ID: 1133583400

View in Genome Browser
Species Human (GRCh38)
Location 16:7167912-7167934
Sequence GTGCTTGTCTGGGGATGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 351}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133583391_1133583400 29 Left 1133583391 16:7167860-7167882 CCTCTGCGAAAAAAGTGTGCCAA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1133583400 16:7167912-7167934 GTGCTTGTCTGGGGATGCTGCGG 0: 1
1: 0
2: 5
3: 25
4: 351
1133583395_1133583400 10 Left 1133583395 16:7167879-7167901 CCAACCGCTCTTCTAGGGAGGTG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1133583400 16:7167912-7167934 GTGCTTGTCTGGGGATGCTGCGG 0: 1
1: 0
2: 5
3: 25
4: 351
1133583390_1133583400 30 Left 1133583390 16:7167859-7167881 CCCTCTGCGAAAAAAGTGTGCCA 0: 1
1: 1
2: 1
3: 7
4: 135
Right 1133583400 16:7167912-7167934 GTGCTTGTCTGGGGATGCTGCGG 0: 1
1: 0
2: 5
3: 25
4: 351
1133583396_1133583400 6 Left 1133583396 16:7167883-7167905 CCGCTCTTCTAGGGAGGTGTTTA 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1133583400 16:7167912-7167934 GTGCTTGTCTGGGGATGCTGCGG 0: 1
1: 0
2: 5
3: 25
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133583400 Original CRISPR GTGCTTGTCTGGGGATGCTG CGG Intronic
900149270 1:1171142-1171164 GTGCCTGGCTGGGGAGCCTGGGG + Intergenic
900366021 1:2312313-2312335 GACCTTGTCTGGGGAGGCAGCGG + Intergenic
900432221 1:2607761-2607783 CTGCTGGCCTGGGGAGGCTGTGG + Intronic
900879957 1:5373662-5373684 TTGATTGGCTGGGAATGCTGTGG + Intergenic
901268290 1:7929669-7929691 GTGGTTGCCAGGGGATGGTGGGG + Intronic
902990393 1:20183641-20183663 GAGCTTTTGTGGGGAGGCTGTGG + Intergenic
903240635 1:21980587-21980609 GTGCTGGTGTGGGGAGGCTTTGG + Intronic
903244378 1:22005210-22005232 GTGCTGGTGTGGGGAGGCTTTGG + Intronic
903763010 1:25712412-25712434 CTGCTAGGCTGGGGCTGCTGTGG - Intronic
903833891 1:26190437-26190459 GAGGAAGTCTGGGGATGCTGTGG - Intergenic
905209406 1:36363185-36363207 GCGCCTGTCTCGGGAGGCTGAGG + Intronic
905458761 1:38106947-38106969 GTGCGTTTCTGGGGCGGCTGTGG + Intergenic
906107741 1:43304918-43304940 TTGCGTGTCTGGGGAGGCCGGGG + Exonic
906137665 1:43510967-43510989 ATGCTGGTCTGGGCCTGCTGCGG + Intergenic
906196093 1:43931689-43931711 AGGCCTGCCTGGGGATGCTGGGG - Intergenic
906801189 1:48738492-48738514 GTGCCAGACTGGGCATGCTGGGG + Intronic
912264133 1:108138292-108138314 CTGCTTGGCTGGGGTTGCTGTGG + Intronic
913092399 1:115486461-115486483 GTGCTTATGTGGGGTTGTTGGGG + Intergenic
915284696 1:154845376-154845398 GTGGCTGTCTGGGGCTCCTGGGG - Intronic
916222535 1:162459312-162459334 GTGGTTGTCTGGGAATGAGGGGG + Intergenic
916597980 1:166263980-166264002 GTGATTGTCTGGGGCTAGTGAGG - Intergenic
917205194 1:172564214-172564236 GTGCTCCAGTGGGGATGCTGGGG - Intronic
917349948 1:174066642-174066664 ATGCTTGTCTGGAGACTCTGGGG + Intergenic
918312015 1:183291691-183291713 CTGATCTTCTGGGGATGCTGGGG - Intronic
918778219 1:188665674-188665696 GTGCTTTTATGGGGTTGGTGGGG - Intergenic
922019376 1:221688300-221688322 GTGCTTTCCTGGGGCTGATGTGG - Intergenic
1063547055 10:6991650-6991672 GCGCATGTCTGGGCATGCTGTGG + Intergenic
1064342150 10:14497021-14497043 GGGCCTGTCGGGGGAGGCTGGGG + Intergenic
1066299543 10:34084715-34084737 CTGCTGGCCTGGGGGTGCTGTGG - Intergenic
1066489193 10:35877673-35877695 TTGCTTGTCTGGGGTTGCATGGG + Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1067309331 10:45097507-45097529 TTGCTTGTCTGGGGCTGCCTGGG + Intergenic
1067558877 10:47290595-47290617 GTGCCTGCCTGGAGCTGCTGTGG - Intergenic
