ID: 1133587648

View in Genome Browser
Species Human (GRCh38)
Location 16:7211493-7211515
Sequence CTCTATCACTAGTAAATACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133587642_1133587648 25 Left 1133587642 16:7211445-7211467 CCAGTGGGCTGGTAGCTGTCATA 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1133587648 16:7211493-7211515 CTCTATCACTAGTAAATACAGGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133587648 Original CRISPR CTCTATCACTAGTAAATACA GGG Intronic
909146297 1:71937528-71937550 CTTGATCACTAGAAAATAAATGG + Intronic
909873759 1:80778415-80778437 CTCCATCCCAAGGAAATACAGGG - Intergenic
916697768 1:167257327-167257349 CTCTATGAAAAGTAAAAACAAGG + Intronic
919359491 1:196573069-196573091 CTCTCTCATTAGGAAAGACATGG - Intronic
919418640 1:197342823-197342845 CTCTATCACTACTAACAACGAGG - Intronic
920329791 1:205198270-205198292 CTCTACCACTAATAAACATAAGG - Intronic
920566068 1:206974433-206974455 CTCTAACACTAGTGAGTGCAGGG + Intergenic
922478953 1:225925218-225925240 TTCTATCAGTAGTAAATATAAGG + Intergenic
922745416 1:228040283-228040305 TTCTCTCATTAGTTAATACAAGG + Intronic
923486750 1:234439824-234439846 CTCTCTCAGTAATAGATACAAGG + Intronic
923802179 1:237220827-237220849 CTCTTTCATTAATAAATACTGGG + Intronic
924067422 1:240238787-240238809 ATCTATCAATATTAGATACACGG + Intronic
1064535540 10:16353950-16353972 CTAAATCACTAGTAATTCCAAGG + Intergenic
1066211208 10:33240616-33240638 CTAGATCACTGGGAAATACATGG - Intronic
1069395917 10:67987622-67987644 CTGTTTCCCTAGGAAATACATGG + Intronic
1072499808 10:96002673-96002695 TTTTATCACTAGGAAATATAAGG + Intronic
1073219848 10:101862132-101862154 CACTAGAAATAGTAAATACATGG + Intronic
1073532688 10:104246466-104246488 CTTTTTCACTAGTAAAAACCTGG + Intronic
1076131295 10:128015808-128015830 CTCTAAAACTAATAAATAAAAGG + Intronic
1085893218 11:80605835-80605857 ATCTAACTCTAGTAAATTCAGGG - Intergenic
1086150178 11:83600590-83600612 GTCTAGCAATAGCAAATACACGG + Intronic
1088147085 11:106694356-106694378 CTTTATTACTAATAAATAAAGGG - Intronic
1090831907 11:130426267-130426289 CTCTATCACTGGGAAAGGCAGGG - Intronic
1093626590 12:21356055-21356077 CTCTATCACTACATTATACAGGG - Intronic
1093869713 12:24274367-24274389 CTCTATCTCTAGTAATTATTTGG + Intergenic
1098323703 12:69278506-69278528 CTCTACCACCAGAAAATACCTGG + Intergenic
1101177771 12:102173570-102173592 CTGTATCATTACTAAATAGAAGG + Intronic
1104186205 12:126434471-126434493 CTCAATCAATAGTAATTAAATGG - Intergenic
1104236131 12:126938273-126938295 CTAAATCACTAGTGAATATAAGG + Intergenic
1106596978 13:31151942-31151964 CTCTATCACTTTTCAATATATGG + Intronic
1106647550 13:31653019-31653041 TCCCATCACTAGTGAATACACGG - Intergenic
1111198365 13:84902499-84902521 GTTTGTTACTAGTAAATACAAGG + Intergenic
1111318181 13:86587464-86587486 CTCTATCATGAGTTAATACTAGG - Intergenic
1111897284 13:94157289-94157311 CTCTCTCTCTAGAAAATAAATGG - Intronic
1119429768 14:74558815-74558837 GTCTATGACTAGGGAATACATGG - Intronic
1120551586 14:85879163-85879185 ATCTATCACTGGTGAAAACATGG + Intergenic
1121702812 14:95968759-95968781 CTCTCTCTCTCGTAAAGACAAGG + Intergenic
1125622325 15:41074915-41074937 GTATATTACTAGTAAAGACAGGG + Intronic
1131494331 15:92892299-92892321 CTCTAACACTATTATAAACATGG + Intronic
