ID: 1133598852

View in Genome Browser
Species Human (GRCh38)
Location 16:7319592-7319614
Sequence TCTGAGGCCCAGGAAAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 9, 3: 55, 4: 483}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133598852_1133598855 -4 Left 1133598852 16:7319592-7319614 CCATGCTTTTCCTGGGCCTCAGA 0: 1
1: 0
2: 9
3: 55
4: 483
Right 1133598855 16:7319611-7319633 CAGAAGAGATTTCAGCATCGAGG 0: 1
1: 0
2: 0
3: 10
4: 248
1133598852_1133598858 28 Left 1133598852 16:7319592-7319614 CCATGCTTTTCCTGGGCCTCAGA 0: 1
1: 0
2: 9
3: 55
4: 483
Right 1133598858 16:7319643-7319665 GAATGTGGGCACCTGAGTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 205
1133598852_1133598857 14 Left 1133598852 16:7319592-7319614 CCATGCTTTTCCTGGGCCTCAGA 0: 1
1: 0
2: 9
3: 55
4: 483
Right 1133598857 16:7319629-7319651 CGAGGCGAGATTTAGAATGTGGG 0: 1
1: 0
2: 0
3: 1
4: 21
1133598852_1133598856 13 Left 1133598852 16:7319592-7319614 CCATGCTTTTCCTGGGCCTCAGA 0: 1
1: 0
2: 9
3: 55
4: 483
Right 1133598856 16:7319628-7319650 TCGAGGCGAGATTTAGAATGTGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133598852 Original CRISPR TCTGAGGCCCAGGAAAAGCA TGG (reversed) Intronic
900789440 1:4670019-4670041 ACTGAGGCTCAGAAAAACCATGG - Intronic
900906438 1:5562898-5562920 TCAGAGGCCCAGGTACAGCTTGG - Intergenic
900955291 1:5882993-5883015 TCTGAAGCCCAGGAAGAACAGGG + Intronic
901041670 1:6368033-6368055 TCTGAGGCCCATAAAAACCCCGG - Intronic
901164454 1:7207916-7207938 TCTGCTGCCCAGCAAAACCAGGG + Intronic
901201825 1:7471581-7471603 TCTGAGACCCAGCGAGAGCAGGG + Intronic
901217330 1:7562080-7562102 TTTGTGCCCCAGGAAAAGCCAGG + Intronic
901245387 1:7726249-7726271 TCTGAGGGCATGGAAGAGCAGGG - Intronic
901717643 1:11169354-11169376 GCTAAAGCCCAGGAAAGGCAGGG + Intronic
902042686 1:13504242-13504264 ACTGAGGACCAGGAACATCAGGG + Intronic
902839222 1:19064916-19064938 ACTGAGGCCCAGGAGGGGCAGGG - Intergenic
903228507 1:21907364-21907386 TCTGAGGCCCAGAGAAGGGAAGG - Intronic
903375237 1:22861678-22861700 TCTGGGCCCCAAGAAAGGCAGGG + Intronic
903669305 1:25026026-25026048 GCTGAGGCCCAGCAAAGGCAGGG + Intergenic
904313403 1:29643802-29643824 TCTAAGACCCAGGAAAGGAAGGG + Intergenic
904525160 1:31128014-31128036 TCTGAGGCTTAGAAAAAGTAAGG + Intergenic
904625058 1:31797843-31797865 TCAGATGCCCTGGAAAAGCCTGG - Intronic
904893874 1:33799667-33799689 TCTGTATTCCAGGAAAAGCAAGG - Intronic
904962980 1:34349356-34349378 TAGGAGGCCCTGGAAAACCAGGG + Intergenic
905656214 1:39687621-39687643 TCTGAGACCCAATAAAAGCAGGG - Intronic
905668267 1:39775331-39775353 TCTGAGTCCCAGGACCAGCCGGG - Intronic
905854797 1:41302466-41302488 TCAGTTGCACAGGAAAAGCAGGG - Intergenic
906484305 1:46222408-46222430 TTCAAGGCCCAGGAAAGGCAGGG - Intergenic
906531091 1:46524486-46524508 ACAGAGGCCCAGAAAAAGCCAGG - Intergenic
906692594 1:47802402-47802424 ACTGAGGCCCAGGGAAGGGAAGG + Intronic
907559793 1:55377991-55378013 ACAGAGGCCCAGGCAAGGCATGG + Intergenic
907587767 1:55636570-55636592 ACTGAGGCCCAGGGAAATTAAGG - Intergenic
908064498 1:60388131-60388153 TGTGAGGACCAGGACAGGCAAGG + Intergenic
908670113 1:66536874-66536896 TCTGCTGCTCAGAAAAAGCATGG + Intronic
908683239 1:66685504-66685526 TTTGAGGGCCAGGGAAAGAAAGG + Intronic
908911029 1:69072348-69072370 TCGGAGAGCAAGGAAAAGCAGGG - Intergenic
910654942 1:89609926-89609948 TCTGAGGCCCATAAAAACCCTGG - Intergenic
911105664 1:94129551-94129573 TCTTGGCCCCAGGAAAAGCAAGG + Intergenic
911441022 1:97925612-97925634 TATGAGGCCCAGTGAGAGCAAGG - Intergenic
911585219 1:99682680-99682702 TCTATGCCCCAGGAAAAGAAAGG + Intronic
915537141 1:156543639-156543661 TCTGTGGCCCAGCACAAACAAGG - Intronic
915827368 1:159092489-159092511 TCTGAGGACAAGGAAGAACACGG + Intronic
916126782 1:161578471-161578493 TCTCAGGCCTAGGAATAGCCAGG - Intergenic
916136701 1:161660311-161660333 TCTCAGGCCTAGGAATAGCCAGG - Intronic
918374465 1:183895294-183895316 TCTGAAGCCCAAGAACAGCATGG + Intronic
918983700 1:191596220-191596242 TCTGAAGCCCATGAAAATCCCGG - Intergenic
919762253 1:201105657-201105679 ACTGAGGCCCAGAGAGAGCAAGG - Intronic
920058014 1:203206635-203206657 GAGGAGGCCTAGGAAAAGCACGG + Intergenic
920096977 1:203492630-203492652 TCTGAGGGCCTGGAAACACACGG + Intergenic
920559305 1:206927841-206927863 TCTGAGTCCCAGGAAAAGGTAGG + Intergenic
921824898 1:219661360-219661382 TCTGCTGCTCAGGAAAAGCTTGG + Intergenic
921827962 1:219695189-219695211 TCTGAGTCCAAGGAAACTCATGG + Intronic
921850623 1:219928856-219928878 CCTGAGGGCCAGGAGAAGCGGGG - Intronic
922987430 1:229876919-229876941 TCTGTGTCCCAGGAAAAGGGTGG - Intergenic
923153696 1:231257317-231257339 TCTGAGAAGCAGGAAAAGTAGGG - Intronic
923691690 1:236200013-236200035 TCTGAGGCACAGCAAAAGTGGGG - Intronic
924074855 1:240323292-240323314 TCTGAGGCACAAGAAATGCTTGG - Intronic
1062823709 10:553167-553189 ACTGGGGCCCAGGAAGAGCTGGG + Intronic
1063886101 10:10580562-10580584 ACTGAGGCCCAGAAAAATGAAGG - Intergenic
