ID: 1133592162

View in Genome Browser
Species Human (GRCh38)
Location 16:7256338-7256360
Sequence CATTCCTACCAGAAGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133592159_1133592162 11 Left 1133592159 16:7256304-7256326 CCACAGTCAGCGAGCAGATCTCT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1133592162 16:7256338-7256360 CATTCCTACCAGAAGTTCTGAGG 0: 1
1: 0
2: 1
3: 22
4: 214
1133592157_1133592162 19 Left 1133592157 16:7256296-7256318 CCTCACCTCCACAGTCAGCGAGC 0: 1
1: 0
2: 1
3: 28
4: 203
Right 1133592162 16:7256338-7256360 CATTCCTACCAGAAGTTCTGAGG 0: 1
1: 0
2: 1
3: 22
4: 214
1133592158_1133592162 14 Left 1133592158 16:7256301-7256323 CCTCCACAGTCAGCGAGCAGATC 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1133592162 16:7256338-7256360 CATTCCTACCAGAAGTTCTGAGG 0: 1
1: 0
2: 1
3: 22
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133592162 Original CRISPR CATTCCTACCAGAAGTTCTG AGG Intronic
900764013 1:4491839-4491861 CACTCCTACCAGGATTTCCGAGG - Intergenic
900933644 1:5752052-5752074 CATTCCTGCCTGAAGGTCTCAGG - Intergenic
902375744 1:16029222-16029244 CATTCCCACCAAAGGTGCTGGGG - Exonic
902380695 1:16050971-16050993 CATTCCCACCACAGGTGCTGGGG - Exonic
902879726 1:19363530-19363552 CCTTCCCCCCAGAAGTCCTGTGG - Intronic
907185785 1:52608118-52608140 CACTCCAACCAGAATCTCTGAGG - Intronic
907680983 1:56563221-56563243 CTTTCCTAAAAGAAGTTTTGTGG - Intronic
910585293 1:88872588-88872610 CATTCCTAGCAGAAGAGCTCAGG - Intronic
910761214 1:90733435-90733457 CATTCCTACTACAAGTTAGGAGG - Intergenic
911252478 1:95593067-95593089 CCTTCCTACCACAATTTTTGGGG + Intergenic
913164268 1:116170426-116170448 CATCCCCTCCAGAAGTACTGTGG + Intergenic
913207109 1:116549324-116549346 CTTCCCTAAAAGAAGTTCTGAGG + Intronic
916031401 1:160880549-160880571 CTTTCCTACCAGGAGTTCAGAGG + Intronic
916292772 1:163184802-163184824 CATTCCTCCTGGAGGTTCTGGGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
919770946 1:201158196-201158218 CATTCCTTCTAGAAGCTCTAGGG - Intronic
920362268 1:205427180-205427202 CATTCCTTCCAGAATTTTTAAGG + Intronic
921228691 1:213046831-213046853 CATTCCTACAACTAGTTCTGAGG - Intergenic
1063731660 10:8704223-8704245 CGTTCCTCCCAGACTTTCTGAGG - Intergenic
1064371381 10:14754550-14754572 CATGGCTGCCAGTAGTTCTGAGG - Intronic
1064845028 10:19642700-19642722 CATTCCTAGGAGAAGATCTGAGG + Intronic
1068750248 10:60584129-60584151 ACTTCTTACCAGAAGTTCAGAGG + Intronic
1069619182 10:69825974-69825996 CATGGCTGCCAGAAGTTCAGAGG + Intronic
1071855911 10:89624130-89624152 AATTCCTTTCAGAACTTCTGAGG + Intronic
1073093053 10:100960378-100960400 TATTCCCACCAGAATGTCTGAGG + Intronic
1074039234 10:109771724-109771746 CATTCCTACAAGGGCTTCTGTGG + Intergenic
1074929241 10:118106741-118106763 CCTTCCTAAGAGAAGCTCTGAGG + Intergenic
1075157242 10:119988543-119988565 AACTCCTTCCAGAAGTACTGTGG + Intergenic
1075611166 10:123855845-123855867 GATTCCTTCCAGCAGTGCTGGGG + Intronic