1133587648 16:7211493-7211515 CTCTATCACTAGTAAATACAGGG + Intronic
1133807442 16:9136314-9136336 CTCATTCACTGGTGAATACATGG - Intergenic
1134287141 16:12871709-12871731 CTATATCACTAATAAAAAGAGGG + Intergenic
1140319161 16:73931236-73931258 CTCTATAATTAATATATACATGG - Intergenic
1144271548 17:13622179-13622201 TTCTATCACCAGAAAATTCAAGG - Intergenic
1153397658 18:4642790-4642812 CTTTCTCACAAGTAAATACATGG - Intergenic
1154041877 18:10864104-10864126 GTCTATCACAAGTAATTATATGG - Intronic
1159884477 18:73891205-73891227 TTCTATCACTGGTAACTGCACGG - Intergenic
1160180788 18:76634421-76634443 CTCTCTCACTATTATATATACGG + Intergenic
1161259376 19:3328263-3328285 ATCTATCAAAAGTTAATACAGGG - Intergenic
927391810 2:22604639-22604661 CTCTATCACTACTCCATTCAGGG + Intergenic
928076336 2:28268126-28268148 CTATATCCCTAATAAATAAATGG - Intronic
928352148 2:30568339-30568361 CTATATCTCTAACAAATACATGG - Intronic
933402440 2:81816053-81816075 TTCTATCTCTATTAAATAGATGG - Intergenic
934123826 2:88866776-88866798 CTGTGTCACAAGTAAATTCAAGG + Intergenic
938693332 2:133812881-133812903 CTCTACCACTAGCATCTACATGG + Intergenic
948561624 2:238857416-238857438 ATCTATCGCTATTAAATCCAGGG - Intronic
1170039103 20:12021499-12021521 CTCTCTCCCTAGTAAAAACAAGG + Intergenic
1170966164 20:21073537-21073559 TTATATAAATAGTAAATACATGG - Intergenic
1178017562 21:28367428-28367450 CTCTTGCACTATGAAATACAAGG + Intergenic
1182436476 22:30333956-30333978 CTGTATTACTGTTAAATACATGG + Exonic
1183444214 22:37842373-37842395 CTCTATCACTTGTAGTCACAGGG + Intronic
951328858 3:21341194-21341216 CTCTTTATCTAGTAAATACCAGG - Intergenic
954115052 3:48462275-48462297 GTCTACCACCAGTAAAAACATGG - Intronic
955444870 3:58999115-58999137 CTCTATCACATTTAAATACCAGG - Intronic
957595143 3:82254088-82254110 CTGTATAATTAGTAAATACTAGG + Intergenic
958064932 3:88531793-88531815 TTCTATCAATAGTAAACCCAGGG - Intergenic
958739125 3:98046982-98047004 CACTATCACTGGTAATTACTAGG - Intergenic
963269912 3:143276198-143276220 CTCTAACAGTAGTAACTAGATGG - Intronic
965383829 3:168022515-168022537 CTCTATCACTAGTGCTTAAATGG + Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
970273520 4:14372141-14372163 TTCTAGCACTTGTAAAAACATGG - Intergenic
971091997 4:23356602-23356624 CTGTATCACTAGTATATCCCAGG + Intergenic
972497913 4:39651177-39651199 CTTTAACACCAGTAAATACCTGG - Intergenic
972824911 4:42746749-42746771 CTCTAACACTAGGAAAAACATGG - Intergenic
974555598 4:63443912-63443934 CTCTATGATTAAGAAATACATGG - Intergenic
976863553 4:89695699-89695721 ATCTTTGACTAGTAAGTACAAGG - Intergenic
977982508 4:103341259-103341281 CTCTGCCACTAGGAAATAAATGG + Intergenic
978111876 4:104974436-104974458 TTCTATCACCAGAACATACAAGG + Intergenic
979201346 4:117982788-117982810 CTCTATCACTTATAAATAATAGG - Intergenic
982246506 4:153357478-153357500 CTTAATGAATAGTAAATACATGG - Intronic
982409224 4:155055234-155055256 CTCTAGTACTAGAAAATATAGGG + Intergenic
982629380 4:157812622-157812644 CTCTCTCTCTTGCAAATACAGGG - Intergenic
987662293 5:20893041-20893063 CTCTATCTCTACAAAATAAATGG - Intergenic
987841235 5:23225210-23225232 GACTATCACTAGAAAATAGATGG + Intergenic
988187007 5:27878285-27878307 CTCAAAAACTAGGAAATACAAGG - Intergenic
988761289 5:34312272-34312294 CTCTATCTCTACAAAATAAATGG + Intergenic