1067880878 10:50043809-50043831 GTGCTTAGCTGAGCATGCTGTGG + Intergenic
1068117616 10:52751773-52751795 GTCCCTGTCTGGGGATGGAGAGG - Intergenic
1069855716 10:71439877-71439899 GTGCTGATCTCTGGATGCTGGGG + Intronic
1069855887 10:71440797-71440819 GCTCTTCTCTGGGGATGCTATGG - Intronic
1069957918 10:72062956-72062978 GCCCTTGTCGTGGGATGCTGGGG - Intronic
1071385551 10:85116626-85116648 GTGGTTGCCTGGGGATGGGGAGG - Intergenic
1071826211 10:89328829-89328851 GTGGTTGCCTGGAGATGGTGGGG + Intronic
1073448524 10:103595462-103595484 GTGCATGTTTGGGGTAGCTGGGG - Exonic
1074095742 10:110310744-110310766 GTGTGTGTTTGGGGATGATGGGG + Intergenic
1074232979 10:111556024-111556046 GTGCTTTTCTGGGCAAGCAGGGG + Intergenic
1075036628 10:119074800-119074822 GTGCATGCCTGCGGAGGCTGAGG + Intronic
1075797944 10:125134643-125134665 CCGCGTGTCTGGGGCTGCTGTGG - Intronic
1076200999 10:128557797-128557819 GGGCTGGGCTGTGGATGCTGAGG + Intergenic
1076474660 10:130743806-130743828 GTTGGTGTCTGGGGAAGCTGGGG - Intergenic
1076898223 10:133324738-133324760 GGGCTGGGGTGGGGATGCTGGGG + Intronic
1076898232 10:133324758-133324780 GGGCTGGGGTGGGGATGCTGGGG + Intronic
1076898241 10:133324778-133324800 GGGCTGGGGTGGGGATGCTGGGG + Intronic
1076945489 10:133646324-133646346 CTGATAGTGTGGGGATGCTGGGG + Intergenic
1076995920 11:297447-297469 GTGGGTGTGTGGGGAGGCTGTGG + Intergenic
1077060742 11:616918-616940 GAGATTGCCTGGGGAGGCTGAGG - Exonic
1077393461 11:2310193-2310215 GGGCTCGTCTGGGGCAGCTGCGG + Intronic
1077435133 11:2535282-2535304 GTGTCTGTCTGGGGCAGCTGGGG + Intronic
1077472446 11:2770377-2770399 GTGCTGGCCTGGGGTTGCTGGGG - Intronic
1078078838 11:8188197-8188219 GGGCTTGTCGGGGGACGGTGGGG - Intergenic
1078328587 11:10400503-10400525 GTGGGTGTCTGGGGCTGCTTGGG - Intronic
1079329158 11:19519865-19519887 GGCCTTCTCTGGGAATGCTGAGG + Intronic
1080313839 11:30925979-30926001 GTGCTTGTTTGGGAAGGCAGGGG - Intronic
1081406991 11:42709525-42709547 TTGCTTCTCTGGGTATGCAGGGG - Intergenic
1081912855 11:46711277-46711299 CTGTTGGCCTGGGGATGCTGTGG - Intergenic
1081925695 11:46826553-46826575 GTGCTTGTTTGGGCATGCAGTGG - Intronic
1082188336 11:49210989-49211011 GTGCTTGTAAGAGGATGCTTGGG - Intergenic
1083062238 11:59886045-59886067 GGGCTTGTCAGGGGAGGGTGGGG - Intergenic
1083620780 11:64048369-64048391 GCCCTTGTCTGTGGAGGCTGGGG + Intronic
1084421999 11:69065168-69065190 GTGCCTGTCTGTGGGTGGTGGGG + Intronic
1084464331 11:69313378-69313400 GGGCTAGACTGGGGAAGCTGAGG + Intronic
1084681908 11:70671336-70671358 GCGCTGGTTTGGGGAAGCTGGGG - Intronic
1085513751 11:77100623-77100645 GTGCTTGTATGGGGACGCTGTGG - Intronic
1086014632 11:82152361-82152383 ATGGTTGTCTGAGGATGGTGCGG - Intergenic
1086176440 11:83896668-83896690 GTGGTTGTCTGGGGCTGGGGTGG + Intronic
1086678185 11:89635654-89635676 GTGCTTGTAAGAGGATGCTTGGG + Intergenic
1087107413 11:94423950-94423972 GTGCTGGTCTGGGAAGGGTGTGG + Intronic
1088196340 11:107278164-107278186 GAGCTTGTCTGGATTTGCTGGGG + Intergenic
1088874808 11:113926033-113926055 GTGTTTGCCTAGGGCTGCTGGGG - Intronic
1089197259 11:116701559-116701581 GGGCTTGTCTGGATCTGCTGTGG + Intergenic
1089345010 11:117785436-117785458 ATGCATGTTGGGGGATGCTGTGG + Intronic
1089647358 11:119889029-119889051 GAGCTTATCTGGTGATGGTGGGG + Intergenic
1092259308 12:6944231-6944253 CTGCTGGTCTGGGGAGGATGCGG + Intronic
1094169501 12:27478220-27478242 GTGCTTATTTGTGGAGGCTGTGG + Intronic
1094698039 12:32841195-32841217 GTGCTTTTCTAGGTTTGCTGTGG - Exonic
1096581204 12:52586517-52586539 GAGCCTGTGTGGAGATGCTGTGG - Intronic