1076143436 10:128097607-128097629 CATTCCTACTGAAAGTTTTGAGG + Exonic
1076435107 10:130435221-130435243 TGTTCCCACCAGAAGCTCTGGGG - Intergenic
1076653982 10:132009032-132009054 CATTCTCAGCAGAGGTTCTGAGG + Intergenic
1080051502 11:27863654-27863676 GATTCCAATCAGTAGTTCTGGGG - Intergenic
1082882709 11:58053872-58053894 CATCCCAACCACCAGTTCTGGGG + Intronic
1085552690 11:77389469-77389491 CATTCCCACCAGCAATTATGAGG + Intronic
1085905747 11:80760193-80760215 CTTTCTTACCAGAAGTGCTGAGG - Intergenic
1086700747 11:89898118-89898140 CCTTCCTTCCAAAATTTCTGTGG - Intergenic
1086705422 11:89946409-89946431 CCTTCCTTCCAAAATTTCTGTGG + Intergenic
1090208575 11:124899328-124899350 AATTCCTACCCCAAATTCTGTGG + Intergenic
1090610346 11:128465802-128465824 CATTCCTCCCAATAATTCTGTGG + Intronic
1091162558 11:133438613-133438635 CACTCCTATCAGAAATTATGGGG - Intronic
1096131555 12:49163071-49163093 GGTTCCTACCAGAGGCTCTGAGG - Intergenic
1096294297 12:50370534-50370556 CATTCCTACCAGCAGTGCACAGG - Intronic
1098439628 12:70504314-70504336 CTTTCCTCCTGGAAGTTCTGAGG - Intergenic
1098983923 12:76989565-76989587 CATTCATACCACAAAATCTGAGG - Intergenic
1099046355 12:77725816-77725838 CATTCCTTCTGGAAGATCTGTGG + Intergenic
1099294354 12:80811579-80811601 CATTTCTTCCAGAACTTTTGGGG + Exonic
1099342170 12:81450940-81450962 TATTTCTATCAGTAGTTCTGAGG - Intronic
1100395882 12:94186001-94186023 CACTCCTCCCAAAAGTGCTGAGG - Intronic
1101300146 12:103471160-103471182 CATTCTTCCCAGAATCTCTGTGG + Intronic
1101647265 12:106643016-106643038 CAATCCTACAGGGAGTTCTGAGG + Intronic
1102354728 12:112223175-112223197 CATGCTTCCCAGGAGTTCTGAGG + Intronic
1103605933 12:122086149-122086171 CGTTCTTCCCAGAAGCTCTGGGG - Intronic
1103920065 12:124394708-124394730 CATTCCCTCCAGAGGCTCTGGGG - Intronic
1107520887 13:41179902-41179924 CACTCCTACCAGCAGGTATGAGG + Intergenic
1108232935 13:48369450-48369472 CATTTCTAGGAGAAATTCTGGGG - Intronic
1108475418 13:50811537-50811559 CGTTCCTGGCAGAACTTCTGTGG + Intronic
1109459523 13:62637779-62637801 CATTCCTAACAGAAATTCTTTGG - Intergenic
1110711329 13:78654142-78654164 CATCCCTACCAGAAATGCTTTGG + Intronic
1110827609 13:79990842-79990864 CATTCCTTCCAGAAGCTTGGGGG - Intergenic
1111797491 13:92941433-92941455 CATTCCTTCTGGAAGCTCTGGGG - Intergenic
1112063335 13:95764541-95764563 GATTCCTGCCAGATGTTGTGAGG + Intronic
1113818715 13:113194977-113194999 CATTCTTCCCAGAAGTTTTGAGG - Intronic
1116268730 14:42731587-42731609 GATTCTTTCCAGAAGTACTGAGG + Intergenic
1117971990 14:61260872-61260894 TCTTCCTACCAGAAGTTGTTTGG - Intronic
1119046050 14:71320228-71320250 CATAGCAACCAGAAGTTCCGCGG + Intergenic
1119528211 14:75340058-75340080 CATTCCTGCCAGAAATTCCAGGG - Intergenic
1119529256 14:75348177-75348199 CATTCCTACCAGGGATTTTGAGG - Intergenic
1119714398 14:76848620-76848642 CCTTCCCAGCAGAACTTCTGTGG - Intronic
1121034896 14:90693742-90693764 CATTCCCACCAGCAGTTATGAGG - Intronic
