ID: 1133580152

View in Genome Browser
Species Human (GRCh38)
Location 16:7136938-7136960
Sequence CTCGTCATGGCCCATGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133580142_1133580152 27 Left 1133580142 16:7136888-7136910 CCTGGGCAGGAAGGAGGCATCTA 0: 1
1: 0
2: 1
3: 14
4: 314
Right 1133580152 16:7136938-7136960 CTCGTCATGGCCCATGGGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133580152 Original CRISPR CTCGTCATGGCCCATGGGCC AGG Intronic
900587302 1:3439540-3439562 CTGGTCCTGGCCCATGGCCTGGG + Intergenic
904131938 1:28281784-28281806 CTGGCCATGGCCCAGGGGCAGGG - Exonic
905104627 1:35557255-35557277 CTCCTCCTGGTCCATGGGCTCGG + Exonic
905442306 1:38003462-38003484 CTCAGCAAGCCCCATGGGCCTGG - Intronic
905649251 1:39645627-39645649 TTCATCCTGGGCCATGGGCCAGG - Intergenic
910127579 1:83860787-83860809 TTCTTCGGGGCCCATGGGCCAGG - Intergenic
911378199 1:97077467-97077489 CTTGCAATGGCCCATGGGCAGGG - Intergenic
924905935 1:248452785-248452807 CTTGTCATGGACCATGGGCATGG + Exonic
924921954 1:248639249-248639271 CTTGTCATGGACCATGGGCATGG - Exonic
1067768960 10:49109896-49109918 TTTAACATGGCCCATGGGCCAGG - Intronic
1068685344 10:59865173-59865195 TTAGTCATTGCCCCTGGGCCAGG - Intronic
1071719791 10:88131722-88131744 CCGGTCATGGCTCCTGGGCCAGG + Intergenic
1077506929 11:2933893-2933915 CCCAACATGGCCCATGTGCCAGG + Intergenic
1078428288 11:11268719-11268741 CTGGTCCTGGTCCCTGGGCCGGG + Intergenic
1089957104 11:122581636-122581658 CTCGTCTTGGCCTCTGGGCCGGG + Intergenic
1090049637 11:123366424-123366446 ACCGGCATGCCCCATGGGCCTGG + Intergenic
1096841968 12:54385275-54385297 CTCGACCTGGCCTATGGGCGGGG + Intronic
1102157415 12:110742508-110742530 CTCGAGTTGGCCCACGGGCCGGG - Intronic
1106448039 13:29854046-29854068 CTGGTCATGGCCCAGGGGCAGGG + Intergenic
1108021842 13:46135778-46135800 CACTACATGGCCCATGGCCCAGG + Intronic
1120849857 14:89160029-89160051 CTCGTCCTGGCAGATGGGCTTGG + Exonic
1122417342 14:101556752-101556774 CTTGTCAGGGCCCCAGGGCCTGG - Intergenic
1123470614 15:20549428-20549450 ACAGCCATGGCCCATGGGCCTGG - Intergenic
1123647446 15:22451272-22451294 ACAGCCATGGCCCATGGGCCTGG + Intergenic
1123730914 15:23144406-23144428 ACAGCCATGGCCCATGGGCCTGG - Intergenic
1123749053 15:23341832-23341854 ACAGCCATGGCCCATGGGCCTGG - Intergenic
1123931741 15:25175300-25175322 GGTGTCATGGGCCATGGGCCAGG + Intergenic
1124281425 15:28365715-28365737 ACAGCCATGGCCCATGGGCCTGG - Intergenic
1124301278 15:28545906-28545928 ACAGCCATGGCCCATGGGCCTGG + Intergenic
1124372113 15:29109900-29109922 CTCGTCCTGGCACCTGTGCCAGG - Intronic
1124883328 15:33661700-33661722 CTGGTCCTGGTCCATGGCCCCGG + Intronic
