ID: 1133574074

View in Genome Browser
Species Human (GRCh38)
Location 16:7070779-7070801
Sequence ATGGCTAAGGGGAAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1372
Summary {0: 1, 1: 0, 2: 3, 3: 93, 4: 1275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133574074_1133574084 -10 Left 1133574074 16:7070779-7070801 CCATCCCCCTTCCCCTTAGCCAT 0: 1
1: 0
2: 3
3: 93
4: 1275
Right 1133574084 16:7070792-7070814 CCTTAGCCATTCAGGTGGTGCGG 0: 1
1: 0
2: 0
3: 9
4: 145
1133574074_1133574087 -4 Left 1133574074 16:7070779-7070801 CCATCCCCCTTCCCCTTAGCCAT 0: 1
1: 0
2: 3
3: 93
4: 1275
Right 1133574087 16:7070798-7070820 CCATTCAGGTGGTGCGGATTGGG 0: 1
1: 0
2: 3
3: 5
4: 70
1133574074_1133574088 3 Left 1133574074 16:7070779-7070801 CCATCCCCCTTCCCCTTAGCCAT 0: 1
1: 0
2: 3
3: 93
4: 1275
Right 1133574088 16:7070805-7070827 GGTGGTGCGGATTGGGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1133574074_1133574085 -5 Left 1133574074 16:7070779-7070801 CCATCCCCCTTCCCCTTAGCCAT 0: 1
1: 0
2: 3
3: 93
4: 1275
Right 1133574085 16:7070797-7070819 GCCATTCAGGTGGTGCGGATTGG 0: 1
1: 0
2: 1
3: 11
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133574074 Original CRISPR ATGGCTAAGGGGAAGGGGGA TGG (reversed) Intronic
900615125 1:3562057-3562079 AAGGGTAAGGGGTAGGGGTAGGG + Intronic
900808993 1:4786947-4786969 ATGGCTTTGTGGAAGGGGCAGGG - Exonic
901266443 1:7914239-7914261 ACGGGGAGGGGGAAGGGGGAGGG - Intergenic
901363255 1:8722256-8722278 ATAGCCAAGGGGAAGGTAGATGG - Intronic
901395904 1:8981403-8981425 AAGGGGAAGGGGAAGGGGAAAGG - Intergenic
901395906 1:8981409-8981431 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
901953123 1:12764174-12764196 ATGGTCAAGGGGCAGGGGCAGGG + Intergenic
902192024 1:14770443-14770465 AGGGATGAGGGCAAGGGGGATGG + Intronic
902216144 1:14935683-14935705 AGGGAGAAGGGGAAGGGAGAGGG - Intronic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
902905965 1:19557747-19557769 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
902906004 1:19557855-19557877 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903019995 1:20387044-20387066 AGGGCTGAGGGGGAGGAGGAAGG + Intergenic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
904024214 1:27492019-27492041 AATGCTAAGGGGATGGGTGAGGG - Intergenic
904036996 1:27564275-27564297 TTGGCTTCGGGGAGGGGGGAAGG + Intronic
904172780 1:28603172-28603194 AGGGAAAAGGGGAAGGGAGAAGG + Exonic
904190358 1:28737997-28738019 ATGGGGGAGGGGAAGCGGGAGGG + Intronic
904352438 1:29917412-29917434 AGGGGGAAGGGGAAGGGGAAGGG - Intergenic
904599115 1:31664159-31664181 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
904599118 1:31664165-31664187 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
904599121 1:31664171-31664193 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
904599124 1:31664177-31664199 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
904610450 1:31723161-31723183 AGGGGTAAGGGTAAGGGTGAGGG + Intergenic
905334676 1:37236296-37236318 ATAGCTAAAGGGGAGGGTGAGGG + Intergenic
905337032 1:37251878-37251900 ATGTCTCAGGGGAAGGGGCCTGG + Intergenic
905793204 1:40801168-40801190 CTGGCTGGGGGGAAGGGGAATGG + Intronic
905827878 1:41040398-41040420 ATGGCAAAGGGGAAAGGCAACGG + Intronic
906114548 1:43348041-43348063 ATGAGTAAGGGGAAGGGATAAGG - Intronic
906238394 1:44226074-44226096 AGGTCTTAGGGGATGGGGGAGGG + Intronic
906427777 1:45727433-45727455 AAGGGCAAGGGGAAGGGGAAGGG - Intronic
906500882 1:46341258-46341280 ATGGGCAAGGGAAAGGGGGAGGG - Intronic
906851125 1:49251359-49251381 ATGGCTATGAGCAAGGGAGAGGG - Intronic
906940671 1:50252524-50252546 CTGGATAATGGGGAGGGGGAAGG + Intergenic
907621288 1:55983449-55983471 AAGGCGAAGGGGAAGGGGAAGGG + Intergenic
907621291 1:55983455-55983477 AAGGGGAAGGGGAAGGGGCAGGG + Intergenic
908252476 1:62275894-62275916 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
908528243 1:65008616-65008638 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
908528246 1:65008622-65008644 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
908528249 1:65008628-65008650 AAGGCGAAGGGGAAGGGGAAGGG - Intergenic
908544393 1:65148891-65148913 AGGGCTAAGGGGTACGGGGACGG - Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908728239 1:67199326-67199348 ATCGCAATGGGGTAGGGGGAAGG - Intronic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
909501098 1:76336790-76336812 ATGGCCAAGGGCAAAGGGCAAGG + Intronic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
911045963 1:93628564-93628586 ATGTCTAAGGGGAAGAAGAAGGG - Intronic
911308528 1:96262251-96262273 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
911620905 1:100065670-100065692 AAGGAAAAGGGGAAAGGGGAAGG - Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
912798139 1:112705165-112705187 AAGGCTGTTGGGAAGGGGGAGGG + Exonic
913181904 1:116330396-116330418 ATGGCTAAGCGGTGTGGGGAGGG + Intergenic
913203731 1:116517040-116517062 AGGGCCACGGGGAAAGGGGATGG - Intronic
913248113 1:116888125-116888147 AGGGATAAGGGGAAGGGGAGGGG + Intergenic
913323714 1:117607781-117607803 GTGGAAAAGGGGGAGGGGGATGG + Intronic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
913412024 1:118562607-118562629 ATGAATAAGGGGGAGGGGGAAGG + Intergenic
913596375 1:120381937-120381959 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
914090895 1:144497038-144497060 TTGGGTAGGGGGAGGGGGGAGGG - Intergenic
914307708 1:146437169-146437191 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
914463407 1:147905808-147905830 ATGGGTAATGGAGAGGGGGAAGG - Intergenic
915345487 1:155195042-155195064 ATGGCAAGGGGGAGGGGGGAGGG - Intergenic
915360463 1:155283547-155283569 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
915459154 1:156059482-156059504 ATGGCACTGGGGAAGGGGGCTGG - Intergenic
915775921 1:158486148-158486170 ATGGTTGAGGGGCAGGGGAAGGG - Intergenic
915882527 1:159687137-159687159 CTGGCCAAGGGGAAGGGCCATGG - Intergenic
915911456 1:159918197-159918219 GTGGCTAAGGGGTGGGGTGAGGG - Exonic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
916646940 1:166796245-166796267 ATGGCTGATGGGAAGGGACAGGG - Intergenic
916768789 1:167887545-167887567 TGGGCTGGGGGGAAGGGGGAGGG + Intronic
917364608 1:174216164-174216186 ATGGGTAAGGGACATGGGGATGG + Intronic
917954897 1:180085097-180085119 AAGGGAAAGGGGAAAGGGGAAGG - Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918817513 1:189208593-189208615 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919002639 1:191853386-191853408 ATGGGTTGGGGGAGGGGGGAGGG - Intergenic
919016770 1:192048516-192048538 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
919814838 1:201430827-201430849 ATGGCTAAGGGTACAGGGAAAGG + Intergenic
919840503 1:201605781-201605803 AGGGCTAAGGAGAGGGGGAATGG + Intergenic
920230190 1:204465165-204465187 AGGGCTATGGGGGATGGGGAGGG - Intronic
920311736 1:205052657-205052679 ACAGCTGAGGGGAAGGGGCAGGG + Intronic
920330234 1:205202083-205202105 AGGGAGAAGGGGAAGGGAGAGGG + Intronic
920330256 1:205202131-205202153 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
920441111 1:205980865-205980887 GAGGTGAAGGGGAAGGGGGAGGG - Intronic
920748006 1:208647195-208647217 AGGGGGAAGGGGAAGGGAGAGGG - Intergenic
920863619 1:209732739-209732761 TTGGGTGGGGGGAAGGGGGAGGG - Intronic
920924804 1:210330766-210330788 ATGGACTGGGGGAAGGGGGATGG + Intronic
921218457 1:212956317-212956339 AGGGCTAGGGGGCAGGAGGAGGG - Intronic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922014831 1:221634711-221634733 ATAGCCAAGGAGAAGGGTGAAGG + Intergenic
922110161 1:222548241-222548263 ATGGGTTGGGGGAGGGGGGAAGG - Intergenic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
922402787 1:225277118-225277140 AGGGGGACGGGGAAGGGGGAAGG + Intronic
923072431 1:230577877-230577899 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
923401841 1:233623281-233623303 AAGGGTACGGGGAGGGGGGATGG + Intronic
923482471 1:234397500-234397522 AGGGGGAGGGGGAAGGGGGATGG + Intronic
923902048 1:238336582-238336604 ATGGCATTGGAGAAGGGGGATGG + Intergenic
924262902 1:242250392-242250414 AAGGTGAAGGGGAATGGGGAAGG + Intronic
1062767175 10:74702-74724 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1062833815 10:623519-623541 AAGGCCAAGGGGAAGAGGGGAGG + Intronic
1062833901 10:623745-623767 AGGGCCAAGGGGAAGAGGGGAGG + Intronic
1062911123 10:1213012-1213034 AAGGCTTTGGGGAAGAGGGAGGG + Intronic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063219590 10:3954371-3954393 GTGGGTAGGGGGCAGGGGGAGGG + Intergenic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1064595717 10:16942838-16942860 AGGGGGAAGGGGAAGGGGAAGGG + Intronic
1064595739 10:16942896-16942918 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
1065031379 10:21589903-21589925 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1065154304 10:22853673-22853695 ATGGCAGAGGGGAAGGGGTTGGG + Intergenic
1065368700 10:24960042-24960064 ATGGGAAAGGGGGTGGGGGATGG - Intergenic
1065515415 10:26519396-26519418 ATGGCAGAGGGTAAAGGGGAAGG + Intronic
1065796370 10:29311960-29311982 AAAGGGAAGGGGAAGGGGGAGGG + Intronic
1066023395 10:31325648-31325670 ATGGGGGAGGGGAAGGGAGAGGG - Intronic
1066211507 10:33243876-33243898 ATGGCTAAGGGAGGGAGGGAGGG + Intronic
1066334636 10:34463219-34463241 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
1066721884 10:38348062-38348084 AAGGTGAAGGGGAATGGGGAAGG - Intergenic
1066934935 10:41817586-41817608 TGGGGTTAGGGGAAGGGGGAGGG - Intergenic
1067338166 10:45380558-45380580 ATGGCAAAGTGGAAGGGGCGAGG - Intronic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1067364004 10:45608124-45608146 AGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1067549986 10:47227442-47227464 ATGGCTAAGAGGTGGGGTGAGGG - Intergenic
1067832305 10:49617177-49617199 GGGGGAAAGGGGAAGGGGGAAGG - Intronic
1067836264 10:49643712-49643734 CTGGCTAATGGGAAGGGGAAAGG - Intronic
1069177986 10:65318336-65318358 ATGAATAATGGGAAAGGGGAAGG + Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069695154 10:70380950-70380972 ATGGCCAGGGGGAAGGGACAGGG + Intronic
1069860814 10:71470446-71470468 ATTGCTAGGGGGTAGGAGGAAGG - Intronic
1070016429 10:72537062-72537084 ATGGTGAGGGGGAAGGGGCATGG + Intronic
1070025231 10:72625942-72625964 AAGGCGAAGGGGAAGGGGGTTGG - Intronic
1070411195 10:76142832-76142854 TTGGGTAGGGGGAGGGGGGAAGG - Intronic
1070613408 10:77950128-77950150 TCTGCTAAGGGGAAGGGAGAGGG - Intergenic
1070624892 10:78043961-78043983 ATGCCTATGTGGAAGGGAGAGGG - Intronic
1070721346 10:78759411-78759433 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1070721349 10:78759417-78759439 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1070721352 10:78759423-78759445 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1070721355 10:78759429-78759451 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1070721358 10:78759435-78759457 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1071132448 10:82410530-82410552 GTGGCTAAGGGGTGGAGGGAAGG + Intronic
1071164163 10:82785204-82785226 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1071231951 10:83598225-83598247 ATAGCTAAGGGGAAGGATGTGGG - Intergenic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1073048549 10:100653995-100654017 CTTGCTAAGGGGGAGGGAGAAGG - Intergenic
1073249109 10:102111044-102111066 ATGGCCAAGGGAAAAGGGGCTGG - Intronic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1073592141 10:104767654-104767676 GTGGAGAAGGGGAAGGGGAACGG - Intronic
1073930044 10:108565530-108565552 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1073930047 10:108565536-108565558 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1074326393 10:112455346-112455368 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
1074339934 10:112618599-112618621 TTGGCCTAGGGGAAGGAGGAAGG + Intronic
1074416357 10:113270334-113270356 GTGGCTGAGGGGAAGGGAGAAGG + Intergenic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074696122 10:116051502-116051524 ATGCCACAGGGGAAGGGGGCTGG + Intergenic
1074750254 10:116578956-116578978 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1074924444 10:118053178-118053200 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1074984117 10:118642217-118642239 ACTGCTAAGAGGAAGGGAGATGG + Intergenic