1124636480 15:31367950-31367972 AATTCCTTCCAGAGGCTCTGAGG + Intronic
1125178328 15:36851788-36851810 CATTTCCACCAAAAGTGCTGGGG - Intergenic
1125285703 15:38090335-38090357 CAGTCTGACCAGAAGTTCAGTGG + Intergenic
1125750525 15:42024554-42024576 CATTCCTCCCAGAAGCCCAGTGG + Intronic
1125752663 15:42039898-42039920 ATTTCCAACCAGAAGTTTTGGGG + Intronic
1126412736 15:48388650-48388672 CAGTCCTAACAGAAGTTCCCCGG - Intergenic
1126933253 15:53678040-53678062 CATTTCTACCAGAGATTATGGGG + Intronic
1128676780 15:69615540-69615562 CATTCAAACCAGAAGTGCTCTGG - Intergenic
1128716214 15:69910048-69910070 CACTCCTTCCAGAAGTTTAGAGG - Intergenic
1130646581 15:85733063-85733085 CATGCTTACCAGAAGTTCTTAGG + Intronic
1133592162 16:7256338-7256360 CATTCCTACCAGAAGTTCTGAGG + Intronic
1135299889 16:21317053-21317075 CGTGCCTTCCAGAAGTACTGTGG + Intergenic
1136170049 16:28483625-28483647 CATTCCAATCACAAGTGCTGAGG - Intronic
1136645311 16:31608750-31608772 CTTTCCTACTGGTAGTTCTGAGG + Intergenic
1138732962 16:59216446-59216468 CATTCCCTCTAGAAGTTCTAGGG + Intergenic
1138988855 16:62365655-62365677 CATTCCCAGCAGAAGTTGTCTGG + Intergenic
1139273249 16:65703196-65703218 CATTCCAAACAGGAGCTCTGGGG - Intergenic
1141374225 16:83514816-83514838 CCTTCCTTCTGGAAGTTCTGAGG - Intronic
1143646865 17:8235868-8235890 CTTGCCTACCAGCAGTTCCGTGG - Exonic
1146606173 17:34259625-34259647 CATTCCTTCCAGAGGTTCTATGG + Intergenic
1146658068 17:34646823-34646845 CTTTCCTCCCAGAAGTCCAGGGG - Intergenic
1147020327 17:37526588-37526610 CATTCCTTCTAGGAGTTCTAGGG + Intronic
1147449541 17:40495589-40495611 CAATCCTACCAAAATTTCAGGGG + Intronic
1147689122 17:42304714-42304736 CATTGCTGCCAGGAGTCCTGAGG - Intronic
1152970275 18:154783-154805 CATTCCTTCTAGAGGCTCTGAGG - Intergenic
1154338619 18:13485280-13485302 CACTCCTACCAGAGGCTTTGTGG - Intronic
1156242894 18:35271002-35271024 CATTCCTCCCAGTAGGTTTGTGG + Intronic
1158602894 18:58870307-58870329 CATTCCTATCATAGCTTCTGGGG - Intronic
1159994686 18:74952796-74952818 CATTTCTCCCAGAAGTTGTGAGG + Intronic
1160621214 18:80172139-80172161 TATTCCCCCCAGCAGTTCTGAGG + Intronic
1164473883 19:28557857-28557879 CATACCTACAAGAATATCTGGGG - Intergenic
1165380430 19:35475746-35475768 AATTCCTAACAGAACATCTGGGG - Intergenic
926301427 2:11606295-11606317 CATTCCCATCAGAATTTCAGTGG + Intronic
928626718 2:33147393-33147415 CATTTCTACCACATGCTCTGAGG + Intronic
930296749 2:49563901-49563923 CAGTCCTACCAGCATTTGTGGGG + Intergenic
931321590 2:61178138-61178160 CATCCCTTCCGGAGGTTCTGCGG - Exonic
931819336 2:65935727-65935749 CACTCCTGCCGGCAGTTCTGGGG + Intergenic
932173998 2:69582981-69583003 AATTGCTGCCAGGAGTTCTGTGG - Intronic
934082678 2:88482974-88482996 CATTCCTTCCAGAAGTTTCAGGG + Intergenic
934099522 2:88640027-88640049 CATTCTTAAAAGAAGCTCTGGGG + Intergenic
939695118 2:145313786-145313808 AGTTTCTACCAGAAGTACTGTGG + Intergenic
945579359 2:211573261-211573283 CATTCCCTCCAGAAGCTCTAGGG - Intronic