1096717296 12:53499298-53499320 GTGATGGCGTGGGGATGCTGAGG - Intronic
1096772998 12:53948293-53948315 GTGCATGTCTGTGGAGGCTGAGG + Intergenic
1096813007 12:54183585-54183607 ATGCTTGGCTGGGTGTGCTGTGG - Intronic
1096839519 12:54371666-54371688 CTGTTTCTCTGGGGATCCTGGGG + Exonic
1099613963 12:84912190-84912212 GTAGGTCTCTGGGGATGCTGTGG + Intronic
1100160328 12:91852779-91852801 GTGGTTGCCTGGGGCTGCGGTGG + Intergenic
1102076443 12:110063967-110063989 GTTCTTGTCTGGAGACTCTGGGG - Intronic
1102150650 12:110687561-110687583 GGGCTTGGCAGGCGATGCTGGGG + Intronic
1102543161 12:113636945-113636967 GTGCTGGTCTGTGGGTTCTGGGG - Intergenic
1103238154 12:119391634-119391656 GTGCATGTCATGTGATGCTGCGG + Intronic
1103789072 12:123456518-123456540 GTGGTTATCAGGGGCTGCTGTGG - Intergenic
1103852156 12:123940327-123940349 GAGCTTCTCTCAGGATGCTGTGG - Intronic
1104962304 12:132494005-132494027 GTGCTGGGCTGGGTGTGCTGGGG + Intronic
1105988753 13:25596443-25596465 GTGCTTGCCTGGGGATATGGAGG - Intronic
1107568785 13:41634022-41634044 GTGCCTGTCTTGGGAGGTTGAGG + Intronic
1107585262 13:41840302-41840324 GGGCCTGTCTGGGGATGGCGGGG + Intronic
1108740087 13:53328138-53328160 GTGCTTTTCTGTGAATGCTCTGG + Intergenic
1109441409 13:62379534-62379556 GTGCTCGTCTGGGGAGGCTCAGG - Intergenic
1110171317 13:72504076-72504098 GTGGTTCTCTGGGAATTCTGGGG - Intergenic
1110983925 13:81939431-81939453 GCGCTTGGCTGGGTATGCTGGGG + Intergenic
1112083204 13:95999265-95999287 GTACTTATCTGGGTATGGTGTGG - Exonic
1112319737 13:98395452-98395474 GTGCTTGGCTGCGGGGGCTGAGG - Exonic
1112443628 13:99444098-99444120 GGGCTTGTCTGGGGGTGATGGGG - Intergenic
1114670864 14:24410227-24410249 GGGGTGGGCTGGGGATGCTGTGG + Intronic
1115450591 14:33543002-33543024 GGGCATGTCTGGGGGTGATGGGG - Intronic
1118826195 14:69384471-69384493 TTACTTGTCTTGGGAGGCTGTGG - Intronic
1119071392 14:71588349-71588371 GAGCTTTTCTGGGGGAGCTGGGG - Exonic
1120129392 14:80787209-80787231 GCGCTTGTCTGGAGGTTCTGAGG + Intronic
1121991626 14:98563353-98563375 GTGCTGGTTTGGGGACACTGTGG - Intergenic
1122278345 14:100606920-100606942 GGGAGTGTCTGGGCATGCTGGGG - Intergenic
1122714272 14:103684566-103684588 GTGCTGGTCTGGGTCTGCAGAGG + Intronic
1122875219 14:104660755-104660777 GCTCCTGCCTGGGGATGCTGGGG + Intergenic
1123006780 14:105327608-105327630 GTACTTGCCTGGGGAGGATGTGG + Intronic
1123917061 15:25041989-25042011 ATAATTGTCTGAGGATGCTGAGG + Intergenic
1123951254 15:25278358-25278380 ATAATTGTCTGAGGATGCTGAGG + Intergenic
1124857108 15:33399705-33399727 GTTCTTGCCTGGGGGTGTTGAGG - Intronic
1126793809 15:52243849-52243871 TGGCTTGGCTGGGGCTGCTGTGG + Intronic
1127537969 15:59908346-59908368 GTCCTTCTCTGGGGAAGGTGTGG + Intergenic
1127595312 15:60476270-60476292 GAGATTGTCTGGGGATGGGGGGG - Intronic
1128213711 15:65919744-65919766 GTGCCTATCTGGGGAGGCTAAGG - Intronic
1128648803 15:69395906-69395928 GGGTTTGTCTTGGGAGGCTGTGG + Intronic
1129228529 15:74183734-74183756 GAGTTTGTCTGGGAATGCTCTGG - Intronic
1129269278 15:74410978-74411000 GGCCTTGTCTGGGGAGGCAGTGG + Exonic
1129772646 15:78212687-78212709 GGGCCTCTCTGGGGCTGCTGTGG - Intronic
1130398632 15:83529109-83529131 GTGGTTGTTAGTGGATGCTGTGG + Intronic
1132544935 16:528542-528564 GTGTTCCTCTGGGGCTGCTGCGG + Intronic
1132903598 16:2271258-2271280 GTGCCTGTCTGGAGAGGGTGGGG + Intergenic
1133583400 16:7167912-7167934 GTGCTTGTCTGGGGATGCTGCGG + Intronic
1134134803 16:11671171-11671193 GGGGTTGTTTGAGGATGCTGGGG + Intronic