1064332276 10:14405090-14405112 AGTGAGGTCCAGGAAGAGCATGG + Intronic
1067299051 10:44992918-44992940 GCTGAGGCCCAGCACAAGGAAGG + Intronic
1067719914 10:48720322-48720344 TCTGTGTCCCAGGAACAGCAGGG - Intronic
1068393525 10:56430149-56430171 GCTGAGGCACAAGAAAAGGAGGG - Intergenic
1068529147 10:58165030-58165052 TCTGGAGCACAGGAAATGCAGGG - Intergenic
1068893150 10:62169354-62169376 ACTGAGGACCCTGAAAAGCATGG + Intergenic
1070143889 10:73759880-73759902 TCAGAGGCACAGGAAATACAAGG - Intronic
1070596648 10:77837472-77837494 TGTGGGGCCCAGGGAAAGGAAGG - Intronic
1070648211 10:78216046-78216068 TCTGATGGCCAGCAGAAGCAAGG - Intergenic
1070670141 10:78372065-78372087 ACTGAGGCCCAAGAAGAGAAAGG - Intergenic
1070956443 10:80466729-80466751 TCTGCGTCCTGGGAAAAGCACGG + Intronic
1070960711 10:80498345-80498367 ACTGAGGCCCAGGAGAGGGATGG + Intronic
1071166773 10:82816483-82816505 TCTGAAGCCCAGGAAAACCCTGG - Intronic
1071479061 10:86049453-86049475 TATATGGCCCAGGAAAAGCCTGG + Intronic
1072478957 10:95792163-95792185 TCTCAGTCCCAGGCAAAGCAGGG - Intronic
1072667851 10:97407455-97407477 TCTGTAGCCCAGGAAAAGGATGG - Intronic
1075731078 10:124637216-124637238 TGTGAGGCCCAGCACCAGCAAGG - Intronic
1075746272 10:124730135-124730157 TCTGATGCCCATGGAAAACATGG + Intronic
1076224370 10:128762222-128762244 TCTGGGGGCCAGGCAAATCAGGG - Intergenic
1076372075 10:129962107-129962129 TCTGAAGCCCAGGACAACCCAGG + Intronic
1076489518 10:130848306-130848328 TCAGAGTCCCAGAAAAAGCAAGG + Intergenic
1076507517 10:130987688-130987710 TCTGAGGCCCAGGGCCAGCCAGG + Intergenic
1076611591 10:131729370-131729392 GCTGAGGCTCAGGAAAGCCATGG - Intergenic
1076911000 10:133389578-133389600 TCTGTGGCTCAGGAAACCCACGG + Exonic
1077322802 11:1949843-1949865 TCTGAGGCCCAGATAGAGCCAGG + Intronic
1077577915 11:3398404-3398426 TCTGAGGCCCAGCAGGCGCAGGG + Intergenic
1079394573 11:20050729-20050751 TCTGCGGCCCAGGCATAGCTAGG - Intronic
1081163941 11:39785862-39785884 TCTGAGGCCCATAAAAACCCTGG - Intergenic
1081751150 11:45512084-45512106 GCTGAGGCCCAGAAAAAGGAAGG + Intergenic
1082802310 11:57424255-57424277 TCTGAGGCCCAAGGCTAGCATGG + Intronic
1083276639 11:61600629-61600651 GCCGAGGCCCAGGGGAAGCAAGG + Intergenic
1083784468 11:64935838-64935860 TCCGAGGCCCAGGAACAGAGCGG + Exonic
1084231860 11:67759305-67759327 TCTGAGGCCCAGCAGGCGCAGGG + Intergenic
1085216964 11:74841690-74841712 TTTGAAGCCAAGGCAAAGCAAGG + Exonic
1085448186 11:76615153-76615175 ACTGAGGCCCAGGAAAAAAAGGG - Intergenic
1086281522 11:85195064-85195086 TCTGAAGCCCAGGAAGAACAAGG + Intronic
1086333062 11:85773121-85773143 ACTGAGGCCAAGGAAAGGAAAGG - Intronic
1088235850 11:107721819-107721841 TCTGAGAACCAGGAGAACCAAGG + Intergenic
1088724133 11:112619605-112619627 TAGGAGGCCCAGCAAAGGCAGGG + Intergenic
1088756342 11:112888403-112888425 TGGGAGGCACAGGAAAAGTAGGG + Intergenic
1088994820 11:114987148-114987170 ACTGAGGCACAGAAAAGGCAAGG + Intergenic
1089297675 11:117479976-117479998 TAGGAGGCCCTGGAAAAGCTTGG - Intronic
1090908749 11:131099677-131099699 TCTGAGGCTCAAGAAAAGCATGG - Intergenic
1202805820 11_KI270721v1_random:5156-5178 TCTGAGGCCCAGATAGAGCCAGG + Intergenic
1091768708 12:3138037-3138059 GCTGAGGCCCAGAGAAGGCAAGG - Intronic
1092637629 12:10468872-10468894 TCTCCAGCCCAGGAACAGCAAGG + Intergenic
1093133715 12:15423212-15423234 TCTGAAGACCAGGAAGGGCAAGG - Intronic
1093249096 12:16778350-16778372 ACCTAGGCCCAGGAAAAACAAGG - Intergenic
1093301504 12:17464071-17464093 TCTGGAGCCTAGGAAATGCAAGG - Intergenic
1094265205 12:28550753-28550775 TCTGAGACTCAGGAAAAAAAGGG - Intronic
1095486485 12:42689916-42689938 TCTGAGGCACAGGAAAGAGAAGG + Intergenic
1095743667 12:45633889-45633911 TCTCAGTCTCAGGAAAACCATGG + Intergenic
1096839989 12:54374287-54374309 TCTGAGCCCCAGGAATAACCAGG - Intronic
1097078562 12:56412924-56412946 TCTGAAGCCCATGAAAACCTTGG - Intergenic
1097102100 12:56597067-56597089 TCTGCTGAGCAGGAAAAGCAGGG + Exonic
1097166200 12:57087852-57087874 TCTAAGCCCCAGGGAAAGGAGGG - Intronic
1097572889 12:61356020-61356042 TCTGAGGCCCATAAAAACCCTGG - Intergenic
1098041713 12:66359558-66359580 TCTGAGGCTCAGAAAAACCAAGG - Intronic
1098312504 12:69161556-69161578 TGTGAGGACAAGGTAAAGCAGGG - Intergenic
1100067115 12:90662598-90662620 TGTGAGGCACAGGTAAAGCAAGG - Intergenic
1100560089 12:95739780-95739802 ACCGAGGCTCAGGAAAAGGAAGG - Intronic
1100637458 12:96448529-96448551 TGTGAGTCACAGGAAAAGGATGG + Intergenic
1101720286 12:107345074-107345096 CCTGAGCAACAGGAAAAGCAAGG - Intronic
1102016486 12:109651210-109651232 ACTGAGGCCCAGGTAATGGAAGG + Intergenic
1103204815 12:119120385-119120407 ACTGAGGCCCAGGAAGATGAAGG - Intronic
1104342506 12:127964069-127964091 TCTGAGCCCCAGCAAAATTATGG - Intergenic
1106799059 13:33237301-33237323 AGTGAGGCCAAGGAAAAACAGGG - Intronic
1107823929 13:44310655-44310677 ACTAATGCCCAGGAAAAGCCTGG + Intergenic
1107880763 13:44830036-44830058 TGTGAGGCCCAGGAATACCTGGG - Intergenic
1108443041 13:50475614-50475636 TCTCATACCAAGGAAAAGCAGGG + Intronic
