergenic
1194128455 X:90049279-90049301 TCCCAAATTAGTTTAACACCAGG + Intergenic
1194748764 X:97660322-97660344 TCCCTCATTATTTTCTTTCAAGG - Intergenic
1194909364 X:99620809-99620831 TCCCAACTTATCATCTATCCTGG - Intergenic
1195133661 X:101880660-101880682 TCCCAAATTATCTCCACTTCTGG - Intergenic
1197151729 X:123227706-123227728 TCCCAAATTAGTTTGCCTCATGG - Intronic
1198925882 X:141794686-141794708 TACCTAATTCTTATCTCTCCAGG + Intergenic
1199800825 X:151248922-151248944 TCCCAACTAATTTTGACTCCTGG - Intergenic
1199843943 X:151677173-151677195 ACCAAAATTATTTTCCCTCTAGG - Intergenic
1200323565 X:155215283-155215305 TCCCATATACTTTTCTCTCCAGG + Intronic