990160336 5:52932032-52932054 CGCTGTCACTAGAAAATACACGG - Exonic
991411936 5:66354267-66354289 CCCCATCACTAGGAAATTCAGGG + Intergenic
997992847 5:138560504-138560526 CTTTATCACTAATAAACACAAGG - Intronic
998214310 5:140225788-140225810 CTCTATCTCCAGTAGATTCACGG - Intronic
999402613 5:151277813-151277835 CTATATTACTAGTTAAGACAGGG - Intronic
1000590557 5:163152650-163152672 TTGTATCATTAGTAAAGACAAGG - Intergenic
1007540322 6:42636684-42636706 CTCTATCTCTAGTAACTCCAAGG - Intronic
1009383803 6:63064721-63064743 TGCTATTTCTAGTAAATACAAGG - Intergenic
1012866636 6:104625838-104625860 CCCTAGAACTACTAAATACAGGG - Intergenic
1013553216 6:111230688-111230710 CTCTTTCAGTAATAACTACAGGG - Intronic
1013840814 6:114391418-114391440 TTCTATTAACAGTAAATACATGG - Intergenic
1015627475 6:135195547-135195569 CTCTAGCACTATTAAAAACAGGG + Intronic
1019899177 7:4006685-4006707 CTCTTTCACTAGAAAATAAAAGG - Intronic
1021277863 7:18677299-18677321 CCATATCACTGGTACATACATGG - Intronic
1022246813 7:28568321-28568343 CTCTATCAATAATAGATCCAAGG - Intronic
1022738080 7:33094613-33094635 ATATATCACAAGTAAGTACAGGG - Intergenic
1023434284 7:40126198-40126220 CTCTATAAATGGTAAATATAAGG - Exonic
1024714200 7:52056025-52056047 ATTTATCACTAAAAAATACAAGG - Intergenic
1024947340 7:54822962-54822984 TTCCATCAGTAGTAAATAAAAGG + Intergenic
1025157271 7:56619306-56619328 CCCTAAAACTAGTAAACACAGGG + Intergenic
1030262799 7:107583275-107583297 CTTTATCTGTAGTAATTACATGG + Intronic
1032497528 7:132373918-132373940 ATATATCCCTATTAAATACAAGG - Intronic
1033720066 7:144049807-144049829 CCCTAAAACTAGTAAACACAGGG + Intergenic
1034551416 7:151822967-151822989 CTCTATCACTTGAAAATCTAGGG + Intronic
1036176145 8:6540308-6540330 CTTTATCAGTAGAAAATAAATGG - Intronic
1038098403 8:24342658-24342680 CTTCAGCACTAGAAAATACAAGG - Intronic
1040039961 8:42905911-42905933 CTGTATCTTTAGTAGATACAGGG - Intronic
1043889221 8:85637984-85638006 CTCTATCACCAGGAACTTCAAGG + Intergenic
1047366971 8:124220434-124220456 CTCGATCATTTGGAAATACATGG + Intergenic
1050689214 9:8206214-8206236 CTCTCTCTCTTGGAAATACAAGG + Intergenic
1051129612 9:13845237-13845259 CACTATTACAAGAAAATACAAGG + Intergenic
1052129364 9:24822984-24823006 CTCTATGTATAGAAAATACATGG - Intergenic
1053390662 9:37733173-37733195 CTTTTTCACTACAAAATACATGG - Intronic
1054786529 9:69215556-69215578 TTCTATTTCTAGTAAAGACAGGG + Intronic
1055401115 9:75925241-75925263 CTCTATGCTTAGTAAATACATGG - Intronic
1055662306 9:78517099-78517121 CTCTATCATTAGTAAATCCCTGG + Intergenic
1056882369 9:90408472-90408494 CTCTACCACTAAGAGATACAGGG + Intergenic
1057011520 9:91606656-91606678 CTCTCTCACTACAATATACATGG + Intronic
1059869737 9:118559322-118559344 CTCTCTCACCTGTAAGTACAAGG + Intergenic
1186695814 X:12030737-12030759 CTTTATCTCTAGTAAGTAGATGG - Intergenic
1188345585 X:29061375-29061397 CTATATGACTTGTAATTACAAGG - Intronic
1189931510 X:46016776-46016798 CTTTATCACCAGTATATACGAGG - Intergenic
1190490143 X:50973791-50973813 TTCTATCACAAGGAAACACAGGG - Intergenic
1191236431 X:58138077-58138099 CTCTATCAGTAGAATATCCAGGG - Intergenic
1197504517 X:127285143-127285165 CTCTAGTAATGGTAAATACATGG - Intergenic
1201692666 Y:16785469-16785491 TTCTTGAACTAGTAAATACATGG + Intergenic