1108913988 13:55586269-55586291 TCTAAGTCACAGGAACAGCATGG + Intergenic
1109327948 13:60892778-60892800 GATGAGGCCCAAGAAAAGCATGG + Intergenic
1109762045 13:66843563-66843585 TCTGAGGCCAAGGACAAGCAAGG + Intronic
1109974281 13:69810516-69810538 TCTGAGGTGCGGCAAAAGCAAGG + Intronic
1110067108 13:71122246-71122268 GTTGAGGACCAGGATAAGCAAGG + Intergenic
1110369855 13:74727721-74727743 CCTGAGGCCTGGGATAAGCAAGG + Intergenic
1110541275 13:76709271-76709293 GTTGAGTCCCAGGAACAGCAAGG - Intergenic
1110903994 13:80862571-80862593 TCAGAGCCAAAGGAAAAGCAAGG - Intergenic
1110975758 13:81832126-81832148 AGTGAGGTCCAGGAAAAGCAAGG - Intergenic
1111111433 13:83715341-83715363 TCTCAGGGTCAGGAAAAGGATGG + Intergenic
1111274885 13:85935616-85935638 TCTGAGGCCCATAAAAAGCCTGG + Intergenic
1111869264 13:93809928-93809950 TCTGAGGTCAAGGAAGAGCAAGG - Intronic
1114194540 14:20465646-20465668 ACTGAGGCCCAGGAAGAGCAAGG - Intergenic
1114584931 14:23802631-23802653 TCTGGAGCCCAGGAAGATCAAGG + Intergenic
1115961394 14:38838295-38838317 GCTGAGGCCCAGGGAACACAGGG + Intergenic
1116777314 14:49195887-49195909 TCTCAGGCCCAGAAAAAGCAAGG - Intergenic
1117356239 14:54926268-54926290 GCTATGGCCCAGGAAAAGCAGGG - Intergenic
1118473103 14:66093579-66093601 TCTGAGACCCATAAAAAGCTTGG - Intergenic
1118589583 14:67391449-67391471 TATCAGGCCCAGCAGAAGCAGGG + Intronic
1119430114 14:74561726-74561748 ACTGAGGCTCAGAAAAAGCATGG + Intronic
1119439933 14:74621434-74621456 TCTGAGGCCCAGGGAGGGGAAGG - Intergenic
1119747605 14:77055391-77055413 TCTGAGGACCTGGAACAACACGG + Intergenic
1119854022 14:77886047-77886069 AATGAGGCACAGAAAAAGCAAGG + Intronic
1119938735 14:78617682-78617704 ACTGAGGCCCAGGAAAGTGAAGG - Intronic
1120139123 14:80907706-80907728 TATGAGGCCCAGGAAAACCAAGG + Intronic
1120650925 14:87131717-87131739 TCTGAGAAGCAGGAGAAGCAAGG + Intergenic
1121267599 14:92614348-92614370 TCTGAGGCCCAGTAGAGGCCAGG - Intronic
1122363045 14:101178730-101178752 TCTGAGAACCCGGAACAGCATGG + Intergenic
1122802445 14:104238444-104238466 TCTGAGGCCCTGGAATTGCAGGG + Intergenic
1122890657 14:104730758-104730780 TCTGGGGGCCAGGGAAGGCACGG - Intronic
1202834544 14_GL000009v2_random:68047-68069 TCAGAGGCTCAGGAACAGAAGGG + Intergenic
1124628392 15:31323695-31323717 TCCCAGGCCAAGGACAAGCAGGG - Intergenic
1126751175 15:51878046-51878068 GCTGAGGTCCAGAAAAACCAAGG - Intronic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128217214 15:65942830-65942852 ACTGAGGCCCAGGATTTGCAGGG - Intronic
1128577363 15:68785341-68785363 ACTGAGGCCCAGGAAGTGAAGGG + Intronic
1128864848 15:71106771-71106793 TCTGAGACCCAGGCTAACCAAGG + Intronic
1129665660 15:77578151-77578173 TCTGAGGGCCAGGGAAACAAGGG - Intergenic
1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG + Intronic
1130108451 15:80946187-80946209 TCTGAGCTGCAGGAAGAGCATGG - Intronic
1130146713 15:81280113-81280135 ACTGAGGCCCAGGGAAGGGAAGG - Intronic
1130546101 15:84858317-84858339 CCGGGGGCCCAGGAAAAGCCTGG + Exonic
1131172184 15:90186252-90186274 TCTGAAGCTCAGGAAAATCTAGG + Intronic
1131186105 15:90275373-90275395 GCTGACGCCCCAGAAAAGCATGG - Exonic
1131279437 15:91008895-91008917 TCTGGGTACCTGGAAAAGCATGG + Intronic
1131362393 15:91805038-91805060 TCTCAGGTCCAGGAAAATGATGG - Intergenic
1131417833 15:92276228-92276250 TCCCAGGCCCAGGAAAAGTAGGG - Intergenic
1132747492 16:1443069-1443091 TCAGAGGCCCAGGAAAGCCATGG - Intronic
1133206617 16:4237892-4237914 GGGGAGGCACAGGAAAAGCAAGG - Intronic
1133598852 16:7319592-7319614 TCTGAGGCCCAGGAAAAGCATGG - Intronic
1135057059 16:19240515-19240537 TCTGAGGCCCATAAAAACCCTGG - Intronic
1135803292 16:25519171-25519193 TCTGGGGAGCAGGAAAAGCTAGG - Intergenic
1136010374 16:27359583-27359605 CCAGAGTCCCTGGAAAAGCAAGG - Intronic
1136105753 16:28029130-28029152 ACTGAGGCCCAGAGAAGGCAGGG - Intronic
1136319057 16:29470770-29470792 TCTGGGCTCCAGGACAAGCATGG - Intergenic
1136372906 16:29847358-29847380 TCTCAGGCCCAGCCACAGCAAGG - Exonic
1136433628 16:30210114-30210136 TCTGGGCTCCAGGACAAGCATGG - Intergenic
1136454118 16:30370690-30370712 TCAGAGGACGAGGAAAGGCAGGG + Intergenic
1136641250 16:31567536-31567558 CCTCATGGCCAGGAAAAGCATGG + Intergenic
1136663730 16:31789841-31789863 CCTCATGGCCAGGAAAAGCATGG - Intronic
1136929668 16:34407907-34407929 TCTGGAGCCCAGGAAATGCAGGG + Intergenic
1136974906 16:35003898-35003920 TCTGGAGCCCAGGAAATGCAGGG - Intergenic
1139183140 16:64770812-64770834 TCTGAGGCCCATGAAAGCCCTGG + Intergenic
1140254813 16:73326059-73326081 TTTGAAGCCCAGGAAAGGGATGG + Intergenic
1140307143 16:73813743-73813765 TCTGAGGTACAGGAAGAGGAGGG - Intergenic
1141164351 16:81650551-81650573 TCAGAGGCCCCAGAAAATCATGG + Intronic
1141404052 16:83775913-83775935 TCTGGGGCCCAGGAAATATAGGG - Intronic
1141413743 16:83854224-83854246 AATGAGGCCCTGGGAAAGCAAGG + Intergenic
1141596263 16:85098643-85098665 TATGGAGCCCAGGAAAAGAAGGG - Exonic
1141634021 16:85304219-85304241 ACTGAGTCCCAGGAAAAGGAAGG + Intergenic