1134193053 16:12137281-12137303 GTAGGTGGCTGGGGATGCTGAGG + Intronic
1134628765 16:15741725-15741747 ATGCATGGCTGGGGTTGCTGGGG - Intronic
1135247213 16:20867289-20867311 TTGCTGCTCTGGGGTTGCTGTGG - Intronic
1136362357 16:29789154-29789176 GTGGTTGCCAGGGGATGGTGAGG - Intergenic
1137496048 16:48970247-48970269 GGCCTTTTCTTGGGATGCTGAGG + Intergenic
1137713259 16:50581958-50581980 TTGGTTGTTTGGGGCTGCTGGGG + Intronic
1138587055 16:57977498-57977520 GTGTGTTTCTGGGGAGGCTGGGG - Intronic
1139821763 16:69726653-69726675 GTGCTGGGCGGAGGATGCTGAGG + Exonic
1139964796 16:70739331-70739353 GTGCTTTCCTGGGGCTGGTGTGG + Intronic
1140705898 16:77628937-77628959 GTCCCTGTCTGGTCATGCTGGGG - Intergenic
1140758262 16:78088483-78088505 GTGCCTTTCTGGGGACTCTGGGG + Intergenic
1141233376 16:82192598-82192620 GAGCTTGTCTGGGGATTCTGGGG + Intergenic
1141278485 16:82608884-82608906 GTGGTTGTCAGGGGATGAAGGGG + Intergenic
1141418099 16:83892599-83892621 GTGCATGCCTAGGGAGGCTGAGG - Intergenic
1142470062 17:158259-158281 GGGTTTGTCTGGGGGGGCTGAGG - Intronic
1143146275 17:4778219-4778241 GTGTTTCTCTGAGGTTGCTGGGG + Intronic
1143364206 17:6395222-6395244 GGGCTGGGATGGGGATGCTGAGG + Intronic
1143609932 17:8012351-8012373 GTGTGTGTCTGGGGGTGGTGGGG + Intronic
1144874004 17:18387555-18387577 CTTCTTGTCTGGGGCTGCTTTGG - Intronic
1145158469 17:20558228-20558250 CTTCTTGTCTGGGGCTGCTTTGG + Intergenic
1146603545 17:34238649-34238671 GTGGTTCTCTGTGGATCCTGAGG + Intergenic
1146729847 17:35183887-35183909 GTGCTTCTCTTGGGAAGCTCTGG - Intronic
1146885004 17:36464686-36464708 CTGCTTTTCTGGGGAAGCCGTGG - Intergenic
1147135504 17:38431793-38431815 GTCCTTGTCTGCCGAGGCTGAGG - Intronic
1147136384 17:38436345-38436367 GATGTGGTCTGGGGATGCTGAGG + Intronic
1147411826 17:40258605-40258627 GAGCTTGTATGGTGATGTTGGGG + Intronic
1147426148 17:40346785-40346807 CTGCTGGGCTGGGGATGGTGTGG + Intronic
1149377904 17:56064343-56064365 GTGCTGGTCTGCGGAGACTGCGG + Intergenic
1149503108 17:57170227-57170249 GTGGTTGTCAGGGGCTGGTGAGG + Intergenic
1150125171 17:62630503-62630525 GGGCTCTTCTGGGGATGATGTGG + Intronic
1151314877 17:73315686-73315708 CTGCCTGTCTGGGGCCGCTGGGG + Intergenic
1152333078 17:79684845-79684867 TTGCTTTTCTGAGGATCCTGGGG - Intergenic
1203164790 17_GL000205v2_random:84043-84065 CTGATAGTGTGGGGATGCTGCGG + Intergenic
1156432755 18:37092986-37093008 GTGGTTGTCTGTGTAAGCTGTGG - Intronic
1156492024 18:37501924-37501946 GTTCTCTTCTGGGGAAGCTGGGG + Intronic
1157223720 18:45844774-45844796 CTCCTTGTATGGGGATGCTTTGG + Intergenic
1157260918 18:46174652-46174674 GTCCTTTTCCGGGGGTGCTGAGG + Intronic
1157597389 18:48872063-48872085 GTGCTTCACTGAGGATGGTGAGG - Intergenic
1157970086 18:52257250-52257272 GTACCTGGCTGGGTATGCTGTGG + Intergenic
1157991161 18:52498271-52498293 GTGCTTGTCTTAGGCTGCTTGGG + Intronic
1159532858 18:69677701-69677723 TTGCTTGACTGGTGATGTTGTGG + Intronic
1160029152 18:75243501-75243523 CTGCTTGTCTGGGTGGGCTGAGG + Intronic
1160322707 18:77911428-77911450 GTGGTTTTCTGGGGACGCTCAGG - Intergenic
1160531357 18:79566932-79566954 CTGCTTCTCTGAGGAGGCTGCGG + Intergenic
1160554968 18:79718972-79718994 GTCCCTGCGTGGGGATGCTGAGG + Intronic
1160703446 19:518578-518600 GGCCTGGGCTGGGGATGCTGGGG + Intronic
1160719725 19:591838-591860 GTGCTTGACTGGAGAAACTGAGG + Intronic
1161315602 19:3615897-3615919 GTGCTTGGCTGGGGCTGCCACGG - Intronic
1163142403 19:15358769-15358791 GTGCTTGCCTGGGGACTCTGGGG - Intronic
1163144688 19:15372597-15372619 GTGGTTGTCGGGGGCTGGTGGGG + Intronic