1075013136 10:118891814-118891836 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1075201382 10:120407258-120407280 ATGGCTAAGGGGAAGTTGAGTGG + Intergenic
1075284506 10:121171845-121171867 AGGGAGAAGGGGAAGGGGAAAGG + Intergenic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1076666801 10:132097888-132097910 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1076666804 10:132097894-132097916 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1076666807 10:132097900-132097922 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1076666820 10:132097929-132097951 ATGGGAAAGGGAAAGGGGAAGGG - Intergenic
1076666837 10:132097978-132098000 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077632092 11:3817639-3817661 AGGGACAAGGGGATGGGGGAAGG + Intronic
1077806587 11:5596540-5596562 AGGGGAAGGGGGAAGGGGGAAGG - Intronic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1078127324 11:8580487-8580509 AGGGGGAAGGGGGAGGGGGATGG + Intronic
1078267685 11:9767037-9767059 ATGGCGAAGGGGGACTGGGAGGG - Intergenic
1078362569 11:10680537-10680559 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1078362572 11:10680543-10680565 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1078362575 11:10680549-10680571 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1078384114 11:10872763-10872785 AGGGGTAAGGGGAAGGGGAAGGG - Intergenic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078493893 11:11796929-11796951 TTGGGTAGGGGGCAGGGGGAGGG - Intergenic
1079206155 11:18416723-18416745 ACGGAGAAGGGAAAGGGGGAAGG - Intronic
1079269580 11:18971787-18971809 ATGCCTGAGGTGAAGGTGGAGGG - Intergenic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1080286087 11:30614354-30614376 TTTGCTAGGGGTAAGGGGGAGGG - Intergenic
1080405145 11:31972030-31972052 ACGGGAAAGGGGGAGGGGGAGGG + Intronic
1080438550 11:32268940-32268962 AATGGGAAGGGGAAGGGGGAGGG + Intergenic
1080741194 11:35065951-35065973 ATGGAAAAGGGGATGGGGCAAGG - Intergenic
1081155472 11:39684415-39684437 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1081312147 11:41587177-41587199 ACAGCTGAGGGTAAGGGGGAGGG + Intergenic
1081810511 11:45911435-45911457 TTGGTTCAGGGGAAGGGGCAAGG + Intronic
1081813132 11:45924291-45924313 ACAGCTGAGGGGAGGGGGGAAGG - Intronic
1081875203 11:46403833-46403855 AGGGCCAAGGGGAGTGGGGAGGG + Intronic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1082196797 11:49316251-49316273 AAGGAGAAGGGGAAGGGGTAAGG + Intergenic
1082196804 11:49316264-49316286 AGGGGTAAGGGGAAGGGGAAGGG + Intergenic
1082244427 11:49905182-49905204 AAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1082626132 11:55488452-55488474 GGGGCTAAGGGGAAGGGATAAGG - Intergenic
1082895345 11:58184151-58184173 ATGGCTAAGGCCAAGGAAGATGG + Intergenic
1082940895 11:58703999-58704021 AAGTCTCAGGGGAAGGGGAAGGG - Intronic
1083300927 11:61739331-61739353 ATGGCAAAGGGGCAGGGGAAGGG - Intronic
1083460001 11:62805091-62805113 ATGGCTCGGGGGTAGGGTGACGG - Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1084569913 11:69953131-69953153 ATGGGGAAGGGGGAGAGGGACGG + Intergenic
1084740976 11:71139352-71139374 AGGGGTAGGGGGAGGGGGGAGGG + Intronic
1084942957 11:72623648-72623670 ATGGGCAAAGGCAAGGGGGAGGG - Intronic
1085041819 11:73331249-73331271 ATGGGTAAGGGCTAGGGGTATGG - Intronic
1085182630 11:74548538-74548560 ATGGTTAGGGAGAAGAGGGAGGG + Intronic
1086001560 11:81990909-81990931 ACGGCTGGGGGGAAGGGGCAGGG + Intergenic
1086518765 11:87646102-87646124 AGGGGGAAAGGGAAGGGGGAAGG - Intergenic
1086629535 11:89000088-89000110 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
1086659021 11:89391922-89391944 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1086659024 11:89391928-89391950 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1086659027 11:89391934-89391956 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1087429785 11:98038365-98038387 GTGCACAAGGGGAAGGGGGAAGG + Intergenic
1087460479 11:98439401-98439423 AAGGCTAGTGGGAAGGGGGCAGG - Intergenic
1088155751 11:106800738-106800760 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1088339300 11:108745059-108745081 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088758870 11:112910534-112910556 AAGGTAAAGGGGAAGTGGGAGGG - Intergenic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089074173 11:115724774-115724796 ATGGCCAAGGGGAAGATGGGAGG - Intergenic
1090029315 11:123194368-123194390 AAGGAAAAGGGGAAAGGGGAAGG - Intronic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1090249572 11:125241989-125242011 ATGGTGAAGGTGGAGGGGGATGG + Intronic
1090333918 11:125950478-125950500 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1090391774 11:126393460-126393482 ATGGCTCAGGAGGAGGGGGATGG + Intronic
1090505390 11:127306929-127306951 AGGGGGAAGGGGAAGGGGAAAGG - Intergenic
1090777278 11:129976352-129976374 ATGGCCAAGGGGAAGAGAGTAGG + Intronic
1090848696 11:130551554-130551576 AAGGCCAAGGGAAAGGGGAAGGG + Intergenic
1091014424 11:132037301-132037323 ATGGCTGAGGTGAAGGGAGCCGG - Intronic
1091076268 11:132620511-132620533 AAGGCTAAGGGGAATCAGGAAGG + Intronic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091493568 12:952958-952980 AGGGAAAAGGGGAAGGGGAAGGG + Intronic
1092119749 12:6035582-6035604 ATGGCCAAGGAAAAGGGAGAAGG + Intronic
1092237422 12:6818943-6818965 AGGGGAAAGGGGGAGGGGGAGGG + Intronic
1092322808 12:7496327-7496349 ATGGGTGGGGGGAAAGGGGAGGG + Intronic
1092334292 12:7614991-7615013 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1092468785 12:8760086-8760108 GTGGGGTAGGGGAAGGGGGAGGG - Intronic
1092620905 12:10267074-10267096 AAGGCTACTGGGAGGGGGGAGGG - Intergenic
1092844861 12:12574778-12574800 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093459225 12:19393271-19393293 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093534816 12:20210275-20210297 AGGGGAGAGGGGAAGGGGGAAGG - Intergenic
1093591523 12:20907461-20907483 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1094047377 12:26182558-26182580 AAGGGGAAGGGGAAGGGAGACGG - Intronic
1094047378 12:26182564-26182586 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094259726 12:28479464-28479486 TGGGGTAGGGGGAAGGGGGAAGG + Intronic
1094339160 12:29391185-29391207 ATGGTTTAGAGGAAGTGGGAGGG + Intergenic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1094731354 12:33179867-33179889 TTTGCACAGGGGAAGGGGGAGGG - Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095376418 12:41534437-41534459 AGGAGTGAGGGGAAGGGGGAAGG - Intronic
1095457275 12:42401501-42401523 GTGGCCATGGGGAGGGGGGAGGG + Intronic
1095583729 12:43828679-43828701 ATCGGTAAGGGGATGGGGGCAGG - Intergenic
1095646209 12:44550858-44550880 GAGGTTAAGGGGAAAGGGGAAGG + Intronic
1095662282 12:44751185-44751207 CAGACTAAGTGGAAGGGGGAAGG + Intronic
1095727474 12:45469373-45469395 ATTCCTAGGCGGAAGGGGGAAGG + Intergenic
1095770608 12:45952201-45952223 GTGGCTGAGGGGAGGGGTGAAGG - Intronic
1096352364 12:50911123-50911145 ATGGCTAAGAGGAGGAGAGAGGG - Intergenic
1096740732 12:53692216-53692238 ATGACTAAAAGGAAGGGGGTGGG + Intergenic
1096750262 12:53754117-53754139 ATGGATAATGGGAAGATGGAAGG + Intergenic
1096884007 12:54698894-54698916 GTGGGGAAGGGGGAGGGGGAGGG - Intergenic
1098219358 12:68252402-68252424 CTAGCTTAGGGGTAGGGGGAAGG + Intronic
1098761217 12:74427677-74427699 AGGGGTAGGGGGAAAGGGGAGGG - Intergenic
1099072549 12:78064112-78064134 ATGGCAGTGGGGAAGGGGGCTGG + Intronic
1099662464 12:85581875-85581897 ATGTGTAAGTGAAAGGGGGAAGG - Intergenic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1101441858 12:104709743-104709765 GTTGCTTAGGGGTAGGGGGATGG + Intronic
1101703916 12:107202322-107202344 ATGGCATAAAGGAAGGGGGAAGG + Intergenic
1101729199 12:107412784-107412806 ATGGGTAGGGTGGAGGGGGAGGG - Intronic
1101746718 12:107547210-107547232 AAGGAGAAGGGGGAGGGGGAGGG + Intronic
1101993718 12:109509413-109509435 AGGGGTAGGGGGAAAGGGGAGGG - Intronic
1102166744 12:110812994-110813016 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102408773 12:112698861-112698883 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1102625633 12:114233259-114233281 AGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103371566 12:120423311-120423333 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1103371569 12:120423317-120423339 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1103371572 12:120423323-120423345 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103472988 12:121196844-121196866 ATGGACAAGGGGAGGGGGAATGG - Intergenic
1104081416 12:125433661-125433683 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1104218448 12:126758113-126758135 ATGGTAAGGGGGAAGGGGCAGGG + Intergenic
1104224307 12:126816365-126816387 AAGGGTGAGGGGATGGGGGAGGG - Intergenic
1104550963 12:129756950-129756972 AAGGCTAACAGGAAGAGGGAGGG - Intronic
1105337152 13:19483919-19483941 TTGGGTAGGGGGAGGGGGGAGGG - Intronic
1105457135 13:20551424-20551446 ATGAGTAAGAGGAAGGGAGATGG + Intergenic
1105596298 13:21842546-21842568 GTGGTTAGGGGGAAGGGGGATGG + Intergenic
1105949156 13:25213965-25213987 ATGGCTCAGAGTCAGGGGGAGGG + Intergenic
1106188300 13:27427661-27427683 AAAGCTAGGGGGTAGGGGGAGGG + Intronic
1106675894 13:31957653-31957675 AGGGGGAAGGGGAAGGGGAAGGG + Intergenic
1106704603 13:32267204-32267226 ATGGCTGAGAAGAAGGGCGAGGG - Exonic
1106720746 13:32432362-32432384 GGGGCTGAGGGGAAGGGGGAAGG + Intergenic
1106720750 13:32432369-32432391 AGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1106771509 13:32965272-32965294 AAGGGGAAGGGGAAGGGGAAAGG - Intergenic
1106771511 13:32965278-32965300 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1107158134 13:37193685-37193707 ATGGAAAAGGGCATGGGGGATGG + Intergenic
1107610018 13:42103684-42103706 ATTGCTAATGGCAAGGGGAAAGG + Intronic
1107795451 13:44046897-44046919 AAGGAGAAGGGGAAGGGGAAAGG - Intergenic
1107795460 13:44046921-44046943 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1107986115 13:45777784-45777806 ATTTCTAAGGGAAAGGGGAAGGG - Exonic
1108492365 13:50994216-50994238 AAGGCGGAGGGGGAGGGGGAGGG - Intergenic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1109569950 13:64174761-64174783 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1110553488 13:76832348-76832370 ATGGATAAGTGGAAGAGAGAAGG - Intergenic
1110682961 13:78337722-78337744 ATGGGGGAGGGGGAGGGGGAAGG + Intergenic
1111605183 13:90529186-90529208 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1111733894 13:92112856-92112878 ATAGCTAAGGAGAAAGGAGAAGG + Intronic
1111994441 13:95150490-95150512 CTGGCAGTGGGGAAGGGGGAGGG - Intronic
1112015171 13:95325564-95325586 AGGGGAAAGGGAAAGGGGGAAGG + Intergenic
1112015175 13:95325571-95325593 AGGGAAAGGGGGAAGGGGGAAGG + Intergenic
1112015736 13:95330045-95330067 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1112420888 13:99247585-99247607 ATGGGTAAGGGGCAAGGGGAGGG + Intronic
1112724505 13:102286978-102287000 ATGGGGGAGGGGGAGGGGGAGGG + Intronic
1112912995 13:104511751-104511773 ATAGGTCAGGGGAAGGGGGAGGG - Intergenic
1113074389 13:106453452-106453474 GTGGCAACGGGGAAGGGAGAAGG + Intergenic
1113159591 13:107364972-107364994 AGGGGGATGGGGAAGGGGGAGGG - Intronic
1113767266 13:112889172-112889194 AGGGCTCAGGGGACGGGGCAAGG + Intergenic
1114224587 14:20725962-20725984 AAGGGGAAGGGGAAGGGGAACGG + Intergenic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1114382656 14:22224397-22224419 ATGGGAATGGGGAAGGGAGAAGG - Intergenic
1114547660 14:23514241-23514263 ATGCCTAAGAGGGAAGGGGAAGG - Intergenic
1114566828 14:23639267-23639289 ATGGCCAAGCTGCAGGGGGAGGG + Exonic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1114909352 14:27171053-27171075 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1115529356 14:34312790-34312812 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1115529359 14:34312796-34312818 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1115860558 14:37681628-37681650 ATGTCTGAGGGCAGGGGGGATGG - Intronic
1116281174 14:42910189-42910211 ATGGGGTAGGGGGAGGGGGAGGG - Intergenic