1141829303 16:86500718-86500740 TGGCAAGCCCAGGAAAAGCACGG - Intergenic
1142184801 16:88689613-88689635 TCTGAGTCCAAGGACAAGCAAGG - Intergenic
1142194228 16:88732219-88732241 TCTGTGGCCCAGGCAAACCCAGG + Intronic
1143173746 17:4944947-4944969 TTGAAGGCCCAGGAAAAACAAGG - Exonic
1143902619 17:10185438-10185460 TCTGAGGGCCAGGAGAAGCTGGG - Intronic
1145217056 17:21060693-21060715 TCTGAGGCCCATAAAAACCCTGG - Intergenic
1145814254 17:27784000-27784022 TCTGAGGCTGAGGAACAGCACGG - Intronic
1146123913 17:30217428-30217450 ACTGAGGCCCAGGAAGAGCTGGG + Intronic
1146616416 17:34360453-34360475 TCTGTGACCTAGCAAAAGCAGGG + Exonic
1146683524 17:34825142-34825164 ACTGAGGGCAAGGAAGAGCATGG - Intergenic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1147185600 17:38711601-38711623 ACTGAGGCCCAGAAGAGGCAAGG - Intronic
1148496543 17:48056319-48056341 TCTGAGGGGCAGGACAAGGAAGG + Intronic
1148715639 17:49713838-49713860 TCTAGAGCCCAGGAAGAGCAAGG + Intronic
1148799126 17:50212022-50212044 TCTGCTGGCCAGGAAAGGCATGG + Intergenic
1148896017 17:50839712-50839734 TCCGAGGCGCAGGTAAAGCTGGG - Exonic
1148911695 17:50946457-50946479 ACTGAGGCCCAGAGAAGGCAAGG - Intergenic
1149311139 17:55395346-55395368 TCTGAGGACTAGGAATAGAAAGG + Intronic
1151355456 17:73555468-73555490 GCTGAGGCCCAGGAAAGGAAGGG + Intronic
1152037727 17:77883642-77883664 TCTCGGCCCCAGGACAAGCATGG + Intergenic
1152161032 17:78668866-78668888 TTTAAGGCCCAGGAAAGGCCTGG - Intergenic
1153723992 18:7936808-7936830 TCTGAAGCCCATGAAATCCATGG + Intronic
1153729560 18:7995991-7996013 TCAGAAGCCCAGAAAAACCAAGG - Intronic
1154349916 18:13574328-13574350 TCCTAGGCCCAGGGACAGCATGG - Intronic
1155133604 18:22964472-22964494 TAGGAGTTCCAGGAAAAGCAAGG - Intronic
1155170119 18:23260780-23260802 GCTGAGGGCCAGCAAGAGCAGGG + Intronic
1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG + Intronic
1160372701 18:78388102-78388124 TCTGAGTCTCAGGACAAGGAAGG - Intergenic
1160741172 19:686782-686804 GCTGAGGCCCAGGGAAGGCAGGG - Intronic
1160943077 19:1629166-1629188 ACTGAGGCTCAGGAAGGGCAGGG - Intronic
1161336160 19:3714746-3714768 ACTGAGGCCCAGAGATAGCAGGG - Intronic
1162464192 19:10830753-10830775 GCTGAGGCCCAGGGAGGGCAGGG + Intronic
1162787611 19:13045521-13045543 ACTGAGGCCAAGGAAAGGAACGG + Intronic
1163248650 19:16112528-16112550 TCTGAGGCTCAGGGAGGGCATGG + Intronic
1163264181 19:16208346-16208368 GATGAGGAGCAGGAAAAGCACGG - Intronic
1163335835 19:16671045-16671067 ACTGAGGCCCAGGGAAGGGAGGG + Intronic
1164589155 19:29496569-29496591 GCTGAGCCCAAGGAATAGCAAGG - Intergenic
1165141104 19:33700463-33700485 GCTGTGGCCCAGGAAAAGTGAGG - Intronic
1165914853 19:39251883-39251905 ACTGAGGCCCAGGAAAGTAAAGG + Intergenic
1166148476 19:40853067-40853089 ACTGAGGCCCAGCAAAGGAAAGG - Intronic
1166152617 19:40884852-40884874 ACTGAGGCCCAGCAAAGGAAAGG - Intronic
1167106003 19:47430146-47430168 CCAGAGGCCCAGGAAGAGCGCGG + Exonic
1167110083 19:47455180-47455202 ACTGAGTCCCAGGAAGAGAAGGG + Intronic
1167797592 19:51719800-51719822 CATGAGGCCCAGGATGAGCAGGG + Exonic
1168132824 19:54332050-54332072 ACTGAGGCCCAGGCAGAGGAGGG + Intergenic
1202638150 1_KI270706v1_random:59645-59667 TCAGAGGCTCAGGAACAGAAGGG - Intergenic
926251746 2:11158897-11158919 TTTGAATCCCAGGGAAAGCAGGG + Intronic
926528052 2:14007561-14007583 TATGACGCACAGCAAAAGCATGG - Intergenic
926785581 2:16515476-16515498 TCTGAGCCCCAGTAAAATGATGG - Intergenic
926982054 2:18583493-18583515 TATGAGACACAGTAAAAGCATGG - Intronic
927026764 2:19076182-19076204 GCTGAGGCTCAGAAAAGGCAGGG - Intergenic
927085869 2:19673471-19673493 TCTAAGGCCAAGGGAAAGGAGGG + Intergenic
927373540 2:22385820-22385842 TCTGAGGCCCATAAAGAGAATGG - Intergenic
927418980 2:22909649-22909671 ACTGAGCCCCATGAAAAGCTGGG + Intergenic
927755178 2:25702502-25702524 ACTGGGACCCAGGAAGAGCATGG - Intergenic
927869658 2:26615503-26615525 GTTGAGGCCCAGGAAGAGGAAGG + Intronic
928092885 2:28386812-28386834 TCTGAGGATCTGGGAAAGCAAGG - Intergenic
928451680 2:31383626-31383648 GGTGAGCCCCAGGAGAAGCAGGG + Intronic
931337332 2:61360133-61360155 TCTAAGATCCAGGAAAGGCAAGG + Intronic
931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG + Intergenic
931500075 2:62855612-62855634 TCTGAGGCCCATGAAAGCCCTGG + Intronic
931709384 2:64975078-64975100 TCTCAGGGCCATCAAAAGCAAGG - Intergenic
931790111 2:65657389-65657411 TCTGAGGCTCAGAAAATGCTTGG - Intergenic
931999540 2:67872021-67872043 TGTGAGGCCCAGGGAAAGTAAGG + Intergenic
932582113 2:72998848-72998870 TCTGAGGGCCAGGCCAGGCAAGG - Intronic
932739796 2:74282830-74282852 TCAGAGGCCCAGGAAGGGGAAGG - Intronic
933852952 2:86385571-86385593 CCTGAGGCCCTGGGAATGCATGG + Intergenic
934537461 2:95147200-95147222 TCTGAGACCCAGTAAATGTAGGG + Intronic
934783213 2:96986210-96986232 ACTGAGGCCGAGGAACCGCAGGG - Intronic
934889981 2:98058935-98058957 TCTGGGCCCCAGGGAAAGAAGGG - Intergenic
935109665 2:100080942-100080964 ACAGAGGTCAAGGAAAAGCAAGG + Intronic
936084124 2:109455039-109455061 TCTGAGCCTCAGGAACATCATGG - Intronic
