ID: 1133603208

View in Genome Browser
Species Human (GRCh38)
Location 16:7360304-7360326
Sequence GTTTTCAGTTGACCACAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133603208_1133603210 6 Left 1133603208 16:7360304-7360326 CCAAACTGTGGTCAACTGAAAAC 0: 1
1: 1
2: 0
3: 10
4: 137
Right 1133603210 16:7360333-7360355 TCTGAGAAGATCAGAAATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 299
1133603208_1133603211 26 Left 1133603208 16:7360304-7360326 CCAAACTGTGGTCAACTGAAAAC 0: 1
1: 1
2: 0
3: 10
4: 137
Right 1133603211 16:7360353-7360375 TGGCTCTGCTGCTTCATATGTGG 0: 1
1: 0
2: 1
3: 26
4: 188
1133603208_1133603209 3 Left 1133603208 16:7360304-7360326 CCAAACTGTGGTCAACTGAAAAC 0: 1
1: 1
2: 0
3: 10
4: 137
Right 1133603209 16:7360330-7360352 GACTCTGAGAAGATCAGAAATGG 0: 1
1: 1
2: 3
3: 33
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133603208 Original CRISPR GTTTTCAGTTGACCACAGTT TGG (reversed) Intronic
901559747 1:10060651-10060673 ATTTTCTGATGACCACACTTAGG - Intronic
904249351 1:29211908-29211930 GTTCTTAGTTGGCCACAGCTTGG - Intronic
908084512 1:60616536-60616558 TTTTTCATTTTACCACAGTCAGG - Intergenic
908227880 1:62074407-62074429 GTTTTCAGTTGAACTGAATTTGG - Intronic
911950781 1:104171822-104171844 GATTATAGTTGACTACAGTTAGG + Intergenic
913713806 1:121513444-121513466 GTTGTTAGTTGACCTCATTTAGG - Intergenic
916773807 1:167938325-167938347 GTTTTCACTTCTCCACATTTTGG + Intronic
916801909 1:168223756-168223778 TTTTTCAGTTTACCACACTGTGG + Intergenic
917950520 1:180028311-180028333 GAATTCAGCTGAACACAGTTTGG + Intronic
922206671 1:223454226-223454248 GTGTTCCGTGGAACACAGTTTGG + Intergenic
1064588870 10:16867689-16867711 GTTTTCCTCTGGCCACAGTTAGG - Intronic
1065602473 10:27383715-27383737 GTTTTCATTTCTCCCCAGTTTGG + Intergenic
1065885008 10:30069102-30069124 TTTTTCCGTTGACCACAGCCTGG + Intronic
1066350139 10:34629985-34630007 GTGTTTCGCTGACCACAGTTGGG - Intronic
1068868708 10:61921324-61921346 GCTTTCAGATGGCCACAGCTGGG - Intronic
1073517412 10:104088988-104089010 GTTTTCAGTTAACAGCAGTATGG + Intergenic
1078716619 11:13846057-13846079 TTTTTCACTTGAACACAGCTCGG - Intergenic
1079110184 11:17601029-17601051 GTTTCCAGTTGACCCCTGGTGGG + Intronic
1080844184 11:36012177-36012199 GGTTTCAGTTGACAGCAATTTGG - Intronic
1083805280 11:65069920-65069942 GTTTGCAGCTGACCACAGTGCGG + Intronic
1084314336 11:68335854-68335876 GGCCTCAGTTGACCTCAGTTTGG + Intronic
1084491422 11:69480694-69480716 GTGTTCAGGTCACCACAGTGAGG + Intergenic
1085252577 11:75153307-75153329 GCTTACATTTGAACACAGTTGGG - Intronic
1087388749 11:97507839-97507861 GTTTTCTGTTGACTAAATTTGGG - Intergenic
1091573220 12:1709805-1709827 GTTTTCATTTGAATACATTTTGG + Intronic