947359962 2:229336692-229336714 GATTCCAAGCAGAAGGTCTGGGG + Intergenic
948146285 2:235710507-235710529 CATTCCTCCCTGAAGGTCTCTGG + Intronic
1169427242 20:5506031-5506053 CATTCCCACCAGCAGTGATGAGG + Intergenic
1170758894 20:19231604-19231626 CATTCCTACTGGAAGCTCTTGGG - Intronic
1171418400 20:24999491-24999513 CAGTGATACCAGAATTTCTGGGG - Intergenic
1172908945 20:38391630-38391652 CATTCCTTCAGGAAGCTCTGGGG + Intergenic
1173124989 20:40328355-40328377 AATACCTACCAGAAGCTTTGAGG - Intergenic
1174039863 20:47691466-47691488 CAATCCAACCAGAATCTCTGGGG - Intronic
1174098251 20:48106673-48106695 CATTCCTTCCAGAGGCTCTAAGG - Intergenic
1175043480 20:56078784-56078806 GATACCTACCAGAAGTGCAGAGG - Intergenic
1175358737 20:58390157-58390179 CAATCCCATCAGAAGTCCTGAGG - Intronic
1175630770 20:60534629-60534651 CACTCCTACCAGAGGCTCTAAGG - Intergenic
1177747110 21:25230131-25230153 CATTCCTACCAAGAGTGTTGAGG - Intergenic
1179676160 21:42983806-42983828 CATTCCTACCAACAGTACAGAGG + Intronic
1179835740 21:44031560-44031582 CTTTCCTCCCAGGAGTTATGGGG + Intronic
1180154933 21:45973138-45973160 TATTCCTGCCAGATGTTCAGAGG + Intergenic
950438814 3:12995294-12995316 CTTTCCTCCCAGAAGTCCAGAGG - Intronic
954429076 3:50459662-50459684 CATTCCTGGCTGGAGTTCTGAGG - Intronic
955375032 3:58387581-58387603 CATTCCTACACGGAGATCTGAGG + Intronic
955631599 3:60981117-60981139 CTTTCATGCCAGAAGTACTGGGG - Intronic
956102601 3:65784176-65784198 CATTCCTACCAGCAATGATGAGG - Intronic
957335339 3:78820787-78820809 CATTCACACCAGAAGTTCAGTGG + Intronic
957586819 3:82143179-82143201 AATTCCTTCCAGTATTTCTGAGG + Intergenic
961019303 3:123490873-123490895 CTTTTCTAACAGAAGTTCAGCGG - Intronic
963552152 3:146737538-146737560 CATTCCTACCAGCAGTGCATGGG + Intergenic
968310875 3:197682216-197682238 CTTTCCTCCCAGTAGTTGTGTGG - Intronic
969733879 4:8974096-8974118 CATTCTGACCAGAGGTTCTTTGG - Intergenic
969973153 4:11069040-11069062 CATTCCTTTCAGAAGCTCTAGGG - Intergenic
970700807 4:18735815-18735837 CATTTGTTCTAGAAGTTCTGTGG + Intergenic
971200982 4:24508998-24509020 CATTCCTTCCATAGGTTCTTGGG + Intergenic
971426720 4:26523245-26523267 CAATCATAGCAGTAGTTCTGTGG - Intergenic
971866975 4:32184906-32184928 CATTCCTAACAAAGGTTGTGAGG + Intergenic
973930662 4:55790393-55790415 CATTCCTTCCCTAAGGTCTGGGG + Intergenic
974271518 4:59656498-59656520 CTTTCCTACTGGTAGTTCTGAGG + Intergenic
977281125 4:95041528-95041550 CATGACTACCAGAAAGTCTGAGG - Intronic
977696355 4:99971048-99971070 CACTCCTAGCAGAACTTCAGAGG + Intergenic
977886260 4:102255487-102255509 CATGACCACCAGAAGCTCTGGGG + Intronic
978051927 4:104211447-104211469 CATACCAACCACAAGTTTTGTGG - Intergenic
978709401 4:111760097-111760119 AATCCCTCCTAGAAGTTCTGGGG - Intergenic
979464997 4:121026703-121026725 CATTCCTACCAATAGTTTTCAGG - Intergenic
980302647 4:131014204-131014226 CACTCTTAGCAGAGGTTCTGAGG - Intergenic
980786471 4:137562738-137562760 AATTTCTACCAGCTGTTCTGTGG - Intergenic