1125790520 15:42362054-42362076 CTGGTCAAGGCCCTTGGGCGTGG - Intronic
1129204092 15:74025144-74025166 CTCTTGATGGGCCATGAGCCAGG + Intronic
1133580152 16:7136938-7136960 CTCGTCATGGCCCATGGGCCAGG + Intronic
1139047573 16:63081324-63081346 CTCCAAGTGGCCCATGGGCCAGG + Intergenic
1139335704 16:66229604-66229626 CTCTTTATGGGTCATGGGCCAGG - Intergenic
1139489360 16:67278425-67278447 CTCCCCAGGGACCATGGGCCTGG + Exonic
1139953253 16:70681870-70681892 CTCCACAGGGCCCTTGGGCCAGG - Intronic
1141458478 16:84161280-84161302 CTCAGCATGGCCCCTGGGGCGGG - Intronic
1141803304 16:86325129-86325151 CTGGTCATGGCCTGTGAGCCAGG + Intergenic
1144335044 17:14261134-14261156 CTCCTCATGTCTCATTGGCCAGG - Intergenic
1155166770 18:23238040-23238062 CATGTCCTGGCCCATGAGCCGGG + Intronic
1159518598 18:69489370-69489392 CCAGTGATGGACCATGGGCCAGG + Intronic
1161323556 19:3652355-3652377 CACGTCCTTGCCCATGGGCCTGG - Intronic
1163437610 19:17304691-17304713 CTCCTCAAGGGCCAGGGGCCTGG - Intronic
1164708670 19:30339239-30339261 GTCCACAGGGCCCATGGGCCAGG + Intronic
1165465269 19:35970856-35970878 CTTGTCATGCCTCAAGGGCCAGG + Intergenic
1166300061 19:41908140-41908162 CTGGTCCTGGGCCTTGGGCCAGG + Intronic
1166375385 19:42324542-42324564 CCGGTCATGGCCCATGGGGCAGG - Intronic
928412709 2:31066947-31066969 CCCGACATTGCCCAGGGGCCTGG + Intronic
930154682 2:48093956-48093978 CTCATCATGGACCTGGGGCCTGG + Intergenic
931582551 2:63792749-63792771 CTCATCATGGCCCTTGTGGCTGG + Intronic
932441981 2:71743310-71743332 CTCCTCCTGGCCCATGGAACTGG - Intergenic
933837576 2:86258261-86258283 CTGGATTTGGCCCATGGGCCAGG - Intronic
934577718 2:95413615-95413637 GTCCACATGGCCCAGGGGCCAGG + Exonic
937821125 2:126312297-126312319 CTAGGCATGGCCCATGTCCCTGG + Intergenic
938734606 2:134175026-134175048 TTCCTCCTGGCCCATGGGCAGGG + Intronic
942430629 2:175907405-175907427 CTAGTACTGGCCCATGGCCCAGG + Intergenic
944636586 2:201681094-201681116 GTCATGATGGCCCATGGGCAAGG - Intronic
948148078 2:235723581-235723603 CTCGGGAGGGCCCATGGCCCAGG - Intronic
1170769182 20:19317521-19317543 GAAGGCATGGCCCATGGGCCTGG - Intronic
1171971922 20:31570021-31570043 CCAGTCATGGCACAAGGGCCAGG + Exonic
1172102287 20:32492407-32492429 CTAGTCACTGCCCCTGGGCCAGG - Intronic
1172626668 20:36351270-36351292 CTGGTCATGGCCCAAGGGTTGGG - Intronic
1173470049 20:43316476-43316498 CCTGTCCTGGCCCATGGGGCTGG - Intergenic
1175419120 20:58820294-58820316 CTCGTCTTGGCAGCTGGGCCAGG - Intergenic
1175759952 20:61555504-61555526 ATCGTCATGGCAAATGGACCGGG - Intronic
1180130464 21:45823647-45823669 CAATTCAGGGCCCATGGGCCTGG + Intronic
1183676529 22:39301870-39301892 CTCGTTGTGCCCCATGAGCCAGG - Intergenic