1116604326 14:46969784-46969806 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1116707973 14:48327719-48327741 GGGGGTAAGGGGAGGGGGGAGGG - Intergenic
1117010798 14:51468297-51468319 ATGGGAGAGGGGGAGGGGGAGGG + Intergenic
1117031829 14:51679953-51679975 ATGCCAAAGAAGAAGGGGGAAGG + Intronic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1117993033 14:61453629-61453651 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1118076933 14:62309544-62309566 TTTGCTAAGGGGAAGGAGGGGGG + Intergenic
1118244835 14:64099891-64099913 GTGGGTTAGGGGGAGGGGGAAGG - Intronic
1118798917 14:69171553-69171575 AAGGCTAAGGGCAAGGGCGTGGG - Intergenic
1119387798 14:74268692-74268714 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1119852315 14:77874901-77874923 ATGGTTAAGGGACAGGTGGATGG + Intronic
1119872275 14:78028045-78028067 ATCCCCAAGGGGAAGGGAGAGGG - Intergenic
1120281447 14:82443651-82443673 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1120281450 14:82443657-82443679 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1120281453 14:82443663-82443685 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1120505228 14:85347486-85347508 ATAGCAAGGGGGAAGGGGGAAGG + Intergenic
1120540852 14:85748552-85748574 GTGGCTAGGGGGAAGGGAAAAGG + Intergenic
1121159668 14:91726059-91726081 ATGGCTACCTAGAAGGGGGATGG - Intronic
1121586991 14:95069231-95069253 ATGGCTAAGGGAGACAGGGAAGG + Intergenic
1121593272 14:95137186-95137208 AAGGAAAAGGGGAAGGGGAAAGG + Intronic
1121593313 14:95137328-95137350 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
1121593385 14:95137555-95137577 ATGGAGAAGGGGAAGGGAAAGGG + Intronic
1121593390 14:95137567-95137589 AAGGGAAAGGGGAAGGGGAAAGG + Intronic
1122114225 14:99519893-99519915 GTGGCTGGGAGGAAGGGGGACGG + Intronic
1122464062 14:101918486-101918508 AAGGCTGAGGGGTGGGGGGAGGG - Intronic
1122464093 14:101918554-101918576 AAGGCTGAGGGGTGGGGGGAGGG - Intronic
1122593348 14:102871229-102871251 ATGGAGAAGGGGGAGGGTGAAGG - Intronic
1122881591 14:104692801-104692823 ATGGCCAAGGGCAAGGGCCAAGG + Intronic
1124240690 15:28025458-28025480 ATGGGTAATGGTAAGGGGGCCGG - Intronic
1124719372 15:32098292-32098314 AAGGCTGTGGGGAAAGGGGAGGG + Intronic
1124849820 15:33325682-33325704 AGGGGAAGGGGGAAGGGGGAAGG - Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1126101917 15:45123191-45123213 ATGGCTGAGGGGCAGTGGAACGG - Intronic
1126123733 15:45276330-45276352 TGGGGTGAGGGGAAGGGGGAGGG + Exonic
1126554745 15:49973174-49973196 ACAGATCAGGGGAAGGGGGATGG + Intronic
1127027976 15:54829136-54829158 ATAGCTAAGGGGACAGGAGAAGG + Intergenic
1127810328 15:62560088-62560110 ATGGCTTCGGGAAAGTGGGAAGG + Intronic
1127863735 15:63014842-63014864 AGGGGTCAGGGAAAGGGGGATGG + Intergenic
1127948995 15:63785786-63785808 AAGGAAAAGGGGAAGGGGAAGGG + Intronic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1127980764 15:64033264-64033286 AGGGGGAGGGGGAAGGGGGAAGG + Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129044981 15:72725982-72726004 AGGGGAAAGGGGAAGGGAGATGG - Intronic
1129145885 15:73646811-73646833 ATGGAGGAGGGGGAGGGGGAGGG + Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129332049 15:74832726-74832748 AGGGCTGATGGGGAGGGGGAAGG - Intergenic
1129446883 15:75625236-75625258 AGGGGGAAGGGGATGGGGGAGGG - Intronic
1130171632 15:81520571-81520593 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1130171635 15:81520577-81520599 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1130296378 15:82649106-82649128 ATGGCTAAGGGGAGAGGGACAGG + Intergenic
1130555612 15:84920464-84920486 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1130555615 15:84920470-84920492 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1130691980 15:86089625-86089647 ATTGGTCAGGGGAAGGGTGAGGG - Intergenic
1130702994 15:86204487-86204509 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1130702997 15:86204493-86204515 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1130703000 15:86204499-86204521 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1130746257 15:86657144-86657166 AAGGCTTAGTGGAAGGGGCATGG - Intronic
1130848856 15:87773877-87773899 AGGGCTAGGGGGCAAGGGGAGGG + Intergenic
1130959887 15:88652529-88652551 AGGGCAAAGGGGGAGGGGAAGGG - Intronic
1130985631 15:88842796-88842818 AGGGGTAAGGGTAAGGGGTAAGG - Intronic
1131089853 15:89615424-89615446 AGGGCTAGGGGGAAGGGGCAGGG + Intronic
1131342220 15:91613108-91613130 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1131378267 15:91943234-91943256 AGGGCTGAGGGGAGGGGGAATGG - Intronic
1131641573 15:94299029-94299051 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131690679 15:94824283-94824305 ATGGCTAAGGATTAGAGGGAAGG - Intergenic
1131694332 15:94859054-94859076 GTGGCACAGGGGAATGGGGATGG - Intergenic
1131736616 15:95339398-95339420 ATGGAAAAGAGGGAGGGGGAAGG + Intergenic
1131807836 15:96141492-96141514 ATGGCTGAGACAAAGGGGGAAGG + Intergenic
1132325765 15:100968792-100968814 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1132744626 16:1431567-1431589 AGGGCTTTGGGGATGGGGGAGGG - Intergenic
1132854388 16:2038413-2038435 AAGGGGGAGGGGAAGGGGGAGGG - Exonic
1132868257 16:2104311-2104333 ATGGTAATAGGGAAGGGGGAGGG + Intronic
1133051666 16:3120450-3120472 ATGGCGATGGGGGAGGGCGAGGG + Exonic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133813201 16:9177267-9177289 ATGGGAAAGGGGAAGGGGAGAGG - Intergenic
1133816313 16:9200010-9200032 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1133929153 16:10218102-10218124 ATGGATAGAAGGAAGGGGGAAGG - Intergenic
1134293166 16:12920171-12920193 GTGGGTACGGGGAGGGGGGAGGG + Intronic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134352619 16:13451929-13451951 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1134433208 16:14231133-14231155 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1134449404 16:14354232-14354254 AGGGGGAGGGGGAAGGGGGAAGG + Intergenic
1134493368 16:14712391-14712413 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134498749 16:14751515-14751537 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134523509 16:14928786-14928808 ATGGTAATAGGGAAGGGGGAGGG - Intronic
1134525302 16:14938144-14938166 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134547592 16:15122764-15122786 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1134549383 16:15132134-15132156 ATGGTAATAGGGAAGGGGGAGGG + Intronic
1134711103 16:16327270-16327292 ATGGTAATAGGGAAGGGGGAGGG - Intergenic
1134712890 16:16336628-16336650 GTGGCTTAGGGCAGGGGGGAGGG - Intergenic
1134720756 16:16379946-16379968 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134770600 16:16806037-16806059 AGGGGGAAGGGGAAGGGAGAAGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134770624 16:16806093-16806115 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1134770627 16:16806099-16806121 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1134946671 16:18331939-18331961 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1134948471 16:18341313-18341335 ATGGTAATAGGGAAGGGGGAGGG + Intergenic
1134953930 16:18372054-18372076 GTGGCTTAGGGCAGGGGGGAGGG + Intergenic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1135047609 16:19168198-19168220 ATGGGAATGGGGAAGGGGGTGGG - Intronic
1135077714 16:19408692-19408714 ATGGCTTAGAGAAAGGAGGAGGG - Intergenic
1135149881 16:19996182-19996204 ATGGCTAGGGTGCAGAGGGAAGG - Intergenic
1135284222 16:21179620-21179642 ATGGCTTAGAAGAAGGGGGCTGG + Exonic
1135312753 16:21418932-21418954 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1135365670 16:21851202-21851224 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1135446138 16:22519950-22519972 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1135667939 16:24351589-24351611 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1135667942 16:24351595-24351617 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1136151896 16:28356650-28356672 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136168131 16:28470487-28470509 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136174231 16:28506534-28506556 TTGGCTAGTGGGAATGGGGAGGG - Intronic
1136194841 16:28644519-28644541 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1136211183 16:28758633-28758655 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1136255903 16:29038584-29038606 GTGGCTTAGGGCAGGGGGGAGGG - Exonic
1136309429 16:29397691-29397713 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136322871 16:29499447-29499469 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136437555 16:30239415-30239437 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136628510 16:31476291-31476313 ATTGCCAAGGGGAAGGGGTAGGG - Intronic
1137232401 16:46578290-46578312 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1137460912 16:48662489-48662511 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1137689704 16:50414402-50414424 AAGGGGAAGGGGAAGGGGAAAGG - Intergenic
1137689706 16:50414408-50414430 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1138108531 16:54305124-54305146 AGGGCGAAGGGGAAGGGGCAGGG - Intergenic
1138458804 16:57135954-57135976 AAGGGGAAGGGGAAGGGAGAAGG + Intronic
1138579411 16:57930558-57930580 AAGGAGGAGGGGAAGGGGGAGGG + Intronic
1138891913 16:61154038-61154060 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1139857120 16:69990079-69990101 GTGGCTTAGGGCAGGGGGGAGGG + Intergenic
1140365592 16:74377903-74377925 GTGGCTTAGGGCAGGGGGGAGGG - Exonic
1140859253 16:79004993-79005015 ATGAAAAAGGGGAAGGGAGAGGG + Intronic
1140946272 16:79770871-79770893 GTTGCAAAGGGAAAGGGGGAGGG - Intergenic
1142251721 16:88994963-88994985 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1142333629 16:89472366-89472388 TTTACTAAGGGGAAGGGGAAGGG + Intronic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1142388823 16:89784713-89784735 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1143005160 17:3827070-3827092 AAGGGTAGGGGGAAAGGGGAAGG + Intronic
1143005164 17:3827077-3827099 GGGGGAAAGGGGAAGGGGGAAGG + Intronic
1143617861 17:8064275-8064297 ATGGGTCAGGGGAGGGGGGCTGG + Intergenic
1144059393 17:11568900-11568922 ATGGCAAAAGGAAAGGGGGGTGG - Intergenic
1144273535 17:13643179-13643201 GGGGTTAAGGTGAAGGGGGAGGG - Intergenic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1144582361 17:16466150-16466172 CTGGCTTAGGGGAGGGGGGATGG - Intronic
1144591533 17:16528319-16528341 ATGGGTAATGAGAAAGGGGAGGG + Intergenic
1144746812 17:17621466-17621488 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1146376079 17:32295460-32295482 AGGGCTAAGGAGCAGCGGGATGG + Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146910285 17:36644154-36644176 AGGGCTAGGGGGGAGGGGGCAGG - Intergenic
1146930095 17:36770873-36770895 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1146930098 17:36770879-36770901 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1147301872 17:39535869-39535891 AGGGCTAAGTGGAATGGGAATGG + Intronic
1147359256 17:39920993-39921015 AAGGCTGAGGGGAGGGGGCAGGG - Intergenic
1147374640 17:40016360-40016382 AAGGCTAATGAGGAGGGGGAAGG + Intronic
1147574902 17:41593431-41593453 ATGGGCAAGGTGAAGGGGGTGGG - Intergenic
1147606593 17:41777176-41777198 ATGGCTGAGGAGAAGGGGAGTGG + Intronic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1148899964 17:50867665-50867687 AGGGGAAAGGGGAAAGGGGAAGG - Intronic
1149175887 17:53869490-53869512 ATGGCTAAGGGGTACTGAGAGGG - Intergenic
1149453725 17:56770477-56770499 ATAGATGAGTGGAAGGGGGATGG - Intergenic
1149717288 17:58804505-58804527 ATGGAGATAGGGAAGGGGGATGG + Intronic
1149835208 17:59906353-59906375 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150685317 17:67316068-67316090 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1150685320 17:67316074-67316096 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1150824206 17:68460285-68460307 ATGGGGAAGGGGGAGGGGCAGGG + Intergenic
1151519030 17:74615283-74615305 ATAGCTAAGGGGCAGGGGGCAGG + Intronic
1151875889 17:76868236-76868258 TTGGCTCAGGGGAAGGAGCAGGG + Intergenic