1093316170 12:17653101-17653123 TTTTTCAGTCGACAACAGCTGGG + Intergenic
1100226169 12:92558128-92558150 GGTTTCAGTTCACCTTAGTTTGG - Intergenic
1101014423 12:100484815-100484837 GTTCCCCATTGACCACAGTTAGG + Intronic
1101893424 12:108735364-108735386 GCTCTCAGCTGACCACATTTGGG - Intergenic
1102144430 12:110644236-110644258 ATCTTCAGTGGAACACAGTTTGG + Intronic
1108167148 13:47705319-47705341 TTTTTCAGCTGACCACACGTGGG + Intergenic
1108324269 13:49314464-49314486 GTGTACAGTTGACCAGAATTAGG - Intronic
1108849190 13:54706969-54706991 GTTGTTAGTTGACCTCATTTGGG - Intergenic
1110308343 13:74016846-74016868 GTTTCCAGTTTACAGCAGTTGGG - Intronic
1111228415 13:85307358-85307380 ATTATTAGTTGACTACAGTTAGG + Intergenic
1111529109 13:89513516-89513538 GTTTTCAGTTGAAGCCAATTTGG + Intergenic
1115302636 14:31901641-31901663 GAATTCAGGTGGCCACAGTTTGG + Intergenic
1116774460 14:49164368-49164390 GTTTTCAGAAGATGACAGTTTGG - Intergenic
1117546201 14:56796515-56796537 GTTTGCAGTTGACAGCAGGTTGG + Intergenic
1118823810 14:69362625-69362647 TTTTTCAGTTGAGAACAGTGAGG - Intergenic
1120714133 14:87822112-87822134 GTTTTCTGTTGGCCACATCTAGG + Intergenic
1121228216 14:92337183-92337205 GTTCTCAGTAATCCACAGTTGGG + Intronic
1122346291 14:101062723-101062745 GTGTTCAGTTGACTACAAATTGG + Intergenic
1126429139 15:48562054-48562076 GTTGTCAGTAGATCACATTTTGG + Intronic
1126729135 15:51663933-51663955 GTTGTCTGTTGACCTCTGTTGGG + Intergenic
1128535576 15:68487408-68487430 GGTTTCAGTTGACCTCAGAATGG + Intergenic
1133444809 16:5850990-5851012 GTTTCCAGGTGGCCACAGCTCGG - Intergenic
1133603208 16:7360304-7360326 GTTTTCAGTTGACCACAGTTTGG - Intronic
1134265235 16:12686765-12686787 GTTTTCAGTTGCCAACATTTTGG - Intronic
1139585584 16:67900999-67901021 ATTTTCACCTGACCACAGTGTGG + Intronic
1139947191 16:70649490-70649512 GTTTTCACTAGTCCTCAGTTTGG + Intronic
1140735561 16:77894952-77894974 GTTTTCAGATGAGCAAAATTGGG + Intronic
1142354225 16:89594553-89594575 GTTTCCCGTTGTCCACAGTTTGG + Intronic
1147415181 17:40283844-40283866 GATGTCAGCTGACCACAGTAAGG - Exonic
1148345176 17:46898308-46898330 GATTTCAGTTGTTAACAGTTTGG - Intergenic
1149081609 17:52665213-52665235 GTTTCTAGATGACCACAGGTGGG - Intergenic
1150988538 17:70227798-70227820 ATTTTCAGTATTCCACAGTTTGG + Intergenic
1153364429 18:4238296-4238318 GTTTTCAGTAGAAAATAGTTTGG - Intronic
1157073625 18:44439560-44439582 TTATCCAGTTGACCACTGTTTGG + Intergenic
1158106571 18:53891378-53891400 CTTTGCAGCTGACCACAGCTAGG - Intergenic
1158233947 18:55291554-55291576 GTTTTCAGTTGAAAGTAGTTAGG - Intronic
1158282023 18:55838722-55838744 CTTTCCAGTTGCCCACTGTTTGG - Intergenic
926492483 2:13541957-13541979 ATTTTCAGTTCAGCACAGTATGG + Intergenic