1163669861 19:18620995-18621017 GGGCTTGTCTGGGGCTGGGGAGG + Exonic
1164861345 19:31564604-31564626 GTTCTTGACTGGTGATGCTCTGG + Intergenic
1164941032 19:32252476-32252498 GGGCTGCTCTGGGGAGGCTGCGG - Intergenic
1165000842 19:32760752-32760774 GTGCTTTTCTAGGGATTCTTAGG + Intronic
1165363305 19:35350060-35350082 GTGCATGGCTGGGGACACTGGGG - Intergenic
1166541835 19:43610860-43610882 GTTCTGGGCTGGTGATGCTGGGG - Intronic
1167112028 19:47468225-47468247 AAGCTTGTCTGGTGAGGCTGAGG - Intronic
1167341320 19:48918245-48918267 GTGCTTGTCTGAGGGAGCCGAGG + Intronic
1167498181 19:49831205-49831227 GTGCTGTTCTGGGGATGGAGGGG + Intronic
1167630741 19:50625126-50625148 GTGCTTGTCAGGGGTCGGTGTGG + Intronic
1167719894 19:51172145-51172167 GTGCTTACCTGAGGATGATGAGG - Intergenic
1168589746 19:57623089-57623111 GTGGTTGCCTAGGGATTCTGGGG - Exonic
925190209 2:1876415-1876437 GTGCATGTGTGGGGGTGCTCTGG - Intronic
925817490 2:7767666-7767688 GTGCATGTCTGTGGGTGCGGCGG - Intergenic
927489683 2:23512890-23512912 GTACTTCTCTGTGCATGCTGTGG + Intronic
929821868 2:45280798-45280820 GTGGTTGTCGGGGGAGGCGGGGG - Intergenic
930023362 2:47014711-47014733 GGGCTTGGCTGGGCCTGCTGGGG - Intronic
930333316 2:50014506-50014528 GTGGTTGTGTGGGGATGTTTTGG - Intronic
931401350 2:61934155-61934177 GTGTGTGTCAGGGGATGGTGGGG + Intronic
932335944 2:70931514-70931536 ATGCCTGTCTGGGGATGGTGAGG - Intronic
932462398 2:71891428-71891450 GGGCTTCTCTGCGGGTGCTGCGG - Intergenic
934730994 2:96657587-96657609 GTGGTTGTCTGCGGATGGAGGGG - Intergenic
937056889 2:118945340-118945362 GTGCTTGTCTTGTTAGGCTGTGG - Intronic
938119749 2:128625177-128625199 GTGTTTGTTTGGGGCTGCTCTGG + Intergenic
938981852 2:136534672-136534694 GGGCTTGGCTGGGGTTGGTGGGG - Intergenic
940047243 2:149422766-149422788 ATGCTTGTCAGGAGATGATGGGG - Intronic
941732280 2:168932159-168932181 GGGCCTGTCAGGGGATGGTGTGG - Intronic
943033221 2:182710516-182710538 GTGCTTGCCAGGGGATGTGGTGG - Intergenic
944525267 2:200612376-200612398 ATGATTTTCTGGAGATGCTGGGG + Intronic
945786578 2:214246622-214246644 GTGAGTGGCTGGGGAAGCTGAGG - Intronic
946161249 2:217837342-217837364 GTGCCAGACTGGGGGTGCTGGGG - Intronic
947100687 2:226618164-226618186 GTGCTTGTGTGAGTGTGCTGGGG - Intergenic
947257335 2:228181107-228181129 GCGGGTGTCTGGGGCTGCTGGGG - Intronic
947595524 2:231409331-231409353 GAGATTGCCTCGGGATGCTGAGG + Intergenic
1168817799 20:752442-752464 CTCCTTGGCTGGGCATGCTGGGG - Intergenic
1169253391 20:4078067-4078089 GTGCTTGTTTGCGGTTGTTGAGG + Intergenic
1170181960 20:13541491-13541513 GTGCTTGTGTGTGGATGGTAGGG - Intronic
1170547568 20:17448209-17448231 GTGCTGGTCTGGGGTTGGTATGG - Intronic
1170752018 20:19157797-19157819 GTGCATTTCTGGTCATGCTGAGG + Intergenic
1171783475 20:29442418-29442440 CTGATAGTGTGGGGATGCTGGGG + Intergenic
1172242629 20:33423469-33423491 GGGCTTGGCTGGGGAGGGTGGGG - Intronic
1172433177 20:34909663-34909685 GTGCTTGACTGGGGACTATGAGG + Intronic
1173655076 20:44694493-44694515 GTGCTTTTTTGGGGAAGTTGGGG + Intergenic
1173908394 20:46645494-46645516 TGTCTTGTCTGGGGATGCTGAGG - Intronic
1174106198 20:48164099-48164121 GTGCTTGTGTAGGGGAGCTGGGG - Intergenic
1174177392 20:48653576-48653598 GCGCGTGTCTGGGGTTGCAGTGG - Intronic
1174647450 20:52098055-52098077 GACCTTGTCTTGGGATGCTGAGG + Intronic
1175192958 20:57223885-57223907 GTCCTCTCCTGGGGATGCTGGGG - Intronic
1175913709 20:62416103-62416125 GTGCTGCTCGGGGGGTGCTGGGG + Intronic
1176406962 21:6375044-6375066 CTGATAGTGTGGGGATGCTGCGG - Intergenic