1152308526 17:79535339-79535361 ATAGGTAAGGAGAAGAGGGAGGG + Intergenic
1152370349 17:79884072-79884094 ATGGCGAAAGGCAAGGAGGAAGG - Intergenic
1152609217 17:81307443-81307465 AAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152960026 18:74031-74053 AAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1153450419 18:5221210-5221232 ATGGGGGAGGGGAAGGGGAAGGG - Intergenic
1153675314 18:7451805-7451827 TGGCCTAAGGGGAGGGGGGAAGG - Intergenic
1153708472 18:7772426-7772448 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1153841028 18:9008008-9008030 ATGGGGTGGGGGAAGGGGGAAGG + Intergenic
1154966763 18:21366289-21366311 TGGGGTAAGGGGATGGGGGAGGG - Intronic
1155048956 18:22129989-22130011 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1156053926 18:32974678-32974700 AGAGCTAAAGGGAAGAGGGAGGG + Exonic
1156451130 18:37266972-37266994 AGGGCTGTGGGGAAAGGGGAGGG + Intronic
1156608989 18:38703977-38703999 GTGGTTAAGTGGAAAGGGGATGG - Intergenic
1157168363 18:45379456-45379478 ATGGTTAAGGGAATGGGGGTGGG - Intronic
1157239907 18:45999221-45999243 ATGGCTATGAGGGAGGGAGATGG - Intronic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157331909 18:46710467-46710489 AAGGGGAAGGGGAAGGGAGAAGG - Intronic
1157331910 18:46710473-46710495 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1158298844 18:56029871-56029893 ATGGCTAAGGGGATGGGAAGAGG + Intergenic
1158423107 18:57313436-57313458 AAGGGGAGGGGGAAGGGGGAAGG + Intergenic
1158520124 18:58165005-58165027 ATGGCTTAGGAGAAGGTGGTAGG - Intronic
1159311994 18:66720945-66720967 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1160226787 18:77018217-77018239 ATGGATGAGTGGATGGGGGATGG - Intronic
1160226824 18:77018384-77018406 ATGGATGAGTGGATGGGGGATGG - Intronic
1160226857 18:77018553-77018575 ATGGATGAGTGGATGGGGGATGG - Intronic
1160251850 18:77210150-77210172 AAGGATAAGGGGTAGGGGGCAGG - Intergenic
1160491618 18:79341910-79341932 AGGGTTTAGGGGAAGGGGAATGG - Intronic
1160492762 18:79351817-79351839 AAGCCTAGGGGGATGGGGGATGG + Intronic
1160923569 19:1532098-1532120 GTGGGTAGGGGGAAGGGGAAGGG + Intronic
1161181717 19:2887925-2887947 CTGGCTAAGGGGCAGAGGCAAGG - Intergenic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1161756585 19:6138479-6138501 AGGGGAAGGGGGAAGGGGGAGGG + Intronic
1161821620 19:6533742-6533764 AGGGGGAGGGGGAAGGGGGAAGG - Intronic
1161911361 19:7197051-7197073 ATGGCAAAGGGGCAGGGGTTGGG + Intronic
1161942028 19:7411256-7411278 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1161942031 19:7411262-7411284 AAGGGAAAGGGGAAGGGGAAGGG - Intronic
1161958012 19:7506904-7506926 ATGGATTAGGAGAGGGGGGAGGG - Intronic
1162406676 19:10479032-10479054 AGGGCTAAGGGGCGGGGGGGCGG + Intergenic
1162540807 19:11294890-11294912 ATGGATTGGGGGAAGGCGGATGG - Intergenic
1162551467 19:11360716-11360738 GTGGCTGTGGGAAAGGGGGAGGG + Intronic
1162686182 19:12386473-12386495 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
1162686195 19:12386503-12386525 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
1162686198 19:12386509-12386531 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162686201 19:12386515-12386537 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162686204 19:12386521-12386543 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162704246 19:12543339-12543361 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162704248 19:12543345-12543367 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162802469 19:13118786-13118808 ATGCCGGAGGGGGAGGGGGAGGG + Intronic
1162876782 19:13626590-13626612 AAGGGGAAAGGGAAGGGGGAAGG + Intergenic
1162876791 19:13626609-13626631 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1162963756 19:14145542-14145564 GTGGATATGGGGATGGGGGAGGG + Intergenic
1163101400 19:15099194-15099216 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1163101402 19:15099200-15099222 AAGGGGAAGGGGAAGGGGAAAGG + Intergenic
1163211682 19:15845483-15845505 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1163350001 19:16770611-16770633 AGGGCTGTGGGGCAGGGGGAGGG - Intronic
1163363917 19:16865671-16865693 AGGGGGAAGGGGAAGGGGAAGGG - Intronic
1163390815 19:17028702-17028724 ATGGTCAAGGGGGAGGCGGAGGG - Intergenic
1163445250 19:17342087-17342109 AAGGGGAAGGGGAAGGGGAAAGG - Intronic
1163445252 19:17342093-17342115 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1164441325 19:28282643-28282665 ATGGCTGGGGAGAAGGGGGTGGG - Intergenic
1164443465 19:28297979-28298001 AGGGCAATGGGGAGGGGGGAGGG - Intergenic
1164680556 19:30131195-30131217 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1164680557 19:30131201-30131223 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1164680560 19:30131207-30131229 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1164976524 19:32577004-32577026 AAGGGGAAGGGGAAGGGGAATGG - Intergenic
1165333307 19:35153590-35153612 ATTGCAAATGGGAAGGGAGATGG + Intronic
1165400409 19:35596103-35596125 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1166289556 19:41853693-41853715 ATAGCTAAGGGGAGGGAAGAAGG - Intergenic
1166505394 19:43368391-43368413 CTGGCTTAGGGGAAGGCAGAAGG - Intergenic
1166566274 19:43767451-43767473 GTGGCTAAGGGGGCGGGGGATGG - Intronic
1166674935 19:44734633-44734655 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1166674938 19:44734639-44734661 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1166674941 19:44734645-44734667 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1166674944 19:44734651-44734673 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167270324 19:48502382-48502404 GCTACTAAGGGGAAGGGGGAAGG - Intronic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167702104 19:51054950-51054972 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1168058357 19:53876371-53876393 ATGGATACGGGAATGGGGGAAGG - Exonic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168570075 19:57459365-57459387 ATGTCAAAGGGGTCGGGGGATGG - Intronic
925301319 2:2815016-2815038 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
925327849 2:3036830-3036852 CTGGCTATGGGGAACTGGGATGG + Intergenic
925372931 2:3360909-3360931 ATGGGGAAAGGGGAGGGGGAAGG + Intronic
925548309 2:5041803-5041825 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
925548322 2:5041832-5041854 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
925573392 2:5334863-5334885 AAGGGAAAGGGGAAGGGGAAAGG + Intergenic
925605065 2:5651304-5651326 TTGGGTAGGGGGACGGGGGAGGG + Intergenic
925683987 2:6453058-6453080 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925683990 2:6453064-6453086 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925683993 2:6453070-6453092 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925684068 2:6453235-6453257 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925927592 2:8681684-8681706 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
925947220 2:8876705-8876727 AAGGAAAGGGGGAAGGGGGAAGG + Intronic
926033918 2:9618924-9618946 AGGACTAAGGGGAAGGGTGGAGG - Intronic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
926948997 2:18220906-18220928 AGGGCTAAAGAAAAGGGGGATGG + Intronic
927287480 2:21371607-21371629 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
927710812 2:25324746-25324768 ATGGATAAGGAGGAGGGAGAGGG + Intronic
927861854 2:26565064-26565086 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
927866174 2:26589147-26589169 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
928268305 2:29831177-29831199 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
928268308 2:29831183-29831205 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929097933 2:38281600-38281622 ATGGGTAGGGGCAGGGGGGAGGG + Intergenic
929358451 2:41054459-41054481 TGGGCTGAGGGGACGGGGGAGGG - Intergenic
929957790 2:46472191-46472213 AGGGGTGGGGGGAAGGGGGAGGG - Intronic
930084025 2:47480134-47480156 ATGGGGGATGGGAAGGGGGAGGG - Intronic
930084092 2:47480299-47480321 AGGGGAAAGGGGAAGGGGAAGGG - Intronic
930712177 2:54559310-54559332 ATAGCAAAGGGGAGGAGGGAGGG + Intronic
931236180 2:60414143-60414165 TTGGCAAAGGAGGAGGGGGAAGG - Intergenic
931590672 2:63880156-63880178 AGGGGTAGGGGGAAGGGGGAAGG - Intronic
931957783 2:67447393-67447415 GTGTCTAAGTGGAAGGGAGATGG - Intergenic
932064055 2:68534501-68534523 ATGGTTGAGGGGCAGGGGAATGG + Intronic
932744896 2:74325875-74325897 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
932810032 2:74817500-74817522 CTTGCTAAGGGGAAGTGGGGCGG - Intergenic
933099411 2:78233187-78233209 GTGGCTAAAGGAAAGGAGGATGG + Intergenic
933190393 2:79327795-79327817 ATGCAGAAGGGGCAGGGGGATGG + Intronic
933768990 2:85730868-85730890 ATGGCCAAGGGCAAGGGAGAGGG + Intergenic
934523435 2:95034082-95034104 ATGGCAAAGGTGATGGGGGCGGG - Intronic
935351136 2:102152608-102152630 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
935517597 2:104061497-104061519 ATGGGTGGGGGGAGGGGGGAGGG - Intergenic
936152722 2:110030524-110030546 ATGGCTCAGGGGAGGGCGGGGGG - Intergenic
936191958 2:110340888-110340910 ATGGCTCAGGGGAGGGCGGGGGG + Intergenic
936372923 2:111918054-111918076 GTGGCTAAGGGGAGAGGGAATGG - Intronic
936526324 2:113244204-113244226 ATGGCTGGGGGCCAGGGGGAGGG + Intronic
936749841 2:115628956-115628978 TGGGGTAGGGGGAAGGGGGAAGG - Intronic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937102640 2:119283415-119283437 ATGGATATGGGGAAGAGAGAGGG - Intergenic
937130893 2:119512310-119512332 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
937130896 2:119512316-119512338 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
937130899 2:119512322-119512344 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
937130902 2:119512328-119512350 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
937358498 2:121213046-121213068 ATGGCTGGGGGGGAGGGGGGTGG + Intergenic
937509998 2:122584425-122584447 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
937614439 2:123905022-123905044 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938043410 2:128095377-128095399 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
938299582 2:130200652-130200674 ATGGCCAACAGGAAAGGGGAAGG + Intergenic
938657338 2:133447619-133447641 AGGGGGAAGGGGAAGGGGAAAGG - Intronic
938760413 2:134420564-134420586 GTGGCTAAGGGAAAGACGGAGGG + Intronic
940043529 2:149385709-149385731 ATGGCAAAGGGGGAGGGGAAAGG + Intronic
940093991 2:149952852-149952874 AGGGCTCAGGAGAAGGGGAAAGG - Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940642474 2:156360887-156360909 ATGGCTGAGAGGAAGGGGTTGGG - Intergenic
940660955 2:156544449-156544471 ATGGCTACAGGGAGGGGTGAAGG + Intronic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941038253 2:160590654-160590676 AGGGAGGAGGGGAAGGGGGAGGG - Intergenic
941234027 2:162946635-162946657 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
941234030 2:162946641-162946663 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
942248852 2:174031133-174031155 ATGGGAGAGGGAAAGGGGGAAGG - Intergenic
942431837 2:175920295-175920317 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
943656303 2:190512635-190512657 ATGGTTAAAGGGAAGGAAGAAGG + Intronic
943820974 2:192320429-192320451 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
943920726 2:193705043-193705065 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
943921529 2:193713251-193713273 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
943921532 2:193713257-193713279 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
943921535 2:193713263-193713285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
944036164 2:195296854-195296876 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944502836 2:200379528-200379550 ATAGCTAAAGAGATGGGGGAAGG + Intronic
944661192 2:201923358-201923380 ATGCATAAGGGGAAGAGGGTGGG - Intergenic
945152511 2:206805990-206806012 ATGGTTTGGGGCAAGGGGGAAGG - Intergenic
946316575 2:218919381-218919403 AAGGGGAAGGGGAAGGGGAAAGG - Intergenic
946370801 2:219280182-219280204 AAATCTAGGGGGAAGGGGGAGGG - Intronic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