1183737224 22:39650794-39650816 CCTGTGATGGCCCAGGGGCCTGG - Intronic
1183834383 22:40440250-40440272 CTCTTCATAGCCCATGAGGCAGG + Intronic
1184785027 22:46667553-46667575 GTGGTCCTGCCCCATGGGCCGGG - Intronic
949927002 3:9049342-9049364 CTCTTAATGGCCAATAGGCCAGG - Intronic
953888951 3:46736372-46736394 CTTGCCATGGCCTGTGGGCCGGG - Exonic
953914404 3:46909291-46909313 GTCCTCTTGGCCCCTGGGCCAGG - Intergenic
954089771 3:48274691-48274713 CTCTGCAAGACCCATGGGCCAGG + Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
969697447 4:8742750-8742772 CCAGTCCTGGCCCATGGCCCCGG + Intergenic
982758309 4:159250955-159250977 CTCGTGCTGGCCCATGAGCGTGG - Intronic
992086741 5:73284415-73284437 CTCATCATGGCCCCTGGCCCTGG - Intergenic
992980433 5:82165227-82165249 CTCATCTTGGTCCCTGGGCCTGG - Intronic
997624698 5:135323860-135323882 CTTCTCCTTGCCCATGGGCCTGG - Intronic
998043430 5:138968046-138968068 CTCGTTATAGCCCAGTGGCCAGG - Intronic
1002909929 6:1482072-1482094 CACGTACTGTCCCATGGGCCTGG - Intergenic
1005526883 6:26659798-26659820 CTCCTATTGGCCCAGGGGCCGGG - Intergenic
1007384397 6:41510908-41510930 CTCGTCAGGGCCACAGGGCCAGG + Intergenic
1019551401 7:1604409-1604431 CTCCCCCTGGCCCCTGGGCCTGG - Intergenic
1021039688 7:15846547-15846569 TTCTTCATGGCCTATGGGCATGG + Intergenic
1023262101 7:38368432-38368454 CTGGTCATGGCCCTTGGGAGAGG + Intergenic
1034256582 7:149728109-149728131 CCCGCCATGGCCCAGAGGCCAGG + Intronic
1035450946 7:158976453-158976475 CCCTTCATGGCCCCTGGGCTTGG - Intergenic
1036564440 8:9926333-9926355 CTCGCCATTCCCCATGGGCAGGG + Intergenic
1038481821 8:27907191-27907213 CCCATCATCGCCCTTGGGCCCGG + Exonic
1045207135 8:100054871-100054893 CTCCTCATGGCCCATGGTGATGG + Intronic
1048459996 8:134613703-134613725 CTCCTCAGAGCCCATTGGCCAGG - Intronic
1049363573 8:142225702-142225724 CTCATCACGGGCCATGGGGCAGG - Intronic
1051628636 9:19122662-19122684 CTGGTAATGGTCCATGGCCCGGG - Intronic
1056790710 9:89623625-89623647 CTCCTCATTGCCGCTGGGCCTGG - Intergenic
1057854496 9:98592151-98592173 CTGGACATGGCCCATGAGACAGG + Intronic
1061926773 9:133809764-133809786 CTCACCCTGGACCATGGGCCAGG - Intronic
1062126432 9:134865384-134865406 CTCGTGGTGGACCAGGGGCCAGG + Intergenic
1062561212 9:137142880-137142902 CTCCTCATAGCCTGTGGGCCAGG - Intronic
1190989885 X:55536190-55536212 CTGGTCTTGTCCCATGGGCAAGG + Intergenic
1195050768 X:101094681-101094703 ATCGTCATGACCCTTGTGCCTGG + Exonic
1198693776 X:139313666-139313688 CTATTCATGGTCCCTGGGCCAGG + Intergenic
1200087031 X:153611987-153612009 CTCGTCTTGGCCTCTGGCCCCGG - Intergenic
1201237361 Y:11923998-11924020 CTGAGCATGGCTCATGGGCCTGG - Intergenic