936125309 2:109784267-109784289 ACAGAGGTCAAGGAAAAGCAAGG - Intergenic
936219384 2:110587201-110587223 ACAGAGGTCAAGGAAAAGCAAGG + Intergenic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
936578619 2:113676110-113676132 TCTGAATCCCAGGAAGAGGAGGG - Intergenic
937352204 2:121173218-121173240 TCTGAGCCCCAGGGAAGGGATGG - Intergenic
938558251 2:132446269-132446291 TCTGAGGCCCAGCACATGCCTGG - Intronic
938696849 2:133842505-133842527 TGTGAGGGTCAGGAAAAGAATGG + Intergenic
939590749 2:144061094-144061116 TCTATGGCTCAGGAAAAGTAGGG + Intronic
939909626 2:147963573-147963595 TCTCAGGCCCAGGAGATGCCTGG - Intronic
940195010 2:151084257-151084279 AGTGAGGACCAGAAAAAGCAAGG - Intergenic
940409448 2:153344005-153344027 ACTGTGCCTCAGGAAAAGCAGGG - Intergenic
940447821 2:153797955-153797977 GCTGTGGCCCATGAAAAGCCAGG - Intergenic
940584385 2:155626626-155626648 TCTTATGCCTAGGAACAGCAAGG - Intergenic
940623561 2:156144756-156144778 TTTGAGGCCCAGGATAAAGAGGG - Intergenic
942711903 2:178846271-178846293 ACTGAGCCCCATGAAATGCAGGG - Intronic
943285011 2:185986864-185986886 TCTGGGTTCCAGGAAAACCATGG - Intergenic
945930215 2:215847368-215847390 TCTCAGGCCTAGGAAAAGTCAGG - Intergenic
946241238 2:218357292-218357314 TCTGAGTCCCAGGAGAATCAAGG - Intronic
948704042 2:239778421-239778443 TCTGAGGCCCGGGAGGGGCATGG - Intronic
949014473 2:241701813-241701835 TCGGAGGCCGAGGAGGAGCAGGG - Intergenic
1168844221 20:932354-932376 TCTGAGCCCCAGGAGACACAGGG - Intergenic
1169695740 20:8385182-8385204 GCTCAGGCCCAGGAAGATCAGGG + Intronic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1172329452 20:34064885-34064907 TCTGAGGCCCAGCAAGTGAAAGG + Intronic
1172632760 20:36390320-36390342 ACTGAGGCCCAGAGAAGGCAGGG + Intronic
1172654705 20:36529705-36529727 TCTCAGGCCCAGGGGATGCACGG + Intergenic
1173159025 20:40638808-40638830 TCTGAGGCCCAAGGAAATAAGGG + Intergenic
1173701504 20:45075855-45075877 TTTGAGTCCCAGGAGAAGCCTGG + Exonic
1173721356 20:45260859-45260881 ACTGAGGCCCAGAGAAAGGAAGG - Intergenic
1174180399 20:48670704-48670726 TCAGAGGCCTAGGAGAATCAAGG - Intronic
1174430081 20:50461147-50461169 ACTGAGGCCCAGGAGAGTCATGG - Intergenic
1175998963 20:62823701-62823723 TCTGATGCTCAGGAAACCCAGGG - Intronic
1176074944 20:63244189-63244211 CCTGAGGTCCAGGAGAGGCAGGG - Intronic
1176448451 21:6841410-6841432 TCTGAGGCAGAGGAGAGGCAAGG + Intergenic
1176668695 21:9711915-9711937 GGTGATGCCCAGAAAAAGCATGG - Intergenic
1176826621 21:13706432-13706454 TCTGAGGCAGAGGAGAGGCAAGG + Intergenic
1178095675 21:29212500-29212522 TCTGGGCCCCAGCAACAGCACGG - Intronic
1178422136 21:32451436-32451458 TCTGAGGCCCAGCAGGCGCAGGG - Intronic
1178898001 21:36576582-36576604 CCTGAGGCCCAGCTAAAGCAGGG - Intergenic
1179191640 21:39127068-39127090 TCTAAAGCCCAGGAAGTGCATGG - Intergenic
1180007131 21:45028012-45028034 TCTGGGGCCCAGGGGGAGCAGGG - Intergenic
1180085227 21:45505250-45505272 TGTGAGGGCCAGGAAATGAAGGG - Exonic
1180139036 21:45880262-45880284 TCCGAGGCCCAGGGCCAGCAGGG - Intronic
1180363817 22:11922234-11922256 TCAGAGGCTCAGGAACAGAAGGG + Intergenic
1180898671 22:19355644-19355666 CCTGACTCTCAGGAAAAGCAGGG + Intronic
1180979094 22:19870333-19870355 GCTGGGGGCCAGGACAAGCAGGG + Intergenic
1181163502 22:20971388-20971410 GCTCAGGCCCAGGCATAGCAGGG - Intronic
1181782214 22:25201500-25201522 CCTGAGGCCCAGGAGTAGCCTGG - Intronic
1181950677 22:26551427-26551449 TCTGAGCCCCAGGAAATGGATGG - Intronic
1182294335 22:29304385-29304407 ACTGAGGCCCAGAGAAGGCATGG - Intergenic
1182447088 22:30396165-30396187 ACTGAGGCCCAGATAAGGCATGG - Intronic
1183705078 22:39471040-39471062 AAGGAGGCCCAGGAAAAGCCGGG - Intronic
1184092635 22:42300511-42300533 ACTGAGGCCCAGGAAGGGAAAGG + Intronic
1184164162 22:42717593-42717615 CCTCAGGCCCAGGAGAAGGAGGG - Intronic
1184665715 22:45987823-45987845 TCTGAGGCCCATAAAAACCCTGG + Intergenic
1184957778 22:47903171-47903193 TGTGAGGCACAGGAAACCCAAGG - Intergenic
950703756 3:14767451-14767473 ACTGAGGCCCAGCAAGGGCAAGG - Intronic
950771379 3:15314334-15314356 CCTGAGGCCCCCAAAAAGCATGG - Intronic
951108972 3:18778496-18778518 TATGAGACCCTGGAAAAGAAAGG - Intergenic
952596320 3:35023005-35023027 ATTGAGTCCGAGGAAAAGCATGG + Intergenic
952827653 3:37537591-37537613 TCCGTGCCCCAGGATAAGCAGGG - Intronic
952960799 3:38588005-38588027 CCTGAGGAGCAGGAACAGCAAGG - Intronic
953016384 3:39080821-39080843 GCAGAGGCACAGGAAAAGGATGG + Intronic
953144569 3:40262544-40262566 CAAGAGGCCCAGGAAAAGCTGGG + Intergenic
954533549 3:51341172-51341194 TCAGAGGCCCAGGAGCAGCCTGG - Intronic
954902841 3:54034721-54034743 ACTGAGGCCCAGCAAGGGCAGGG - Intergenic
954990874 3:54839725-54839747 CCTGAGGCCCAGGAAAGCCCAGG - Intronic
955548041 3:60052594-60052616 TCTGATTCCCAGGAAAAGGCAGG - Intronic
956025884 3:64982821-64982843 TCTACAGCTCAGGAAAAGCAGGG - Intergenic
956728835 3:72178123-72178145 TCTGGGGCCCAGGGAAAGCACGG + Intergenic
956935307 3:74094348-74094370 ACTGAGGCCCAAGACAAGGAGGG - Intergenic