946719617 2:222590364-222590386 ATGGGGTGGGGGAAGGGGGAGGG + Intronic
947119628 2:226800605-226800627 AAGGCTGAGGGCATGGGGGAGGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947272085 2:228347851-228347873 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
947272088 2:228347857-228347879 AAGGAAAAGGGGAAGGGGAAGGG - Intergenic
947343622 2:229166967-229166989 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
947348863 2:229221805-229221827 GTGGTTAAGAGGAATGGGGAGGG - Intronic
947373975 2:229476350-229476372 AAGGCTGAGAGGCAGGGGGAGGG - Intronic
947439873 2:230109805-230109827 ATCGCTATGGGGATGGGTGAGGG + Intergenic
947546375 2:231013200-231013222 TTGCCTTGGGGGAAGGGGGATGG - Intronic
948021681 2:234738469-234738491 ATGGCTGCTGGGAAGTGGGAAGG + Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948527564 2:238580971-238580993 AGGTCTAAGGGGTCGGGGGAGGG - Intergenic
948558565 2:238835263-238835285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558591 2:238835344-238835366 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948856561 2:240732925-240732947 AGGGATAAGGGGATGGGGAAGGG + Intronic
949049961 2:241892367-241892389 AGGGGCAAGGGGAAGAGGGATGG - Intergenic
1168904084 20:1390339-1390361 CTGGCCATGGGGAGGGGGGAGGG + Intronic
1169178635 20:3542586-3542608 AGGGGGAAGGGGAAGGGAGAAGG - Intronic
1169178640 20:3542599-3542621 AGGGGAAGGGGGAAGGGGGAAGG - Intronic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1170193387 20:13665924-13665946 ATTGCTATTGGGAAGGGGAAGGG + Intergenic
1170579241 20:17685250-17685272 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1170579244 20:17685256-17685278 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1171114977 20:22517646-22517668 ATGGCTAATGAGCAGGTGGAAGG + Intergenic
1171349672 20:24492766-24492788 AAGGCAAAGGGGAAGGAAGATGG - Intronic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1171474523 20:25397837-25397859 AGGGGAAGGGGGAAGGGGGAGGG + Intergenic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172762813 20:37333897-37333919 AAGGCCAAGGGGAAGGGGAAGGG + Intergenic
1172762817 20:37333903-37333925 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1173053023 20:39583674-39583696 AGAGGAAAGGGGAAGGGGGAAGG + Intergenic
1173356839 20:42300958-42300980 TTGGGTGGGGGGAAGGGGGAGGG + Intronic
1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG + Intronic
1174058194 20:47814071-47814093 AGGGCTGAGGGGAAGGAGAATGG + Intergenic
1174092588 20:48061074-48061096 CTGGCTAAGGAGGAGGGGAATGG - Intergenic
1174411479 20:50339482-50339504 GTGGCTGAGGGCAAGGGAGAAGG + Intergenic
1175333479 20:58179957-58179979 AGGGCTAGGGGGAAGCAGGACGG + Intergenic
1175565011 20:59967749-59967771 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1175794016 20:61760155-61760177 AAGGCTGAAGGGTAGGGGGAGGG + Intronic
1175967338 20:62666123-62666145 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1175967341 20:62666129-62666151 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1176513650 21:7767340-7767362 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1176546533 21:8204703-8204725 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176554427 21:8248894-8248916 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176565484 21:8387750-8387772 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176573349 21:8431918-8431940 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176669086 21:9715283-9715305 TTGGCAAAGGGAAAGGGAGATGG + Intergenic
1176736411 21:10551286-10551308 TTGGGTAGGGGGAGGGGGGAGGG + Intronic
1176909893 21:14551984-14552006 AATGCTAAGGGCTAGGGGGAGGG + Intronic
1177114869 21:17073355-17073377 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1177207582 21:18028233-18028255 AAGGAAAAGGGGAAGGGGAAGGG - Intronic
1177317991 21:19485420-19485442 CTTGCTAAGGGGAAAGGGGAAGG - Intergenic
1177322096 21:19535992-19536014 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1177572859 21:22909614-22909636 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1178072447 21:28983674-28983696 ATGGCTAATTGAAAGGAGGAAGG + Intronic
1178093686 21:29191058-29191080 GTGGCCAAGGCGAAGGGGGCAGG - Intergenic
1178150987 21:29793482-29793504 AAGGAAAAGGGGAAGGGGCAGGG - Intronic
1178296191 21:31412416-31412438 ATGGATGAGGGGGTGGGGGATGG + Intronic
1178379141 21:32093579-32093601 AAGGATAAGAGGAAGGGGTAAGG - Intergenic
1178647763 21:34397864-34397886 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1178992073 21:37365614-37365636 ATAGCTAGGGAGAAGGGGTAGGG + Intergenic
1179125506 21:38587297-38587319 ATGTTCAAGGGGATGGGGGAGGG + Intronic
1179264096 21:39786958-39786980 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1180103030 21:45598755-45598777 ATGGCTGCGGCGAGGGGGGAGGG + Intergenic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1180619137 22:17148405-17148427 CTGGCTGAAGGGAAGGGGCAGGG - Intronic
1180941693 22:19663786-19663808 AGGGGAAAGGGGATGGGGGAAGG - Intergenic
1181080741 22:20413210-20413232 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1181880972 22:25979792-25979814 ATGGAGAAGGGGAAGGGAAAGGG - Intronic
1181994041 22:26860830-26860852 AAGGCGAAAGGGAAGGGGAAGGG - Intergenic
1182408347 22:30158566-30158588 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1182442511 22:30372560-30372582 ATGGCTAAGGGGTGCAGGGAGGG + Intronic
1182445313 22:30386584-30386606 ATGTCTATGGGGGAGGGGGCTGG - Intronic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1183064799 22:35355380-35355402 AGTGCTAAGGGGAGGGAGGAGGG + Intergenic
1183138248 22:35911219-35911241 ATGGGTTGGGGGAAGGGAGAAGG + Intronic
1183255055 22:36756685-36756707 AGGGCCATGGGGAAGGGGGCTGG + Intergenic
1183419741 22:37704465-37704487 AAGGGGGAGGGGAAGGGGGAGGG + Intronic
1183848458 22:40562711-40562733 AGGGGAAGGGGGAAGGGGGAAGG + Intronic
1184089883 22:42287054-42287076 ATGGCTGGGGGGAAGGGAGGAGG + Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184254703 22:43280443-43280465 ATGGGTGAGGGGAAGGGACAGGG - Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185229842 22:49673620-49673642 AGGGAGAGGGGGAAGGGGGAGGG + Intergenic
1203251396 22_KI270733v1_random:120965-120987 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203259442 22_KI270733v1_random:166039-166061 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
949493519 3:4610947-4610969 AGGGGGAAGGGGAAGGGGAAGGG - Intronic
950125700 3:10508635-10508657 AAGGCAAAGGGGACGGGGCAAGG - Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950572390 3:13809467-13809489 ATGGCAGAGGGGAAGGAGGTGGG + Intergenic
950757260 3:15185545-15185567 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
951602324 3:24390097-24390119 ATGGCTTATGGGTAGGGGTATGG - Intronic
951719112 3:25679568-25679590 AGGGCGAGGGGAAAGGGGGAGGG + Intergenic
951719128 3:25679600-25679622 AGGGCGAGGGGAAAGGGGGAGGG + Intergenic
951719138 3:25679625-25679647 AGGGGAAAGGGGAAGGGCGAGGG + Intergenic
951719145 3:25679638-25679660 AGGGCGAGGGGAAAGGGGGAGGG + Intergenic
951719154 3:25679657-25679679 AGGGCGAGGGGAAAGGGGGAGGG + Intergenic
951795917 3:26538210-26538232 AAGGGGAAGGGGAAGGGGAAAGG + Intergenic
951930113 3:27955873-27955895 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
952331238 3:32366230-32366252 ATGGGGAAGGGGAAGAGGGTTGG - Intronic
952749943 3:36816960-36816982 GTGGGAAAGGGGAAGGGGAAGGG - Intergenic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
953503268 3:43458799-43458821 AGGGGTAGGGGGAAAGGGGAGGG - Intronic
953639724 3:44695186-44695208 TGGGGTGAGGGGAAGGGGGACGG + Intergenic
954700377 3:52447751-52447773 ATGGCTGATGGGAAGTGGGGGGG - Intergenic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955150686 3:56363869-56363891 AAGGGAAAGGGAAAGGGGGAGGG + Intronic
955180737 3:56666863-56666885 ATGGGTAATGGGAAGAGGGAAGG - Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955687333 3:61561161-61561183 CTGGCGAGGGGAAAGGGGGAGGG - Intergenic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
956007509 3:64796775-64796797 ATGGCAGAGGGCAAAGGGGAAGG - Intergenic
956161026 3:66352773-66352795 AGAGGTATGGGGAAGGGGGATGG - Intronic
956532099 3:70231999-70232021 ATGGCTAAGGGGAAGAAGGGTGG - Intergenic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956902094 3:73727643-73727665 ATGCCTTTGGGGGAGGGGGAAGG - Intergenic
956992187 3:74779683-74779705 ATTGCCAGGGTGAAGGGGGAGGG - Intergenic
957019432 3:75108416-75108438 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
957019435 3:75108422-75108444 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
957310599 3:78513486-78513508 ATGGGGTAGGGAAAGGGGGAGGG + Intergenic
957563303 3:81854051-81854073 ATGGAAAAGGGGATGAGGGATGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957672946 3:83328656-83328678 AAAGGGAAGGGGAAGGGGGAGGG + Intergenic
957859033 3:85919384-85919406 ATGGCTGAAGGAAAGGAGGAAGG + Intronic
957875028 3:86133437-86133459 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
958766314 3:98372453-98372475 ATGGTCAAAGGGAAGGGGAAGGG + Intergenic
958885453 3:99721425-99721447 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
958885456 3:99721431-99721453 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
958972587 3:100628848-100628870 ATGACTGAGGCTAAGGGGGAAGG - Intronic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
959017959 3:101157353-101157375 GTGGCTAGGGGGAAGGGAGATGG + Intergenic
959240909 3:103792500-103792522 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
959795387 3:110421825-110421847 AGGGCTTAGGGGATGGGGAATGG - Intergenic
960315622 3:116172914-116172936 ATGGCTACTGGGAAAGAGGATGG + Intronic
960556717 3:119038119-119038141 TTTGCAAAGGGGGAGGGGGAGGG - Intronic
960743606 3:120861878-120861900 GTGGGTTAGGGGTAGGGGGAGGG - Intergenic
961097716 3:124172233-124172255 AAGGCGAAGGGGAATGGGGTAGG - Intronic
961213188 3:125141373-125141395 TTGGCTAAGGGGAGGAGGGTAGG - Intronic
961378593 3:126482858-126482880 ATGGCAGAGGGGAATGGGGGAGG - Intronic
961527729 3:127517553-127517575 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962081431 3:132143061-132143083 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
962246398 3:133797929-133797951 AGGGAGAAGGGGAAGGGTGAAGG + Intronic
962407666 3:135113819-135113841 ATGGCAGAGGGGCAGGGGCATGG - Intronic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963239514 3:142989239-142989261 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
963676376 3:148316531-148316553 TGGGCTAAGGGAAAGGTGGAGGG + Intergenic
963938861 3:151081426-151081448 AGGGGGAGGGGGAAGGGGGAGGG - Intergenic
963962055 3:151320655-151320677 TTGATTAAAGGGAAGGGGGATGG + Intronic
964600626 3:158497206-158497228 GGGGCTAGGGGGGAGGGGGAAGG - Intronic
964624740 3:158748317-158748339 AGGAATAAGGGGAAGGGTGAAGG - Intronic
964833301 3:160910178-160910200 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
964833329 3:160910244-160910266 AGGGGAAAGGGGAAGGGGAAAGG - Intronic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
964833335 3:160910257-160910279 AAGGGGAAGGGGAAGGGGAAAGG - Intronic
966422266 3:179745276-179745298 AGGGGTAAGGGAAAGGGGGTGGG + Intronic
966461465 3:180181631-180181653 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
966555205 3:181251364-181251386 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
966762735 3:183431596-183431618 ATGGGTGAGAGGAAGGGAGAAGG - Intergenic
966836128 3:184050854-184050876 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
966899809 3:184473007-184473029 ATTGGTAAGGGGCAGGGGAAGGG - Intronic
966946322 3:184779451-184779473 AAGGCTAAGGGGAAGGAGCTCGG + Intergenic
967036197 3:185649811-185649833 AGGGCTAAGGGGATGGGTGAGGG + Intronic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967886504 3:194337045-194337067 ATGGGGAAGGGCAAGGGCGAGGG + Intergenic
968135629 3:196217639-196217661 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
968382937 4:110602-110624 AGAGCAAAGGGCAAGGGGGAGGG + Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968624736 4:1622036-1622058 AGGGCAGAGGGGAAGGAGGAAGG - Intronic
968630618 4:1649126-1649148 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