982365130 4:154569565-154569587 CATTTCTATCAAAAGTTCTGTGG - Exonic
982744370 4:159091269-159091291 CATTCCTCCCAGAAATTCTTAGG + Intergenic
984862639 4:184253956-184253978 CATTCCTCCCAGTGGGTCTGTGG - Intergenic
984949875 4:184999976-184999998 CATGCCTGAGAGAAGTTCTGTGG - Intergenic
986291190 5:6400452-6400474 GATTCCTCCCACAAGTGCTGTGG - Intergenic
987399795 5:17463595-17463617 CTTTCCTCCCAGTAGTTCTGAGG - Intergenic
987988537 5:25181045-25181067 CTTTCCTACTGGTAGTTCTGAGG - Intergenic
988839968 5:35073925-35073947 CATTCCTACCAGCAGTATTGAGG - Intronic
990737335 5:58878576-58878598 CATTCCTTCTGGAAGTTCTGGGG - Intergenic
990980381 5:61597678-61597700 GGTTCCTTCCAGAAGCTCTGAGG + Intergenic
991343299 5:65636030-65636052 CATTCTTACCCAAAATTCTGTGG - Exonic
992089970 5:73308019-73308041 CATTCATACCACAGGTTTTGAGG - Intergenic
992333810 5:75744615-75744637 AATACCTGCCAGAGGTTCTGTGG - Intergenic
992970449 5:82051355-82051377 CTTTCCCCCAAGAAGTTCTGAGG + Intronic
993839771 5:92863758-92863780 AAATTCTACCAGAAGTTGTGCGG + Intergenic
994597559 5:101859694-101859716 CACTCCTACCAGATCTTCAGAGG + Intergenic
996461367 5:123747258-123747280 AAGCCCTACCAGAAGTACTGAGG - Intergenic
997113166 5:131097500-131097522 CATTCCTCCCAGAGCCTCTGTGG + Intergenic
999450874 5:151677158-151677180 TATTCCTAACAGAGGCTCTGTGG + Intronic
1000780440 5:165473749-165473771 CATTCCAAAGATAAGTTCTGAGG - Intergenic
1001430866 5:171660886-171660908 CATTCCTTCCAGAAGTCCTCTGG + Intergenic
1002949126 6:1791134-1791156 CATCCCTTCCAGAGGCTCTGGGG - Intronic
1004876698 6:19962770-19962792 CATTCCTTCTGGAAGTTCTAGGG - Intergenic
1005170654 6:22980858-22980880 CTTTCCTCCTAGTAGTTCTGAGG + Intergenic
1006215258 6:32436667-32436689 ACTTCCTACCAGAGGTGCTGAGG - Intergenic
1006874203 6:37281259-37281281 CATTCCTACCATATGTTCTAAGG + Intronic
1009035418 6:58112062-58112084 CATACCTTTCAGCAGTTCTGGGG + Intergenic
1009916745 6:70005738-70005760 CATTCCTCCTGGTAGTTCTGAGG - Intronic
1010153778 6:72767867-72767889 CATTCCTACCAGCATGTATGAGG - Intronic
1010184112 6:73123004-73123026 CTTTCCCATCAGAAGTTCTTAGG - Intronic
1010576972 6:77543990-77544012 CATTCCTACAAGTCTTTCTGGGG + Intergenic
1010732545 6:79405983-79406005 CATTCCTTTCAGAAGCTCTAGGG - Intergenic
1011399939 6:86949578-86949600 CATTTCTATCAAAAGTTTTGAGG + Intronic
1011464699 6:87643277-87643299 CGTTCCCAACAGAAGCTCTGGGG - Intronic
1013177406 6:107689599-107689621 CAGTCCTACCAGACGCTCTCAGG - Intergenic
1014770806 6:125456047-125456069 AATTCCTTGAAGAAGTTCTGTGG + Intergenic
1016347877 6:143135067-143135089 CATTCCTACCATAAGCTTTCTGG + Intronic
1019967840 7:4514563-4514585 CACTCCTACCAGCTGTTCTGGGG - Intergenic
1020189991 7:5988171-5988193 CATTCCTACCAGAGGTATTCAGG - Intronic
1022911483 7:34903026-34903048 CATTCCTTCTGGAGGTTCTGAGG - Intergenic
1024590623 7:50879685-50879707 CAATCCAATCAGAATTTCTGGGG - Intergenic
1027651745 7:80876909-80876931 CATTGCTCCCAGCAGTTCTCGGG + Intronic