1176936319 21:14871770-14871792 GTGTGTGTTTTGGGATGCTGGGG + Intergenic
1178510448 21:33200948-33200970 CTGTTTGCCTGGGGAGGCTGAGG - Intergenic
1179945551 21:44671532-44671554 GTGGTTGTCAGTGGAGGCTGTGG - Intronic
1181344795 22:22211236-22211258 GTGCCTGTGTAGGGATGCTCAGG - Intergenic
1181594337 22:23904613-23904635 GTGGGTGTCTGGGGTTGCTCAGG + Intergenic
1181773695 22:25144823-25144845 GGGCTTGTCTGGGGATTCCCAGG - Intronic
1182824078 22:33247855-33247877 GAGCTGGTCTGGAAATGCTGAGG + Intronic
1182861340 22:33561968-33561990 CTGGTTGTCTGGGGCTGCAGTGG - Intronic
1183735711 22:39643731-39643753 GTGCTTTCTTGGGGAGGCTGGGG + Intronic
1184238511 22:43199483-43199505 ATCCTTGTCTGGGGATGTTTTGG + Exonic
1185241413 22:49749520-49749542 AAGCTTGTCAGGGGAGGCTGGGG - Intergenic
1185359561 22:50397521-50397543 GAGCATGACTTGGGATGCTGGGG + Intronic
952108269 3:30093439-30093461 GTGGCTGTATGGGGATCCTGAGG - Intergenic
953553566 3:43924086-43924108 TGGGTTGTCTGGGCATGCTGAGG - Intergenic
953929203 3:46997588-46997610 CTGCTTTTCTGCTGATGCTGCGG + Exonic
955217553 3:56997084-56997106 GGCCCTGTGTGGGGATGCTGGGG - Intronic
957081996 3:75644144-75644166 CTGATAGTGTGGGGATGCTGGGG - Intergenic
957883552 3:86254003-86254025 GTGCATGTCTCAGGAGGCTGAGG - Intergenic
959338817 3:105101390-105101412 GTGTATGTTTTGGGATGCTGTGG + Intergenic
960388390 3:117049235-117049257 ACGCTTGTTGGGGGATGCTGTGG - Intronic
960719448 3:120611395-120611417 TTGGTTTTCTGGAGATGCTGTGG + Intergenic
961479736 3:127172028-127172050 GGGCTTGGCTGTGGATGATGGGG + Intergenic
961642923 3:128376140-128376162 GTGCTGGTCTGGGGATGGTGTGG - Intronic
963388325 3:144625348-144625370 GTTCTTCTCTGAGGCTGCTGTGG + Intergenic
969230365 4:5826430-5826452 GGGCAGGGCTGGGGATGCTGTGG + Intronic
973808257 4:54546119-54546141 GTCCTGGTCTGGGGTTCCTGTGG + Intergenic
975590311 4:75993283-75993305 GTGTTTGTCTGGGGATGATGAGG - Intergenic
977033875 4:91924810-91924832 GAGCTTGAGTGGGGAAGCTGAGG + Intergenic
977326830 4:95584592-95584614 GTGGTTGTTTGTGGAGGCTGTGG + Intergenic
978361084 4:107931708-107931730 GTGCGCCTCTGGGGCTGCTGCGG + Exonic
979363819 4:119796408-119796430 GTGTTTGTCTGGGGTGGTTGTGG + Intergenic
982717876 4:158827831-158827853 GTGCTTGCCAAGGGAGGCTGGGG - Intronic
983323750 4:166227374-166227396 GAGATGGGCTGGGGATGCTGAGG + Intergenic
984017927 4:174447750-174447772 GTTATTGTCTGGAGATTCTGGGG + Intergenic
984756227 4:183328085-183328107 GGGCTTGGCTGAGGATTCTGAGG - Intergenic
985448875 4:190046836-190046858 CTGATAGTGTGGGGATGCTGGGG + Intergenic
985580883 5:694494-694516 GTGCTGGGCAGGGGGTGCTGAGG + Intergenic
985595508 5:785826-785848 GTGCTGGGCAGGGGGTGCTGAGG + Intergenic
986233119 5:5885031-5885053 GTGCTTGTCTGGAACTCCTGAGG + Intergenic
986966898 5:13284506-13284528 GTTCTTGTTTGTGGAAGCTGTGG + Intergenic
987183012 5:15386210-15386232 GAGCTGCTCTGGGGCTGCTGAGG + Intergenic
987288121 5:16480159-16480181 GTGGTTGCCTGGGGATGAGGTGG - Intronic
989534750 5:42550683-42550705 GAGTTTGAATGGGGATGCTGAGG + Intronic
990761373 5:59133675-59133697 CTGCTTTACTGGGGCTGCTGTGG - Intronic
990786196 5:59423225-59423247 ATGCTTCCCTGGGGATGATGAGG - Intronic
991478524 5:67050356-67050378 GTGCTTGGGTGGAGATGCTTTGG - Intronic
992882716 5:81126571-81126593 GTGGTTGCCTAGGGCTGCTGGGG - Intronic
993953111 5:94199883-94199905 GTGCTTTAGTGGGGAAGCTGAGG + Intronic
995704137 5:114968400-114968422 GTGGTTGTCAGGGGACGGTGGGG + Intergenic
996691559 5:126345864-126345886 GAGCTTTTCTGGGGAAGTTGAGG - Intergenic