968630641 4:1649180-1649202 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
968708460 4:2095181-2095203 GGGGCTAGGGGGTAGGGGGAAGG + Intronic
968741726 4:2334737-2334759 AAGGGGAGGGGGAAGGGGGAGGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969397678 4:6933278-6933300 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
969397681 4:6933284-6933306 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
969397684 4:6933290-6933312 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
970316097 4:14829668-14829690 ATGGCTCAGGTGAAGGCAGAGGG + Intergenic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
970775832 4:19672854-19672876 AAGGGTTGGGGGAAGGGGGAAGG + Intergenic
970878989 4:20906024-20906046 AAGGGGAAGGGGAAGGGGAAAGG - Intronic
971305120 4:25473301-25473323 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
971305144 4:25473349-25473371 ACGGGGAAGGGGAAGGGGAAGGG + Intergenic
971494971 4:27254383-27254405 ATGGGTAAGGGGAGATGGGAGGG + Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
972759339 4:42087803-42087825 ATGGCAAGTGGGAAAGGGGAAGG - Exonic
972912931 4:43841177-43841199 CTGGCTTAGAGGAAGGGGAAGGG - Intergenic
973149859 4:46873811-46873833 TGGGGTGAGGGGAAGGGGGAGGG - Intronic
973195299 4:47432913-47432935 AAGGCTGAGGGGAAGTGGGTAGG - Intergenic
973263171 4:48185785-48185807 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
973263183 4:48185810-48185832 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
973610507 4:52632021-52632043 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
973610509 4:52632027-52632049 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
973610895 4:52635249-52635271 ATGGCCAAAGGGCAGGGTGAGGG - Intronic
974214942 4:58832967-58832989 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
974214945 4:58832973-58832995 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
974214953 4:58832991-58833013 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
974597692 4:64036628-64036650 AAGGGGGAGGGGAAGGGGGAGGG - Intergenic
975160741 4:71121213-71121235 ACAGCCAAGGGGAGGGGGGAGGG - Intergenic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975360210 4:73460925-73460947 AAGGAGGAGGGGAAGGGGGAGGG - Intergenic
975362362 4:73485704-73485726 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
976259041 4:83128452-83128474 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
976465069 4:85357949-85357971 ATCCCTGAGGGGAAAGGGGAGGG - Intergenic
976579715 4:86721725-86721747 AGGGGAAGGGGGAAGGGGGAAGG - Intronic
976666799 4:87603449-87603471 ATGCCTGAGGTCAAGGGGGAAGG - Intergenic
977200785 4:94112910-94112932 ATGGAAAAGAGGGAGGGGGAGGG + Intergenic
977360537 4:95998890-95998912 ATGTCTAGGGGGGAGGGGGAAGG + Intergenic
977732461 4:100370328-100370350 ATGTCCTGGGGGAAGGGGGAAGG + Intergenic
978268536 4:106858878-106858900 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
978268555 4:106859031-106859053 AAAGGTAAGGGGATGGGGGAGGG + Intergenic
978313944 4:107415151-107415173 TAGGGTAAGGGGAAGGGGAAGGG + Intergenic
978695421 4:111571087-111571109 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
978776675 4:112512102-112512124 ATGGCTAAGGTGGAGAGGCAGGG - Intergenic
979367020 4:119837429-119837451 AAGGAGAAGGGGATGGGGGAGGG + Intergenic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981443946 4:144813013-144813035 GTGGGTAGGGGGAAAGGGGAGGG + Intergenic
981637963 4:146902152-146902174 AGGGAAAAGAGGAAGGGGGATGG - Intronic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
982090882 4:151879058-151879080 ATGGCCAGGGGGAAGGGGACTGG + Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
982364360 4:154559167-154559189 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
982364363 4:154559173-154559195 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
982908638 4:161112008-161112030 ATTGCTAAGGGGTGTGGGGAGGG - Intergenic
982981764 4:162146703-162146725 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
983440473 4:167777346-167777368 TGGGGTAGGGGGAAGGGGGAAGG - Intergenic
984070309 4:175103264-175103286 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
984222452 4:176994695-176994717 AGGGGGAAGGGGAAGAGGGAGGG - Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
984725147 4:183013420-183013442 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
984725150 4:183013426-183013448 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
984725153 4:183013432-183013454 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
984725156 4:183013438-183013460 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
984725159 4:183013444-183013466 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
984858986 4:184219984-184220006 AAGGGTAAGGGGAAGGGGAAGGG + Intronic
984859028 4:184220130-184220152 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
984911433 4:184676922-184676944 AGGGGAAGGGGGAAGGGGGAAGG - Intronic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
984911446 4:184676949-184676971 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
985200433 4:187479052-187479074 TTGGCTAATGGGAAGTGGTAAGG - Intergenic
985405697 4:189636236-189636258 TTGGCAAAGGGAAAGGGAGATGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986210187 5:5664760-5664782 ATGGCCAAGGAGAAGAGGGAGGG + Intergenic
986600298 5:9466219-9466241 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
986668071 5:10120412-10120434 AGGTCCAAGGGGAAGGGCGAAGG + Intergenic
986723450 5:10577092-10577114 AAGGGAAAGGGGAAGGGGAAGGG - Intronic
986723458 5:10577110-10577132 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
986872678 5:12068414-12068436 TTGGGTAAAGGGAAGGGGAAGGG + Intergenic
986946597 5:13029116-13029138 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
986946600 5:13029122-13029144 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
986946603 5:13029128-13029150 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
986946606 5:13029134-13029156 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
986946609 5:13029140-13029162 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987332550 5:16869919-16869941 AAGGGGAAGGGGGAGGGGGAGGG + Intronic
987447647 5:18040687-18040709 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
987561577 5:19530574-19530596 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
988776623 5:34482847-34482869 AGGGTTAAGGAGAAAGGGGAAGG + Intergenic
988789290 5:34592495-34592517 TTGGCAGTGGGGAAGGGGGAAGG - Intergenic
988834023 5:35014019-35014041 ATGGCTAAAGGGATTGGGAATGG - Exonic
988834337 5:35016562-35016584 AAGGGAAAGGGGAAGAGGGAGGG - Intronic
989147635 5:38264532-38264554 ATGGCTAAGGGGCAGTGGCCAGG + Intronic
989272912 5:39553643-39553665 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
989375707 5:40757549-40757571 AAGGGAAAGGGGAAGGGGAAAGG + Intergenic
989741559 5:44779274-44779296 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
989741562 5:44779280-44779302 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
989741565 5:44779286-44779308 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
989741568 5:44779292-44779314 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
989750595 5:44888689-44888711 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
989750598 5:44888695-44888717 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
989750601 5:44888701-44888723 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
989823045 5:45818606-45818628 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
990041676 5:51384230-51384252 ATAGCAAAGAGGAAGGGGGGGGG + Intronic
990105993 5:52262287-52262309 ATTGCTAAGGGGCTGGGGAAAGG + Intergenic
990378074 5:55193037-55193059 TTGACTAAAGGGAAGGGAGACGG - Intergenic
990421707 5:55642025-55642047 AAGGGAAAGGGGAAGGGGAAGGG - Intronic
990589647 5:57249757-57249779 AGGGGAGAGGGGAAGGGGGAGGG - Intronic
990589746 5:57249961-57249983 AGGGGGAGGGGGAAGGGGGAAGG - Intronic
990611350 5:57460041-57460063 TGGGGTCAGGGGAAGGGGGAGGG - Intergenic
990829086 5:59936211-59936233 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
990869802 5:60418850-60418872 GGGGCTAAGGGGGAGGGGGATGG - Intronic
991266834 5:64729636-64729658 AGGGCTAAGGGGAAAAGGCAGGG + Intronic
991434825 5:66587011-66587033 GGGGCTAAGGGGAGGGGAGATGG + Intergenic
991955719 5:71994476-71994498 ATGGCTAATGGGGAGTGGGAAGG - Intergenic
992489055 5:77223375-77223397 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
992578973 5:78151835-78151857 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
992797291 5:80264596-80264618 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
992797294 5:80264602-80264624 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
993853091 5:93035566-93035588 ATTGCTGAGGGGACTGGGGAGGG + Intergenic
993901150 5:93584922-93584944 AAGGGGAAGGGGAAGGGGGGAGG - Exonic
993904957 5:93612319-93612341 GGGGGTAAGGGGAAAGGGGAGGG + Intergenic
993926593 5:93873386-93873408 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
993926595 5:93873392-93873414 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
994204063 5:97013069-97013091 ATGGCTAGAGGAAAGAGGGAGGG - Intronic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
995912536 5:117204626-117204648 CTGGCGAAGGGGGAGGGGGGGGG + Intergenic
996189494 5:120521812-120521834 TGGGGTAAGGGAAAGGGGGAGGG - Intronic
996423272 5:123285673-123285695 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
996423275 5:123285679-123285701 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
996423278 5:123285685-123285707 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
996423281 5:123285691-123285713 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
996423284 5:123285697-123285719 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
996630601 5:125626782-125626804 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
996777328 5:127146654-127146676 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
996819861 5:127614547-127614569 TGGGGTAGGGGGAAGGGGGACGG + Intergenic
996929426 5:128868554-128868576 ATGGCTAAGGTGAAGGATGAAGG + Intronic
997082141 5:130752989-130753011 TGGGGTGAGGGGAAGGGGGAGGG - Intergenic
997411849 5:133696719-133696741 AGGGCTGTGGGGAAGGAGGAGGG + Intergenic
997465699 5:134086695-134086717 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
997855450 5:137368723-137368745 AGGGCTGTGGGGAAGGGAGAGGG - Intronic
997893427 5:137695066-137695088 TTGGAAGAGGGGAAGGGGGAAGG - Intronic
998461544 5:142313811-142313833 ATGGAAAAGAGGAAGGGGGGGGG + Exonic
998537820 5:142951041-142951063 AGGGGGAAGGGGAAGGGGAAGGG - Intronic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999112565 5:149134667-149134689 GTGGCTAAAGGGAAGGGAGAGGG - Intergenic
999372556 5:151064685-151064707 TGGGCTAAGGGAAAGGGGGCTGG - Intronic
1000051123 5:157563678-157563700 ATGGCTAAGTAGATGGGGAATGG + Intronic
1001120723 5:168977857-168977879 ATGGAAAAGGTGAAGAGGGAGGG + Intronic
1001290526 5:170455290-170455312 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1001397021 5:171424845-171424867 AGGGGGAAGGGGGAGGGGGAGGG + Intronic
1002059795 5:176619624-176619646 TTGTCTAAGGGGAAGGGAAATGG - Intergenic
1002113994 5:176943113-176943135 ATGCCTCAGGAGAAGGGGAAGGG - Intronic
1002173666 5:177389347-177389369 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1002173669 5:177389353-177389375 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1002173672 5:177389359-177389381 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1002213186 5:177610376-177610398 TTGGCTGAGGGGCAAGGGGACGG + Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002492570 5:179589330-179589352 ATGGCTAGGGGCAAGGGCGGAGG + Intronic
1002792032 6:443970-443992 GTGGCTAAGCGGAAGAGAGAGGG - Intergenic
1003108185 6:3231330-3231352 AGGCCTGGGGGGAAGGGGGAGGG - Intronic
1003281500 6:4696115-4696137 GTGGCTGAGGGGAGGGGAGATGG + Intergenic
1003700058 6:8453845-8453867 TTGGCAAAGGGGAATGGGGAGGG - Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004603518 6:17173429-17173451 AGGGAGAAGGGGAAGGGGCAGGG + Intergenic