1028273889 7:88826966-88826988 TATTCCTACCAGATGTCATGTGG + Intronic
1029906752 7:104100561-104100583 CATCCCCACTAGAGGTTCTGGGG - Intergenic
1031154323 7:118091282-118091304 CATTCTTACTAGAAATTTTGGGG - Intergenic
1033597370 7:142867165-142867187 CTTCCCAACCAGAAGTTCTGTGG + Intronic
1035267818 7:157701611-157701633 CCTTCCTACCCGAAGTTCTGTGG + Intronic
1038671461 8:29586458-29586480 CATTCCTTCCAGAAGGTGGGAGG + Intergenic
1039036729 8:33367789-33367811 CATTCATTCCAAAAGTTCTTGGG + Intergenic
1040442982 8:47464423-47464445 CATTCCTAACAGATCTTCAGAGG + Intronic
1042347697 8:67744804-67744826 CGTTCCTCCCAGAAATACTGGGG + Intronic
1042572933 8:70186232-70186254 TCTTCCTAACAGAACTTCTGTGG + Intronic
1042892211 8:73625098-73625120 CATTCCCACCAGAATGTATGAGG - Intronic
1044297255 8:90543577-90543599 CATTCCAACCAGAAAATCTGAGG + Intergenic
1044725906 8:95193999-95194021 CATTCCTTCCAGAGGCTCCGGGG - Intergenic
1048195949 8:132331906-132331928 CATGCCAGTCAGAAGTTCTGTGG + Intronic
1050618265 9:7426146-7426168 CTTTCCTCCTAGTAGTTCTGAGG - Intergenic
1051593039 9:18795731-18795753 CATTCCTGCCAGGAGGTCTTAGG + Intronic
1052708321 9:32020751-32020773 CATTTCTTCCAGAAGCTCTAAGG + Intergenic
1053043627 9:34895304-34895326 CATTCCTTTCATAAGTTCGGTGG + Intergenic
1055288004 9:74751485-74751507 TATTCCTACAAGAATATCTGAGG + Intronic
1055722063 9:79186198-79186220 CATTCCTTCTGGAAGCTCTGGGG + Intergenic
1059446016 9:114338407-114338429 CATTCCCACCAGCAGTGCTGAGG - Intronic
1060775692 9:126372480-126372502 CAATCCCACCAGAAGTGCAGAGG + Intronic
1060796566 9:126516088-126516110 CCCTCCCACCAGGAGTTCTGAGG - Intergenic
1061729198 9:132600395-132600417 CATTCCTAGGAGGGGTTCTGTGG + Intronic
1186125050 X:6404347-6404369 CATTCCTTCTGGAAGTTCTAAGG - Intergenic
1186188294 X:7043107-7043129 TATTCCTTCAAGAAGTCCTGGGG + Intergenic
1186501614 X:10055347-10055369 CATTCCTTCTGGAGGTTCTGGGG - Intronic
1188571804 X:31595528-31595550 CATTCCTTCCAAAATTTCAGAGG + Intronic
1188840988 X:35017118-35017140 CATGCCTCCCTGAAGTCCTGTGG + Intergenic
1189416470 X:40818789-40818811 CATGCCTACCAGTAGCTCTCTGG + Intergenic
1189511578 X:41667502-41667524 CCTTCCTACCAGAATCTCAGGGG + Intronic
1189571923 X:42307027-42307049 CTTTCCTCCTAGTAGTTCTGAGG + Intergenic
1191225614 X:58040138-58040160 CACTCCTAACAGAACTTCAGAGG + Intergenic
1191690528 X:63933798-63933820 CCTTCCTCACAGAAGTGCTGGGG - Intergenic
1192672289 X:73158568-73158590 CATTCTTGGCAGAGGTTCTGAGG - Intergenic
1193593401 X:83418615-83418637 CATTCCTAACAGATCTTCAGAGG + Intergenic
1194852007 X:98881366-98881388 CTTTCCTCCTAGTAGTTCTGAGG + Intergenic
1195199559 X:102534641-102534663 CTGTCCTACAAGAAATTCTGAGG + Intergenic
1195544690 X:106101198-106101220 CATTCCTAGCAGATCTTCAGAGG - Intergenic
1199706187 X:150427531-150427553 CATTCCCAAGAAAAGTTCTGAGG - Intronic
1199922250 X:152419397-152419419 CATTCCTAACAGTAGTTGTTTGG - Intronic
1201606772 Y:15794483-15794505 CATTCCTTCTGGAAGTTCTAAGG - Intergenic