957048492 3:75394608-75394630 TCTGAGGCCCAGCAGGCGCAGGG + Intergenic
958004966 3:87798807-87798829 TCTGAGCCTCAGGAAAAATAAGG - Intergenic
958771230 3:98428438-98428460 GCTGAGGCACAAGCAAAGCATGG + Intergenic
960121717 3:113953951-113953973 TCCAAGGCTCAGGAAAAACAGGG - Exonic
961507225 3:127378111-127378133 ACTGAGGCCCTGCAGAAGCAGGG + Intergenic
961880573 3:130058721-130058743 TCTGAGGCCCAGCAGGCGCAGGG + Intergenic
962463367 3:135635142-135635164 TCTGAAGCCGAGGAAGAGGAAGG + Intergenic
962476134 3:135757015-135757037 TATGAGGCCAAGGAGAGGCACGG - Intergenic
962752088 3:138441015-138441037 TCTGAGGCTCTGAGAAAGCATGG + Intronic
963265147 3:143232629-143232651 TCTGAGGCTCAGGAGATGCGAGG - Intergenic
963306077 3:143654769-143654791 TCCTAGGCCCAGGAAAAGGAAGG + Intronic
963712824 3:148767140-148767162 TGTAAGGCACAGGAAGAGCATGG - Intergenic
965005651 3:163019235-163019257 TCTGAGGCCCATTAAAACCCTGG + Intergenic
965541440 3:169875411-169875433 TCTGAGGCCCATGAAAGCCCTGG + Intergenic
965742194 3:171887089-171887111 TCTGAGGCACAGAACAAACAAGG + Intronic
966918516 3:184597769-184597791 ACTGAGGCCCAGGGAGAGGAGGG - Intronic
968082304 3:195854866-195854888 ACTCAGGCCCAGGGAAAACAGGG + Intergenic
968592556 4:1466229-1466251 TCTGGGGCCCAGGAAGTGAACGG - Intergenic
968678700 4:1900952-1900974 TTTGAGTCCCAGGAAATGAAAGG + Exonic
968751093 4:2389404-2389426 ACTGAGGCCCAGGAAAGGGCTGG - Intronic
968992966 4:3927065-3927087 TCTGAGGCCCAGCAGGCGCAGGG + Intergenic
969278224 4:6151321-6151343 TCTCAAGCCCAGCAATAGCAGGG + Intronic
969581319 4:8067216-8067238 TCTGAGGCCCCGGACCTGCAGGG - Intronic
969632379 4:8346227-8346249 ACTGAGGCCCAGAAAGAGCCAGG - Intergenic
969822509 4:9731296-9731318 TCTGAGGCCCAGCAGGTGCAGGG - Intergenic
973029872 4:45324441-45324463 TTTAAGGCACAGGAAAGGCAGGG + Intergenic
974003279 4:56531346-56531368 TCTGAGTCCCTTGAAACGCAAGG - Intronic
974648368 4:64723276-64723298 CCTGAGAACCAGGAAGAGCAAGG - Intergenic
975254905 4:72222477-72222499 TGTGAAGCCAATGAAAAGCATGG + Intergenic
976120609 4:81776770-81776792 TATGAGGCACAGCAAAAGTAAGG + Intronic
976511102 4:85910728-85910750 TCTGAGGCCCATGAAACCCTTGG - Intronic
977571144 4:98631234-98631256 TCTGAGACCCACGGCAAGCAAGG + Intronic
977645746 4:99409879-99409901 TCTCAGGCAAAGGAAAAACATGG - Intergenic
977887796 4:102272796-102272818 TCTGAGGGCAAGCAGAAGCAGGG + Intronic
978423787 4:108561451-108561473 TCAGAGGCCCCAGAAAGGCAGGG - Intergenic
979293147 4:119000312-119000334 TCTCAGACCCAGGAAAATGAAGG - Intronic
979561612 4:122108089-122108111 TCTAAATTCCAGGAAAAGCAGGG + Intergenic
979575984 4:122293367-122293389 ACGGAGGGCAAGGAAAAGCAGGG + Intronic
980503124 4:133682498-133682520 GCTGAGGCTCAAGAGAAGCAAGG - Intergenic
980893873 4:138842689-138842711 TCTGAGGCCCGGGAGAAATAAGG - Intergenic
981341347 4:143625382-143625404 TATGAGGCCAAGGAATTGCATGG - Intronic
983208426 4:164934074-164934096 TTTGAGGCAAAGGGAAAGCATGG + Intergenic
983581704 4:169316040-169316062 TCTGTCGTCAAGGAAAAGCAAGG - Intergenic
985364046 4:189207791-189207813 TCTCAGTCGCAGTAAAAGCAAGG + Intergenic
985406087 4:189639610-189639632 GGTGATGCCCAGAAAAAGCATGG + Intergenic
1202765480 4_GL000008v2_random:145503-145525 TCAGAGGCTCAGGAACAGAAGGG - Intergenic
985625447 5:983010-983032 GCAGAGGCACAGGGAAAGCATGG - Intergenic
986750972 5:10787657-10787679 TCTGAGCCTTGGGAAAAGCAAGG + Intergenic
986917942 5:12647582-12647604 TCTCAGGTCCAGAAGAAGCAGGG + Intergenic
987401711 5:17485299-17485321 ACTGAGGGGCAGGAAATGCATGG - Intergenic
987405131 5:17517572-17517594 TCTGAGGGGCGGGAAATGCAGGG - Intergenic
987405575 5:17521006-17521028 TCTGAGGGGCGGGAAATGCAGGG - Intergenic
987406471 5:17527874-17527896 TCTGAGGGGCGGGAAATGCAGGG - Intergenic
987407227 5:17583097-17583119 TCTGAGGGGCGGGAAATGCAGGG + Intergenic
987407927 5:17588296-17588318 TCTGAGGGGCGGGAAATGCAGGG + Intergenic
987408374 5:17591733-17591755 TCTGAGGGGCGGGAAATGCAGGG + Intergenic
988301612 5:29436823-29436845 TTTGAAGCCTAGGAAAAGAAGGG + Intergenic
988947706 5:36223079-36223101 TGTCAGTCCCAGGCAAAGCAGGG - Intronic
989279168 5:39621795-39621817 TCTGAGGCCCATGAAAACCCCGG - Intergenic
989398471 5:40983827-40983849 TCTGAGGCACAGGAAAGGGCAGG - Intergenic
989511296 5:42290352-42290374 TCTGAGACCTAGGAAAAGGAGGG - Intergenic
990944984 5:61239730-61239752 GCTGATACCCAGGAAAAGTAGGG + Intergenic
992500276 5:77335456-77335478 CCAGAGGCCCAGGGAAAGCCAGG + Intronic
995183334 5:109248872-109248894 TCTGAGGGCCAGGACAAAGAAGG - Intergenic
996638961 5:125729979-125730001 TCAGAGAGCAAGGAAAAGCAGGG + Intergenic
996742161 5:126809901-126809923 TCTGAAGCCAAGGAAAGGCCTGG - Intronic
996844751 5:127886851-127886873 GCTGAGGCCAAGGAAATGAAAGG + Intergenic
997057730 5:130464593-130464615 TCTGATGACCAGGAATAACAGGG - Intergenic
997537237 5:134632434-134632456 ACTGAGGCCCAGGGGAAGGAAGG + Intronic
998494322 5:142574158-142574180 CCTGAGGTTCAGGAAAAACATGG - Intergenic