1004924237 6:20402990-20403012 ATGGAGAAGGGGGTGGGGGAGGG + Intronic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1005722135 6:28613877-28613899 ATGGTTTAGTGGAAGTGGGAGGG - Intronic
1006031590 6:31180390-31180412 ATGGCTCAGGGGAAGGGGAGAGG + Intronic
1006186067 6:32182359-32182381 AGGGCTGGGGGGAAGGGGCAAGG + Exonic
1006369623 6:33635832-33635854 AGGGGTGAGGGGAAGGGGGATGG + Intronic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006527831 6:34623076-34623098 ATGGCTGGGGTGAAGGGGAATGG + Intronic
1006562972 6:34929771-34929793 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006567711 6:34974089-34974111 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1006567731 6:34974135-34974157 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1006567734 6:34974141-34974163 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1006567766 6:34974211-34974233 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1006567778 6:34974241-34974263 AAGGGGAAGGGGAAGGGGAACGG - Intronic
1006674840 6:35755062-35755084 ATGACTAAGAGGAAGGGAGCTGG - Intergenic
1006726581 6:36203459-36203481 ATGGCCAAGAGGTAGAGGGAGGG + Intronic
1007103476 6:39267583-39267605 AGGGCTCATGGGAAGGAGGAGGG - Intergenic
1007116183 6:39344985-39345007 ATGGAAAAGGGGATGGGGGAGGG - Intronic
1007339117 6:41179156-41179178 AAGGCTATGGGGAAAGGAGATGG - Intergenic
1007662197 6:43493666-43493688 ATGGCAGAAGGGAAGTGGGACGG + Intronic
1007733399 6:43965453-43965475 CTGGCTAAGAGGGAGGGAGATGG - Intergenic
1007939439 6:45765428-45765450 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1007939442 6:45765434-45765456 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1008111242 6:47497350-47497372 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1008111245 6:47497356-47497378 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1008209210 6:48701200-48701222 TTTGCTGAGGTGAAGGGGGATGG - Intergenic
1009333199 6:62451866-62451888 ATGGCTACTGGGAAGGGTCATGG - Intergenic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1010383584 6:75251894-75251916 ATGGCTAAGGGGTAGGGCAGAGG - Intergenic
1010742577 6:79526198-79526220 GTGGCTATTGGGAAGGGGAAAGG - Intronic
1011096339 6:83668679-83668701 GTGGTGTAGGGGAAGGGGGAGGG + Intronic
1011713307 6:90077264-90077286 ATGGCAAAGGGCAAGAGGGACGG + Intronic
1011888567 6:92127955-92127977 ATGGCAAAGGGGAAGAGAGAGGG + Intergenic
1012740391 6:103008868-103008890 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1013246584 6:108293560-108293582 AGGGGAAGGGGGAAGGGGGAGGG - Intergenic
1013268217 6:108521093-108521115 ATGGACCAGGGGCAGGGGGATGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013711104 6:112900286-112900308 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1013711107 6:112900292-112900314 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1013711110 6:112900298-112900320 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014332326 6:120085504-120085526 ATGGGGAGGGGGCAGGGGGAAGG - Intergenic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1014751425 6:125261051-125261073 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1014837625 6:126177901-126177923 AGGGCTTAAGGGAAAGGGGATGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015367610 6:132414643-132414665 AAGGCAAAGGGAAAGTGGGATGG + Intergenic
1015675765 6:135746497-135746519 GTGGGTCGGGGGAAGGGGGAGGG + Intergenic
1015997885 6:139013621-139013643 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1016311971 6:142743988-142744010 ATGGTTAAAGGGCAGGGGGCAGG - Intergenic
1016567265 6:145470036-145470058 AGGGGTAGGGGGAATGGGGATGG + Intergenic
1016582773 6:145647695-145647717 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
1016582776 6:145647701-145647723 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1017078084 6:150638422-150638444 CTGGCTGAGTGGTAGGGGGAGGG - Intronic
1017122990 6:151041382-151041404 ATGACTGAGGGGACGGGGAATGG + Intronic
1017339562 6:153305189-153305211 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1017339565 6:153305195-153305217 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018490902 6:164292340-164292362 ATGGGGTAGGGGGAGGGGGAGGG - Intergenic
1019159073 6:170057611-170057633 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019159077 6:170057617-170057639 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019159097 6:170057658-170057680 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019159101 6:170057664-170057686 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019566095 7:1679746-1679768 GTGGCCAGGGGGCAGGGGGAAGG - Intergenic
1019740014 7:2668086-2668108 CTGGCTAGGGGGAGGGGGGTAGG + Intergenic
1019851551 7:3563183-3563205 ATAGGAAAGGGGAAGTGGGATGG + Intronic
1020201922 7:6086675-6086697 AAGGGGAAAGGGAAGGGGGAAGG - Intergenic
1020439257 7:8199910-8199932 AAGGGTAATGGGAAGTGGGAAGG + Intronic
1020641512 7:10759705-10759727 GTGGCTTAGGAGAAGGGAGAAGG + Intergenic
1021320477 7:19204179-19204201 CTGGCTATGGGGAAGGAGGTGGG - Intergenic
1021821136 7:24498548-24498570 ATAGCTGAGGGGTTGGGGGAGGG + Intergenic
1022070450 7:26908518-26908540 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1022070453 7:26908524-26908546 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1022070456 7:26908530-26908552 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1022185815 7:27967294-27967316 ATGTCTCAGGGGTAGGGGTATGG - Intronic
1022274426 7:28841823-28841845 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022274428 7:28841829-28841851 AAGGGGAAGGGGAAGGGGAAAGG + Intergenic
1022347427 7:29530010-29530032 TTGGGTAGGGGGATGGGGGAGGG - Intergenic
1022357055 7:29625792-29625814 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1025253961 7:57370527-57370549 AATGCCAAGGGGAAGGTGGATGG - Intergenic
1025777355 7:64570509-64570531 AGGGGCAAGGGGGAGGGGGAAGG + Intergenic
1025777360 7:64570516-64570538 AGGGGGAGGGGGAAGGGGGAGGG + Intergenic
1025935817 7:66035883-66035905 AAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1026106680 7:67426920-67426942 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1026106683 7:67426926-67426948 AGGGGGAAGGGGAAGGGGAAGGG - Intergenic
1026129719 7:67610161-67610183 GTCGCAAAGGGGAAGGGAGAGGG + Intergenic
1026241727 7:68581429-68581451 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1026764955 7:73154709-73154731 AGGACTAAGGGGAAGGCCGAGGG - Intergenic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027041427 7:74964479-74964501 AGGACTAAGGGGAAGGCCGAGGG - Intergenic
1027082213 7:75237897-75237919 AGGACTAAGGGGAAGGCCGAGGG + Intergenic
1027148550 7:75715898-75715920 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027564948 7:79780072-79780094 GTGGAGTAGGGGAAGGGGGAAGG - Intergenic
1027695584 7:81405608-81405630 ATGGCAGAGGGTGAGGGGGAAGG + Intergenic
1027935005 7:84590590-84590612 GTGGGGTAGGGGAAGGGGGAGGG - Intergenic
1028306244 7:89269204-89269226 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
1028433512 7:90775627-90775649 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
1028433519 7:90775639-90775661 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
1028446611 7:90931583-90931605 ATGGCTGATGTGATGGGGGAAGG + Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1029144926 7:98439128-98439150 ATGGCAGAGGGGAAGGGGTATGG - Intergenic
1030196846 7:106860879-106860901 ATGGCTGAGGGGATGAGAGAAGG + Intergenic
1030295490 7:107921851-107921873 ATGGACAAGGGGATGGGGGTGGG - Intronic
1031054989 7:116983524-116983546 ATCCCCTAGGGGAAGGGGGATGG - Intronic
1031381808 7:121095205-121095227 TGGGCTATGGAGAAGGGGGATGG + Intronic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031595112 7:123640730-123640752 AGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1031857333 7:126938200-126938222 CTGGCCCATGGGAAGGGGGAAGG - Intronic
1031865992 7:127039630-127039652 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1031866123 7:127039971-127039993 AGGGGAAAGGGGAAGGGGAAGGG + Intronic
1032122538 7:129167661-129167683 ATGGCTGAGGGGTAGGGAAAGGG + Intronic
1032179698 7:129664124-129664146 ACGGGAAAGGGGGAGGGGGAGGG + Intronic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1033215096 7:139487657-139487679 AAGACAAAGGGGAAGGGGAAGGG + Intergenic
1033215108 7:139487686-139487708 GAGGTGAAGGGGAAGGGGGAGGG + Intergenic
1033418198 7:141182848-141182870 ATGGCTAAGGAAACGGTGGAAGG - Intronic
1033804324 7:144937416-144937438 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1033804327 7:144937422-144937444 AAGGGTAAGGAGAAGGGGAAGGG - Intergenic
1033804359 7:144937518-144937540 AGGGGGAAGGGGAAGGGGAAAGG - Intergenic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1033804372 7:144937544-144937566 AAAGGGAAGGGGAAGGGGGAAGG - Intergenic
1033969813 7:147025405-147025427 AAGGGGGAGGGGAAGGGGGAGGG + Intronic
1033973892 7:147075772-147075794 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034625183 7:152487244-152487266 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1034717578 7:153257464-153257486 ATGGATAAAGGGAATGGGGGTGG + Intergenic
1034944924 7:155255659-155255681 AGGGGAAAGGGGAAGGGGAAGGG + Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035035483 7:155891582-155891604 ATGGTGAAGGGGATGGGGGTAGG + Intergenic
1035389924 7:158497167-158497189 AGGGGTACAGGGAAGGGGGAGGG - Intronic
1035435850 7:158858824-158858846 AGGGGAAAGGGGAGGGGGGAGGG - Intronic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1035856947 8:2985942-2985964 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1035856950 8:2985948-2985970 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1035856953 8:2985954-2985976 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1035911145 8:3567513-3567535 AGGGGGAAGGGGATGGGGGAGGG + Intronic
1036081120 8:5557085-5557107 GTGGGTGGGGGGAAGGGGGAGGG - Intergenic
1036180018 8:6576499-6576521 ACGGGGAAGGGGAAGGGGAAGGG - Intronic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1036658899 8:10695089-10695111 ATGGGGGAGGGGAAGGGGAATGG + Intronic
1036718041 8:11144894-11144916 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1037194894 8:16176982-16177004 ATCGCTAAGGGGATGGGTGGAGG - Intronic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1037886652 8:22599391-22599413 AGGGGCGAGGGGAAGGGGGAGGG - Intronic
1037946318 8:22991710-22991732 AAGGCAGAGGGTAAGGGGGATGG + Intronic
1038042637 8:23737991-23738013 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1038166307 8:25088074-25088096 AAGGGGAAGGGGAAGGGGAAAGG + Intergenic
1038631762 8:29252026-29252048 AAGGAAAAAGGGAAGGGGGATGG + Intronic
1038812705 8:30866372-30866394 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1039127627 8:34220915-34220937 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1039412012 8:37362741-37362763 AGGGGTGAGGGGAAAGGGGAGGG + Intergenic
1039424906 8:37477692-37477714 ATGGATAAGAGGGAGGGTGAGGG - Intergenic
1039434287 8:37548993-37549015 ACTGCCAAGGGGAAGGGGCAGGG - Intergenic
1039474136 8:37830531-37830553 AGGGGTAAGGGTAAAGGGGAGGG - Intronic
1039793107 8:40891239-40891261 AGAGCAAGGGGGAAGGGGGAGGG + Intronic
1039923614 8:41909928-41909950 AGGGCCAAAGGGAAGGGTGATGG + Intergenic
1040516123 8:48136532-48136554 ATGTCTGAGGGGCAAGGGGAGGG - Intergenic
1040577642 8:48667685-48667707 ATTAGTAAGGGGAAGGGGGCTGG - Intergenic
1041000602 8:53446669-53446691 ATGGAGTAGGGGGAGGGGGAGGG + Intergenic
1041284818 8:56249515-56249537 AAGGGGAAGGGGAAGGGGAAAGG - Intergenic
1041284820 8:56249521-56249543 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1041284823 8:56249527-56249549 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1041284826 8:56249533-56249555 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1041284829 8:56249539-56249561 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1041517821 8:58721195-58721217 ATGGCTTAGTGGAAGGAGCAAGG + Intergenic
1041860567 8:62508350-62508372 ATGTCCAAGGTGGAGGGGGAGGG - Intronic
1042357997 8:67850585-67850607 GGGGCTAGGGGGAAAGGGGATGG - Intergenic