997229919 5:132234755-132234777 CTGCTTGTCTTGGGTTGCAGGGG - Intronic
997943142 5:138176605-138176627 GTGCTTGCTTGGGGGTGGTGAGG + Intronic
998232710 5:140371560-140371582 TTGCCTGTCTGGGGCTGCTTTGG + Exonic
998793077 5:145787297-145787319 TTGCTTCTCTGGGGAGGCTTAGG - Intronic
999282977 5:150376890-150376912 GCCCTTGTCTGGGGTTGCTGAGG + Intronic
999283985 5:150383102-150383124 GTTCCTCTCTGGGGGTGCTGGGG - Intronic
999735753 5:154511614-154511636 GTGCCCGTCTGGGGAGTCTGTGG - Intergenic
1000707720 5:164532450-164532472 GTGGTTGTCTGGTTGTGCTGAGG - Intergenic
1000915562 5:167076954-167076976 GTGCATGCCTTGGGAGGCTGAGG - Intergenic
1001112725 5:168911134-168911156 GTATTTGTCTTGGGATGTTGAGG - Intronic
1002799537 6:508456-508478 GTGGTTGTCGGGGGTTACTGGGG - Intronic
1004098015 6:12578810-12578832 GTGCATGTCTGGGCATTCTGAGG + Intergenic
1004371243 6:15054285-15054307 GTGCATGCCTTGGGAAGCTGAGG - Intergenic
1004501938 6:16217133-16217155 GTGCTTGTCGGGGGAGGCTCGGG - Intergenic
1004932655 6:20476837-20476859 GTCCTTGTGTGGGCCTGCTGTGG - Intronic
1008553057 6:52651445-52651467 GCCCTTGTCTGGGGTTGTTGTGG - Intergenic
1010122952 6:72400496-72400518 GTGATTGTCTGGGGAGACTATGG + Exonic
1010172135 6:72986869-72986891 CTGCGAGGCTGGGGATGCTGCGG + Intronic
1011228688 6:85135976-85135998 TTGCTTATCAGGAGATGCTGGGG + Intergenic
1011610102 6:89142344-89142366 ATGTGTGTCTGGGGATGCTTAGG + Intergenic
1013605024 6:111739448-111739470 GCTCCTGCCTGGGGATGCTGTGG + Intronic
1013820227 6:114145736-114145758 GGGCTCGTGTGGGGGTGCTGTGG + Intronic
1016514454 6:144878940-144878962 GTGCAAGTGTGAGGATGCTGAGG + Intergenic
1018391786 6:163346533-163346555 GTGCTTGCCTGGGGAGTCGGAGG - Intergenic
1018828433 6:167424117-167424139 GAGCTTGGCTGGGGCTCCTGGGG + Intergenic
1019219612 6:170463509-170463531 GGCCTGGTCTGGGGAGGCTGTGG + Intergenic
1019340135 7:504979-505001 GGGCTTGTCTGAGGAGGCAGTGG - Intronic
1019353382 7:565742-565764 GTGCTTGACTGGGGTAGCTCAGG + Intronic
1019931336 7:4225354-4225376 GTGCTTGTCCGAGCAGGCTGGGG - Intronic
1020101701 7:5397492-5397514 CTGCCTTGCTGGGGATGCTGGGG - Intronic
1021157216 7:17225411-17225433 GTGGTTGTCAGGGGATGGTTGGG - Intergenic
1022365833 7:29715115-29715137 GGGCTTGTCAGGGGAGGGTGTGG + Intergenic
1023038130 7:36150688-36150710 GTGGTTACCTGGGGATGATGGGG - Intergenic
1024011604 7:45271608-45271630 TTCCTTGACCGGGGATGCTGGGG + Intergenic
1024683015 7:51713742-51713764 GTGCTTCTCTGGGGGTGTTTTGG + Intergenic
1025018609 7:55463581-55463603 GTGGTTGTTTGGGGAGGCTGTGG + Intronic
1027264375 7:76485978-76486000 GTGCTGGGGTGGGCATGCTGTGG + Intronic
1027315745 7:76984092-76984114 GTGCTGGGGTGGGCATGCTGTGG + Intergenic
1029196280 7:98807834-98807856 GAGGTTTTCTGGGCATGCTGAGG + Intergenic
1032676877 7:134138165-134138187 GGGCTTGTGTGGGGATGCACTGG - Intronic
1034477721 7:151296611-151296633 GTGGTTGCCTGGGGATGGTGGGG - Intergenic
1035108385 7:156460655-156460677 GTGTCTGTCTTGGGGTGCTGAGG + Intergenic
1035153378 7:156893153-156893175 CTGCTCGTCTGAGGCTGCTGAGG - Exonic
1036738378 8:11339824-11339846 CTGGTGGTCTGGGCATGCTGAGG + Intergenic
1037802041 8:22041185-22041207 GAGCTTGTGTGGGGAGGATGGGG - Intergenic
1038127593 8:24691705-24691727 GTGCTGAGTTGGGGATGCTGTGG + Intergenic
1038263374 8:26017617-26017639 TTGGTTGTATGGGTATGCTGTGG - Intronic
1038404108 8:27309187-27309209 GTGCTGATCAGGAGATGCTGGGG - Intronic
1039472369 8:37821490-37821512 GTGCTTGGCAGGGGATCCCGGGG - Intronic
1039900395 8:41748042-41748064 GTGCTTGACCAGGGAGGCTGGGG - Intronic