999088648 5:148915328-148915350 ACTAAGGCCCAGGAAGAGGAAGG + Intergenic
999136525 5:149323802-149323824 TCAGAGGCACTGGAAATGCAGGG + Intronic
999504952 5:152184999-152185021 ACTAAGGCCCAGAGAAAGCAAGG + Intergenic
999731393 5:154478627-154478649 ACTGAGGCCCAGGGAAAGAAAGG + Intergenic
1000241442 5:159412262-159412284 TCTGAGGCTTTGGAAAAACAAGG + Intergenic
1001301387 5:170536326-170536348 ACTGAGGCCCAGGGAAAGCAAGG - Intronic
1001434543 5:171688973-171688995 TCTGAGGCCCAAGGGAGGCAAGG - Intergenic
1001851101 5:174966503-174966525 TCTGAGAACCAGAAAAAGCAAGG - Intergenic
1002606903 5:180389082-180389104 TCTGAGGCCCAGGAGATGGCAGG - Intergenic
1002882068 6:1261992-1262014 TCTGAGGACCAAGGAAAACAGGG - Intergenic
1004187870 6:13436989-13437011 TCAGAGGCTCTGGGAAAGCAGGG + Intronic
1004394244 6:15234208-15234230 TCTGAGGCCTGGGAAAATCTGGG + Intergenic
1004456846 6:15799335-15799357 TCTGAGGACAAAGAAAGGCAAGG + Intergenic
1006425860 6:33962656-33962678 TCTGGAGCCCAGGAAACCCAGGG - Intergenic
1007399231 6:41594330-41594352 TCTGAGCCACAGCCAAAGCATGG + Intronic
1007839112 6:44701256-44701278 CCTGAGGCCCCGGGAAAGCCAGG - Intergenic
1008179798 6:48314460-48314482 TCTGAGGAACAGGAAAGGAAAGG - Intergenic
1008477245 6:51945356-51945378 TCTGAGGCCCAGCAATTGTATGG - Intronic
1010269043 6:73900776-73900798 GCTGAGGCACAAGAGAAGCATGG + Intergenic
1010942171 6:81931712-81931734 TCTGAGTCCAAGGAAATCCATGG - Intergenic
1010973633 6:82289354-82289376 TCTGAGGCAGGGGAAGAGCAAGG + Intergenic
1011530142 6:88312523-88312545 TCTGAGGCCCATAAAAACCCAGG - Intergenic
1011557225 6:88583863-88583885 CTTAAGGACCAGGAAAAGCATGG - Intergenic
1011774328 6:90711546-90711568 AATGAGGCCAAGGAAAAGCAGGG - Intergenic
1013174655 6:107667157-107667179 TCAGAAGCCAAGGAAAAGCCAGG - Intergenic
1013364593 6:109426929-109426951 TCTTGTGCACAGGAAAAGCAGGG - Exonic
1013530543 6:111016032-111016054 TCTGGGGCACTGGAAAAGTAGGG - Intronic
1015260598 6:131233567-131233589 TCTTAAGCCCAGGAAAAACAAGG + Intronic
1016917820 6:149261091-149261113 TCAGAGTTCAAGGAAAAGCAAGG + Intronic
1017577300 6:155818940-155818962 TTTAAGGACAAGGAAAAGCAAGG - Intergenic
1018115046 6:160574626-160574648 ACTGAGGCCCAGGTAAAGTTGGG + Intronic
1018442495 6:163826002-163826024 TCACAGGCCTAGGAAAGGCAAGG - Intergenic
1019070149 6:169338805-169338827 TTTAAGGCCCAGGAAAGGCCTGG + Intergenic
1019316085 7:387577-387599 ACTGAGGCGCAGGAAGGGCACGG + Intergenic
1019352536 7:561760-561782 TCTGGGGCCCGGCAAAGGCACGG + Intronic
1019605376 7:1907495-1907517 CCTGAGGCCCAGGCCAAGCCAGG + Intronic
1020040381 7:4996807-4996829 CCACAGGCCCAGGAAATGCAGGG - Intronic
1020901167 7:14005259-14005281 TCTGAGCCCCAGTAATACCATGG - Intergenic
1021100777 7:16584760-16584782 TCTGAGGCCCTGGAGAAGTTGGG + Intergenic
1021553719 7:21898947-21898969 TCTGAGGACCAGGGATGGCAAGG - Intronic
1021740903 7:23684218-23684240 TTCGAGGCCCAGGAAAGGCCTGG + Intronic
1022581549 7:31560201-31560223 TCTGTGTTCCAGGAATAGCAAGG + Intronic
1023742333 7:43292019-43292041 TCTCAGCCCCAGGAAGAGAAGGG - Intronic
1023871007 7:44263064-44263086 TCTGGGGGACAGGAAAAACAAGG + Exonic
1024612704 7:51081122-51081144 TCTGAGTCCCAAGAAGGGCAAGG + Intronic
1025582342 7:62736339-62736361 TCTGAAGCCCAGGAAGAACAAGG + Intergenic
1025830484 7:65044699-65044721 TCTGAGTCTCAGACAAAGCAAGG - Intergenic
1025962803 7:66238331-66238353 TTTAAGGCCCAGGAAAGGCCTGG + Intronic
1026870507 7:73848369-73848391 TTTAAGGCCCAGGAAAGGCCTGG + Intergenic
1027347427 7:77275707-77275729 TAGGAGGCCCAGGAAAATCATGG - Intronic
1029111095 7:98213362-98213384 ACTGAGGCCCGGGACAAGCCCGG + Intergenic
1030397537 7:109006360-109006382 ACTCAGGCCTAGGAAGAGCAAGG + Intergenic
1031062467 7:117067447-117067469 TCTGAGTACAAGGAAAAGTAGGG + Intronic
1031786601 7:126041022-126041044 TCTGAGGCCTATGAAAACCCTGG + Intergenic
1031977569 7:128103754-128103776 CCTGAGGCCCAGGAGAGGCCGGG + Intergenic
1032012306 7:128354656-128354678 TCTGAGAACAAGGAAAAGGAAGG + Intronic
1032159637 7:129500873-129500895 TCTGGAGCTCAGGAAAAGCAGGG + Intergenic
1032946905 7:136864703-136864725 ACTGAGGTCAAGGAAAAGAAAGG + Intergenic
1033369897 7:140698077-140698099 ACTGAGGCCCAGGAAATGAAAGG + Intronic
1034899251 7:154897350-154897372 TCTGAAGCCCAGAGAAGGCAAGG + Intergenic
1035068462 7:156124416-156124438 CCTGAGGCCCAGGGAGGGCATGG - Intergenic
1036090272 8:5657596-5657618 TCTGATTCCTAGGAAAATCATGG + Intergenic
1037884047 8:22586985-22587007 CCTGAGGCCCAGGGAGAGGAAGG - Intronic
1038049417 8:23795046-23795068 TCAGAGGCCAAGGAAAAGGCAGG - Intergenic
1038404121 8:27309253-27309275 TCTGGGGCCCAGGTAAAGGAGGG - Intronic
1039379435 8:37071226-37071248 ACTGAGGCCCTGGAGAAGCCAGG + Intergenic
1039406013 8:37313077-37313099 TCTGAGGCCCTGGAGAAGATGGG - Intergenic
1040873325 8:52123741-52123763 ACAGAGACCCAGGAACAGCAGGG - Intronic
1041890097 8:62858925-62858947 TCTGCAGCCCAGGCAATGCACGG - Intronic
1043403650 8:79908701-79908723 AGTGAGGCCCAGGGAAAGCAAGG - Intergenic
1045388054 8:101689983-101690005 TCTGAGGTCAGGGAAGAGCAGGG + Intronic