1042877886 8:73456523-73456545 TTTGCTAAGTGGGAGGGGGAGGG + Intronic
1043050239 8:75377049-75377071 ATGGGTTGGGGGAAGGGGGTGGG - Intergenic
1043401096 8:79885071-79885093 CAGGCTAAGTGGGAGGGGGAAGG + Intergenic
1043938284 8:86167973-86167995 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044782016 8:95752856-95752878 ATGGATAAGGGGAAGGTGTTGGG - Intergenic
1044812360 8:96076401-96076423 TGGGGTAGGGGGAAGGGGGAAGG + Intergenic
1045423894 8:102043737-102043759 ATGGGGAAAGGGAAGGGGAAGGG + Intronic
1045527263 8:102951780-102951802 ATTGGGAAGGGGAAGGGAGAGGG - Intronic
1045850832 8:106696821-106696843 GTGGCTAAGGGGTGGGGTGAGGG - Intronic
1045978793 8:108159806-108159828 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1046126074 8:109910226-109910248 AAGGGAAAGGGGAAGGGAGAGGG - Intergenic
1046218346 8:111179830-111179852 ATGGGGTAGGGGAAGGGGGGAGG - Intergenic
1046318399 8:112537019-112537041 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1046739411 8:117812540-117812562 AGAACTGAGGGGAAGGGGGAGGG - Intronic
1047523721 8:125615280-125615302 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1047523724 8:125615286-125615308 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1048034533 8:130665010-130665032 AGGGGTGAGGGGAAGGGGAAAGG - Intergenic
1048472833 8:134718702-134718724 AAGGATAAGGGGTAGAGGGAGGG + Intergenic
1048588907 8:135802917-135802939 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1048862067 8:138730873-138730895 ATGGCTAGATGGGAGGGGGAGGG + Intronic
1049348396 8:142151241-142151263 ATGGATAAGTGGATGGGTGATGG + Intergenic
1049352860 8:142173335-142173357 ATGGCTCAGGGGGAAGGAGATGG + Intergenic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049712396 8:144071232-144071254 AGGGGGGAGGGGAAGGGGGAGGG - Intergenic
1050003150 9:1099669-1099691 ATAGCTATGAGGAGGGGGGATGG + Intergenic
1050358550 9:4805396-4805418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1050490865 9:6186563-6186585 AAGGTGAAGGGGAAGGGGAAGGG + Intergenic
1050490868 9:6186569-6186591 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1050792214 9:9487201-9487223 TTGGGTGGGGGGAAGGGGGAGGG - Intronic
1050825262 9:9937075-9937097 TTGGGTTGGGGGAAGGGGGAGGG + Intronic
1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG + Intergenic
1051284600 9:15483347-15483369 ATGGTAAAGGGGGCGGGGGAGGG - Intronic
1051487320 9:17623045-17623067 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1051487323 9:17623051-17623073 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1051487326 9:17623057-17623079 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1051487329 9:17623063-17623085 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1051487332 9:17623069-17623091 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1051487335 9:17623075-17623097 ATAGGAAAGGGGAAGGGGAAGGG - Intronic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1051886572 9:21899396-21899418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1051977046 9:22963045-22963067 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1052482826 9:29053411-29053433 ATGGGTGGGGGGAAGGGGGAGGG + Intergenic
1052604540 9:30682074-30682096 ATGGGTTGGGGGAGGGGGGAGGG + Intergenic
1052976789 9:34417051-34417073 AAGGAGAAGGGGAAGGGGAAAGG - Intronic
1053330892 9:37206287-37206309 AGGGAGAGGGGGAAGGGGGAAGG - Intronic
1053507711 9:38658134-38658156 ATGGCTTAGAGGAGGTGGGAGGG + Intergenic
1053750909 9:41253903-41253925 AGGGGTAGGGGGATGGGGGAGGG - Intergenic
1053750914 9:41253910-41253932 ACGGTTGAGGGGTAGGGGGATGG - Intergenic
1054720500 9:68598726-68598748 ATGGCTATGAGGAGGGGGTAGGG + Intergenic
1055237703 9:74143876-74143898 ATGGGAATGGGGAAGGGAGATGG - Intergenic
1055450089 9:76423158-76423180 ATGCCTAATGGCAAGGGTGATGG - Intronic
1056096005 9:83254115-83254137 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1056246587 9:84701519-84701541 AGGGCTTAGGGGGTGGGGGAGGG + Intronic
1056431766 9:86535161-86535183 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1056431769 9:86535167-86535189 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1056431772 9:86535173-86535195 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1056431775 9:86535179-86535201 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1056431778 9:86535185-86535207 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1057042161 9:91855708-91855730 ATGGATGAGGGGAATGGGGGTGG + Intronic
1057220134 9:93253101-93253123 ATGGGGATGGGGAAGGGGGTGGG - Intronic
1057272582 9:93659195-93659217 ATGGCTAAGGTGAGGTGGCAGGG - Intronic
1057531978 9:95857039-95857061 ATTCCTAGGGGGAAGGGGAAGGG - Intergenic
1057905230 9:98977704-98977726 ATGGCTGAGGTCTAGGGGGATGG + Intronic
1058330145 9:103750470-103750492 AGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1058554651 9:106153871-106153893 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1058817561 9:108699036-108699058 AAGGCAAAGGGGAAGGGAAAGGG + Intergenic
1058817564 9:108699042-108699064 AAGGGGAAGGGAAAGGGGGATGG + Intergenic
1059300669 9:113310393-113310415 AAGGCTGAGGGGAAGGGGGCAGG - Intergenic
1059490806 9:114666018-114666040 AAGGGAAGGGGGAAGGGGGAAGG - Intergenic
1059745821 9:117200222-117200244 TTGGGTAGGGGGAGGGGGGAGGG - Intronic
1059949275 9:119445215-119445237 AGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1060057865 9:120431112-120431134 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
1060241383 9:121906668-121906690 AAGGGAAAGGGGAAAGGGGAAGG + Intronic
1060404137 9:123364770-123364792 ATGGTGAAGAGGAAGGGAGATGG - Intronic
1061004352 9:127920161-127920183 ATGGCTGAGGGGGAAGGGGGAGG - Intergenic
1061245111 9:129397571-129397593 ATGGATAAGGGGATGGTTGAAGG + Intergenic
1061331888 9:129899800-129899822 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1061331891 9:129899806-129899828 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1061355035 9:130098214-130098236 ATTCCTAAGGGGAGGTGGGAAGG + Intronic
1061422492 9:130479914-130479936 GTGGCTATGGGGAAGGGACATGG - Intronic
1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG + Intergenic
1061637473 9:131922022-131922044 ATGGGGAGGGGGGAGGGGGAGGG + Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061911816 9:133729036-133729058 ATGGATGAAGGGAAGGGGGATGG + Intronic
1062159514 9:135072410-135072432 GGGGCTAAGGGGAAGGAGGTTGG - Intergenic
1062532228 9:137007018-137007040 AAGGCTAAGGGGAAGGGGGCCGG + Intergenic
1062738052 9:138149558-138149580 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1203467798 Un_GL000220v1:104116-104138 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203475623 Un_GL000220v1:148092-148114 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203363548 Un_KI270442v1:238053-238075 AGGGACAAGGGGAAGAGGGAAGG + Intergenic
1203656780 Un_KI270753v1:5652-5674 TTGGCAAAGGGAAAGGGAGATGG - Intergenic
1185756923 X:2659753-2659775 AGGGGGAAGGGGAGGGGGGAGGG - Intergenic
1186293241 X:8121873-8121895 ATGGCTGAGGGGGATGGGGGAGG - Intergenic
1187039491 X:15578763-15578785 AAGGCTTAGGGGCAGGGGGGTGG + Intronic
1187045982 X:15647540-15647562 AGGGGGGAGGGGAAGGGGGAGGG + Intronic
1187051961 X:15703842-15703864 AGGGGGGAGGGGAAGGGGGAGGG + Intronic
1187407460 X:19016686-19016708 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1187596425 X:20777552-20777574 ATGGGGTAGGGGAAGGGGGGCGG + Intergenic
1187678633 X:21743537-21743559 TTGGCTGAAGGGAAGGGAGAAGG + Intronic
1187783871 X:22862157-22862179 AGGGAAAAGAGGAAGGGGGAAGG + Intergenic
1187805874 X:23119625-23119647 TTGGCTAAGGGGATTGGGGTGGG - Intergenic
1187943404 X:24403119-24403141 ATGGGGAGGGGGCAGGGGGAGGG - Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188110053 X:26186194-26186216 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1188360912 X:29252115-29252137 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1188501476 X:30831588-30831610 AGGATTAAGGGGGAGGGGGAAGG + Intronic
1188811205 X:34656559-34656581 ATGGCCACGGGGAAGGGAGAGGG + Intronic
1188839018 X:34991966-34991988 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1189117025 X:38353392-38353414 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
1189208271 X:39260668-39260690 AGGTGTAAGGGGAAGGGGCATGG - Intergenic
1189304931 X:39979717-39979739 GTGGCTAAATGGAAGAGGGATGG + Intergenic
1189320279 X:40083438-40083460 ATTAGTAAGGGGGAGGGGGAAGG + Intronic
1189684401 X:43548820-43548842 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1189684404 X:43548826-43548848 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1189758552 X:44297395-44297417 AGGGGAAAGGGGAAGGGGAAAGG + Intronic
1190089694 X:47427018-47427040 AAGGGAAGGGGGAAGGGGGACGG - Intergenic
1190298192 X:49040744-49040766 GTGGGGAAGGGAAAGGGGGATGG - Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190561953 X:51694986-51695008 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1190595472 X:52049158-52049180 GTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1190613352 X:52204915-52204937 GTGGGTAGGGGGAGGGGGGAGGG - Intergenic
1190618238 X:52260676-52260698 AGTGCTAAGTGGAAGGGTGAGGG + Intergenic
1190976101 X:55402504-55402526 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1191058390 X:56267946-56267968 GTGGCTAGTGGGGAGGGGGATGG - Intronic
1191579839 X:62748200-62748222 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
1192143922 X:68667896-68667918 ATGGCTTAGGAGAATGGGGCAGG - Intronic
1192418157 X:71003143-71003165 GGGGTTAAGGGGCAGGGGGATGG + Intergenic
1192432107 X:71119320-71119342 TTTCCTTAGGGGAAGGGGGAAGG - Intronic
1192448953 X:71230885-71230907 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1192737307 X:73861655-73861677 ATGGCTCCTGGGAATGGGGAGGG + Intergenic
1192936002 X:75859054-75859076 CAGGCTAAGGGGAAGGGGAATGG + Intergenic
1193089264 X:77476613-77476635 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1193340765 X:80346819-80346841 AGGGCTGGGGGGAAAGGGGAGGG - Intronic
1193422318 X:81296116-81296138 ATGGCAAAGGGTGAAGGGGAAGG + Intronic
1193595759 X:83442914-83442936 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1193721235 X:84990071-84990093 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1193721238 X:84990077-84990099 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1193801547 X:85942901-85942923 AGGGGTGAGGGGAGGGGGGAGGG - Intronic
1194348513 X:92796029-92796051 AGGGGGAAGGGGAGGGGGGAAGG + Intergenic
1194534684 X:95091687-95091709 GGGGTTAAGGGGAATGGGGAAGG + Intergenic
1194552633 X:95320340-95320362 ATGGCTAAGTGGAATGCTGAGGG - Intergenic
1194984287 X:100473361-100473383 ATGGATGAGGGGTGGGGGGAGGG + Intergenic
1195433004 X:104810264-104810286 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
1195767175 X:108308117-108308139 GTGGCTGAGGGGATGGAGGATGG - Intronic
1196151084 X:112375215-112375237 CTGGCTAGGAGGAAGAGGGATGG + Intergenic
1196171787 X:112596118-112596140 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1196316909 X:114237818-114237840 TGGGGTAAGGGGCAGGGGGAGGG - Intergenic
1196641611 X:118068907-118068929 CTGCCTGAGGGGATGGGGGAAGG - Intronic
1196782944 X:119399404-119399426 ATGGCTACGTGGAGGCGGGACGG + Exonic
1196827732 X:119754096-119754118 ATGACTAAGGAGAAAGGGGTGGG - Intergenic
1197292170 X:124672141-124672163 ATGACTAAGGGGAATGGAAAAGG - Intronic
1197373953 X:125659269-125659291 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1197457612 X:126697225-126697247 AGGGGGTAGGGGAAGGGGGAGGG + Intergenic
1197677469 X:129346093-129346115 ATTGCAAAAGGGAAGGTGGATGG + Intergenic
1198553101 X:137765072-137765094 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1199486824 X:148357489-148357511 ATGGCTCAGGTGAAGGTGGTTGG - Intergenic
1199875505 X:151924634-151924656 AGGGCTGTGGGGAAGGGGCAGGG + Exonic
1200049323 X:153420384-153420406 GTGGCAAAGGGGGCGGGGGAGGG + Intronic
1200049848 X:153422971-153422993 AGGGCTAAGGGGAAGAGGGGTGG - Intergenic
1200847427 Y:7845315-7845337 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
1201230143 Y:11856266-11856288 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1201434154 Y:13938951-13938973 ATGGGTGAGGGGGAGAGGGAAGG - Intergenic