927176393 2:20411813-20411835 GTTTTCAGCTGACCCCAGCTGGG + Intergenic
927812908 2:26190060-26190082 GTTTTCAGATGACCAGAGTAGGG - Intergenic
929982014 2:46690053-46690075 GTTATCAGTTTATTACAGTTTGG + Intergenic
931186388 2:59955793-59955815 GTTATCATCTGACCCCAGTTAGG + Intergenic
935400883 2:102658893-102658915 GTTTTCTGTTAGCCACAGCTCGG + Intronic
939211474 2:139180759-139180781 GTTTTCAATTCACCACAAATGGG + Intergenic
940898391 2:159103441-159103463 ATTGTCAGTAGTCCACAGTTAGG - Intronic
941901594 2:170684116-170684138 GTTTTCAGGTCAACAAAGTTAGG + Intergenic
942259951 2:174149611-174149633 GTTTTGAGTGGACCTCAGTAAGG - Intronic
942306852 2:174617064-174617086 GTTTTCAGTTCAGAACATTTAGG + Intronic
948952932 2:241266480-241266502 GATTTTAGTTTACCACAATTAGG + Intronic
1170830747 20:19838684-19838706 GTTTAGATTTCACCACAGTTGGG - Intergenic
1170901409 20:20466745-20466767 GATTTCGGTTGGCCACAGATTGG - Intronic
1172671747 20:36639276-36639298 GTCCTGAGTTGACCACAGTCTGG - Intronic
1173300168 20:41795368-41795390 GTTTTCAGTTGCACACAGGACGG - Intergenic
1173689040 20:44945045-44945067 GTTCTGAGTGGATCACAGTTTGG - Intronic
1177997283 21:28116944-28116966 GATTTCATTTGTTCACAGTTGGG + Intergenic
1178762336 21:35415089-35415111 GATTCCAGTTGTCCACAATTTGG - Intronic
1179447626 21:41444063-41444085 CTTTTCAGGGGACCACAGTCAGG + Intronic
1184298223 22:43539724-43539746 TTTTCCAGTTGAACACAGTGAGG - Intronic
949132742 3:525066-525088 TCTTTCACTTTACCACAGTTCGG + Intergenic
952529336 3:34247443-34247465 GTTTTCAGTTGATCTTTGTTGGG - Intergenic
954492162 3:50916386-50916408 GTTTCCAGCTGAGCCCAGTTGGG + Intronic
955499245 3:59567909-59567931 GTGTTGACTTGAACACAGTTTGG + Intergenic
958042770 3:88245968-88245990 GTTTCCAGATGCCCACAATTTGG + Intergenic
961922320 3:130440520-130440542 ATTTTCAGTGGTCCACAGTAGGG - Exonic
964599710 3:158484770-158484792 GTTTAAAGTTCACCACAATTAGG - Intronic
965075715 3:163972861-163972883 GTTTTCACTTGACTAATGTTGGG + Intergenic
966183812 3:177210591-177210613 GCTTTCTGTGGAACACAGTTTGG + Intergenic
966629657 3:182058422-182058444 GCTTTCAGATGACCACACCTTGG - Intergenic
967954395 3:194867292-194867314 GTGTTCAGTTGTTCAAAGTTGGG + Intergenic
969157725 4:5226458-5226480 GTTTTAAATTGCCCACCGTTCGG + Intronic
971164052 4:24163983-24164005 TTGTTCATTTGACCACAGGTTGG + Intergenic
972265716 4:37457315-37457337 GTTTTCAGTTGACCACAACATGG + Intronic
975094506 4:70442451-70442473 GTTTTCACATGACCACTGTTGGG - Intronic
975669763 4:76769188-76769210 GTTTCCAGTTGAAGCCAGTTTGG + Intronic
976032932 4:80779521-80779543 TTCTTCATTTCACCACAGTTAGG + Intronic
976201540 4:82584409-82584431 GTTTTGGGATGACCACAGTGTGG - Intergenic