1045437997 8:102183842-102183864 TCTGAGGCCAAGAGAAAGCAAGG + Intergenic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1046685987 8:117227443-117227465 ATTGAGTTCCAGGAAAAGCAAGG - Intergenic
1048748487 8:137643462-137643484 TATTAGGCCAAGGAAAAGTAGGG + Intergenic
1049635705 8:143687738-143687760 TCTGAGACCAGGAAAAAGCAGGG - Intronic
1049663354 8:143830422-143830444 TCTGAGGCCCTGCTCAAGCAAGG + Intergenic
1049679705 8:143912632-143912654 AGTGGGGCCCAGGAAAAGGAAGG + Intergenic
1051126383 9:13810363-13810385 TCTGACTCGCAGGAAAAGCTGGG - Intergenic
1051854685 9:21550496-21550518 ACTGAGGCCAAGGAAAGTCAAGG - Intergenic
1052393936 9:27914624-27914646 TCTAAGACCCAGAAAAAGTAAGG + Intergenic
1052863966 9:33453804-33453826 TCTGAGGCACAGGGAGAGCAGGG + Intergenic
1053031000 9:34777730-34777752 TCTGAGGCACTAGAGAAGCATGG - Intergenic
1053101707 9:35376925-35376947 GCTGGACCCCAGGAAAAGCAGGG + Intronic
1053416135 9:37947908-37947930 ACTGAGGTCCAGAAAAAGAAGGG - Intronic
1053474563 9:38372658-38372680 ACTGAGACCCAGGAACAGAAAGG - Intergenic
1055375129 9:75640648-75640670 TCTGTGGCTCAGGAATACCAGGG - Intergenic
1055479283 9:76693944-76693966 TCAGAGGTTCAGCAAAAGCATGG + Intronic
1055989899 9:82094293-82094315 ACTGAGGCCCAGGACAAGATAGG + Intergenic
1056289580 9:85129123-85129145 TCTCAGGCCACAGAAAAGCATGG + Intergenic
1056306544 9:85296211-85296233 TGTAAGGCCCAGGAAAAGTGTGG + Intergenic
1057044908 9:91878268-91878290 CCTGAAGCCCAGGAAAGGGAGGG - Intronic
1058359999 9:104133877-104133899 TGTGAGGCCCAGGAGAAAAAGGG - Intronic
1059060468 9:111030621-111030643 TCTGAGACCCAGATGAAGCAGGG + Intronic
1059253156 9:112905236-112905258 TCTGAGGCTCAGGGAAAGCACGG + Intergenic
1059464928 9:114462432-114462454 ACTGAGGCCCAGGGAGAGGAAGG + Intronic
1059842857 9:118237708-118237730 TCTGACTCCCAGGCTAAGCAAGG + Intergenic
1059927060 9:119220183-119220205 TCTGAGACTCAGGAAAAAAATGG + Intronic
1059964674 9:119601967-119601989 ACTGAGGCCCAGGAAGGGGAAGG - Intergenic
1060756590 9:126218592-126218614 CCTGAGGCCGAGGGGAAGCAGGG + Intergenic
1060943857 9:127558436-127558458 ACTGAGGCCCAGGAAGATGATGG - Intronic
1060989580 9:127840709-127840731 TCTGGGGTCCAGGAAACCCAGGG - Intronic
1061001121 9:127903638-127903660 TCTGAGGCTCAGGAAGCGGATGG - Intronic
1061222815 9:129262143-129262165 CCTGAGGACCAGGGAAGGCAGGG - Intergenic
1061419066 9:130463524-130463546 ACTGAGGCCCAGGAAGGGAAAGG - Intronic
1061422562 9:130480177-130480199 ACTGAGGCCCAGAGAGAGCAGGG - Intronic
1061680306 9:132239759-132239781 GCTGAGGCCCAGGAACGGGAAGG - Intronic
1062497003 9:136836632-136836654 TCTCAGGCCCAGGAAATGCCAGG - Intronic
1203520740 Un_GL000213v1:43108-43130 TCTGAGGCAGAGGAGAGGCAAGG - Intergenic
1203546225 Un_KI270743v1:130393-130415 TCAGAGGCTCAGGAACAGAAGGG - Intergenic
1203657172 Un_KI270753v1:9026-9048 GGTGATGCCCAGAAAAAGCATGG + Intergenic
1185521307 X:741869-741891 TCTGAGACCCAGGAGAGCCAAGG - Intergenic
1185521424 X:742771-742793 CCTGAGACCCAGGAAAGCCAAGG - Intergenic
1185521484 X:743222-743244 CCTGAGACCCAGGAAAGCCAAGG - Intergenic
1185521546 X:743673-743695 CCTGAGACCCAGGAAAGCCAAGG - Intergenic
1185971000 X:4663536-4663558 TGTGAGACCAATGAAAAGCATGG + Intergenic
1185975951 X:4720164-4720186 TCTCAGGATCAGGAAAAGAAAGG - Intergenic
1186182339 X:6985542-6985564 TTTAAGGCCCAGGAAAGGCCTGG + Intergenic
1187788393 X:22919788-22919810 CTTCAGGCCCAGGAAGAGCATGG + Intergenic
1188434904 X:30148692-30148714 TCTGAAGCCCATGAAAACCCTGG + Intergenic
1189490992 X:41471739-41471761 TTTAAGGCCCAGGAAAGGCTTGG + Intronic
1190232830 X:48595547-48595569 TCTGAAGCCCAGGGAATTCAAGG - Intronic
1190360536 X:49644838-49644860 TCTGAGGCCCATGAGAACCCTGG - Intergenic
1190477468 X:50842138-50842160 CCTGGGGCCCAGGCAAAGCAAGG + Intergenic
1190585503 X:51936100-51936122 TCTAGGGCTGAGGAAAAGCAAGG - Intergenic
1190731087 X:53225800-53225822 TCTGAGTCCCAAGTAAAGGAAGG + Intergenic
1190760922 X:53437659-53437681 TCTGAGACCCAAGGAAAGGATGG - Intergenic
1191650883 X:63536851-63536873 ACAGAGACCAAGGAAAAGCAGGG + Intergenic
1191908707 X:66124378-66124400 TCTGAGACACAGCTAAAGCAGGG - Intergenic
1192144620 X:68673345-68673367 TAAGAAGCCCAGCAAAAGCAGGG + Intronic
1192213768 X:69143757-69143779 TCTGAGGCCCAGGGAGGGGAAGG + Intergenic
1193554156 X:82932673-82932695 ACTGAGGCCCATGAAAATCCTGG + Intergenic
1193625725 X:83818389-83818411 TCTGAGACACAGCTAAAGCAGGG - Intergenic
1193895478 X:87110093-87110115 ACAGAGACCGAGGAAAAGCAGGG + Intergenic
1195655046 X:107325026-107325048 TCTGAGGCCCATGAAAGCCCTGG + Intergenic
1195701924 X:107712159-107712181 TTTGTGGCTCAGGAAAATCAAGG + Intergenic
1196273834 X:113743102-113743124 TCTGAGGCCCAAGAGAGGGAGGG - Intergenic
1197064338 X:122220773-122220795 TCAGGGGCCCAGGACCAGCATGG + Intergenic
1197270882 X:124423680-124423702 TCTGGGTACTAGGAAAAGCATGG + Intronic
1197704249 X:129622660-129622682 TTTTAGGCCTAGGGAAAGCAGGG - Intergenic
1197848138 X:130826419-130826441 TCTGAGGCACAGAAAATGAATGG - Intronic