1040519218 8:48160564-48160586 GTGCTGGCCTGTGGAGGCTGTGG + Intergenic
1041019532 8:53624469-53624491 GTTCTTGCCTGGGGCTGATGTGG - Intergenic
1041806831 8:61860553-61860575 GTGTTTGCCTGGGGTAGCTGAGG + Intergenic
1043454303 8:80398655-80398677 GTGCATGCCTTGGGAGGCTGAGG - Intergenic
1043762436 8:84084564-84084586 GTGGTTGTCAGGGGCTGCTGGGG + Intergenic
1044069403 8:87738785-87738807 TTGCTTGTCTATGCATGCTGAGG + Intergenic
1044392157 8:91663719-91663741 GTGCCTGTAAGGGGATTCTGGGG - Intergenic
1044863412 8:96545720-96545742 TTGCTTGTTTGGGCATTCTGTGG + Intronic
1046055639 8:109074893-109074915 GCACTTTGCTGGGGATGCTGGGG + Intergenic
1046259741 8:111751869-111751891 GTTCTTGTCTGGAGACTCTGGGG + Intergenic
1046825125 8:118681210-118681232 GTGGTTATCTGGGGCTGGTGTGG + Intergenic
1046965490 8:120160625-120160647 CTGATTGTCTTGGGTTGCTGCGG - Intronic
1047936306 8:129783303-129783325 GTCCTTGTTTGTGGATGATGTGG + Intronic
1049248817 8:141577347-141577369 GTGTTTCTCTGGGGTTGCTGAGG + Intergenic
1049297376 8:141849943-141849965 GTGCTTGTCAGGGTACCCTGAGG + Intergenic
1051651356 9:19329230-19329252 GTGGTTGCCTAGGGCTGCTGGGG - Intronic
1052325730 9:27215136-27215158 GTGCTAGTCTTGGGAGGCTGAGG - Intronic
1052977490 9:34421983-34422005 GAGGCTGTCTGGGGATGGTGTGG - Intronic
1053271622 9:36753892-36753914 GAGCTTGTGTTGGGATGATGTGG - Intergenic
1054745422 9:68849494-68849516 GCTCTTGCCTGGGGAGGCTGAGG - Intronic
1054822810 9:69540539-69540561 GTGGTTGTCAGGGGTTGCAGGGG - Intronic
1055597811 9:77883399-77883421 GTGCTTTTCTAGGTAGGCTGAGG + Intronic
1056627750 9:88267822-88267844 CTGCTAGCCTGGGGACGCTGGGG - Intergenic
1056828246 9:89891464-89891486 GCTCTTGTCTGGGGATGATGTGG + Intergenic
1056978760 9:91286781-91286803 GTGTTTGTATGGGGACACTGAGG + Intronic
1057331686 9:94120960-94120982 GTGCCAGTCTGGGAAAGCTGCGG + Intergenic
1059334113 9:113557908-113557930 GTGCTGGTCTTGAGAAGCTGTGG + Intronic
1060327229 9:122629010-122629032 TTGCTGGACTGGGGATGCTGGGG - Exonic
1060346503 9:122821399-122821421 GTGTGTGTTTGGGGATGGTGTGG - Intronic
1061257790 9:129462697-129462719 GTGGTTGCCTGGGGATGCTGGGG + Intergenic
1061614062 9:131767862-131767884 GTGGTTGCCTGGGGACACTGGGG + Intergenic
1185932884 X:4222493-4222515 GTGCCTGTATCGGGAGGCTGAGG - Intergenic
1186252123 X:7679641-7679663 GGGCCTGTCTGGGGATGGCGAGG - Intergenic
1187775202 X:22748845-22748867 GTTCATTTCAGGGGATGCTGAGG + Intergenic
1189756026 X:44272010-44272032 GTCCTTCTCTTGGGATGCTGCGG - Intronic
1189910694 X:45807704-45807726 GTGGTTGTCAGGGGCTGCAGGGG + Intergenic
1189968963 X:46398797-46398819 GTTCTTGTCTGGAGACTCTGGGG + Intergenic
1195091717 X:101466689-101466711 GTGGTTTTTTGGGGGTGCTGAGG + Intronic
1195860578 X:109378640-109378662 CTGCTTGTGTGTGTATGCTGGGG + Intronic
1196087785 X:111704659-111704681 GTGGTTGTCTGGGGTTGGTGGGG + Intronic
1196655693 X:118214965-118214987 GTGCGTGCCTGGGGAGGCTGAGG - Intergenic
1196802687 X:119557989-119558011 TTGCTTGTATGGGGAGGCAGAGG - Intronic
1198233738 X:134717056-134717078 GTGCTGATCTGAGGATTCTGTGG + Intronic
1199616396 X:149659441-149659463 CTGCCTGTCTGGGGATACCGAGG - Intergenic
1199626245 X:149743807-149743829 CTGCCTGTCTGGGGATACCGAGG + Intergenic
1200695928 Y:6359508-6359530 GTACTGGTCTGGGGCTCCTGAGG + Intergenic
1201039349 Y:9815198-9815220 GTACTGGTCTGGGGCTCCTGAGG - Intergenic
1201489193 Y:14523653-14523675 GTGCTTCTTTTGGGAGGCTGGGG + Intronic
1201917725 Y:19200302-19200324 GTTTTTGTCAGGGGATGGTGGGG + Intergenic
1202111696 Y:21427703-21427725 AAGCATGTCTGGGGAGGCTGGGG - Intergenic