976502039 4:85802385-85802407 GCTTTCAGTGCAGCACAGTTAGG - Intronic
978035095 4:103983412-103983434 GTTTTCAAGTGACCATAGTGGGG - Intergenic
981800793 4:148653271-148653293 GTTGTCAGTTGACCATGGCTTGG - Intergenic
982254770 4:153441088-153441110 GTTTTCAGTTCCTCAGAGTTGGG + Intergenic
982848226 4:160277276-160277298 GGTATCTGTTGACCCCAGTTGGG - Intergenic
985627391 5:996455-996477 TTTTTCAGTTTGCTACAGTTTGG + Intergenic
986327588 5:6688068-6688090 TTTTTCAGTTGACCACAGTTGGG - Intergenic
987181207 5:15370344-15370366 GTTTTAAGTTGATCACAGCCAGG + Intergenic
990419474 5:55617390-55617412 GTTTTGAGTTGAGCTCATTTGGG - Intergenic
995223605 5:109678691-109678713 GTTTTCAGTCTTCCACAGTTTGG - Intergenic
999670599 5:153956129-153956151 ATTTTCAGTAGACCACAGGAGGG + Intergenic
1004033727 6:11900793-11900815 GGTTAGAGTTGACCAGAGTTGGG + Intergenic
1005983598 6:30856241-30856263 GTTTCCTGTGGACCACAGGTGGG - Intergenic
1006395927 6:33787953-33787975 GATTTCAGTGGCCCACAGATAGG - Intronic
1006840222 6:37023646-37023668 GATTGCAGTTGAACACATTTTGG - Intronic
1013858019 6:114598190-114598212 GACTTCAGTTGACCACTGTAAGG + Intergenic
1013988965 6:116230765-116230787 GCTTTCACTTGGCTACAGTTGGG + Intronic
1014259539 6:119200303-119200325 GTGATCTGTTGACCACACTTAGG + Intronic
1014829745 6:126088872-126088894 GGTTTCAGATGAAAACAGTTTGG - Intergenic
1016221922 6:141683941-141683963 GTTTTCATTTCACTATAGTTTGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1021277338 7:18669185-18669207 TTTTTAAGTTGAGCAAAGTTAGG - Intronic
1022261530 7:28709889-28709911 ATGTTTAGTTGACCACAGTGTGG + Intronic
1023189240 7:37561636-37561658 GTTTTCAGCTGTCCACAGCCAGG - Intergenic
1024425687 7:49224172-49224194 GGTTTCAGCTGACCACTGTGAGG + Intergenic
1032729580 7:134625647-134625669 GTTTTCAGTTCACCACTGTCTGG - Intergenic
1037040043 8:14220191-14220213 GTTTTCAGTTCAGTTCAGTTGGG - Intronic
1037236705 8:16728676-16728698 GTTTTCACTTGAACAGTGTTCGG - Intergenic
1038525792 8:28272102-28272124 GTTTTCAGTTGATTATGGTTTGG - Intergenic
1042724824 8:71862211-71862233 GTCTCCAGGTGACCCCAGTTGGG - Intronic
1044004657 8:86926374-86926396 GTTTTGAGTTGAGCTCATTTGGG + Intronic
1046441572 8:114262075-114262097 GTTTCAAGTTGACCACAATGAGG + Intergenic
1047216228 8:122878335-122878357 GGGTTCAGTTGATCTCAGTTTGG + Intronic
1048119140 8:131560112-131560134 GTTTTCAGTTTTCCCCAATTCGG - Intergenic
1049877592 8:145035678-145035700 GTTTTGAGTTGAACTCATTTGGG - Intergenic
1052607138 9:30719376-30719398 ATTTTAAGTTGAGCACAGTATGG + Intergenic
1057275974 9:93676111-93676133 TTTTTGAGTTGTCCTCAGTTGGG + Intronic
1057524028 9:95783930-95783952 GTGTTCCGTGGAGCACAGTTTGG + Intergenic
1058161820 9:101578524-101578546 GGTTTCACTTGACCACAGCAAGG - Intronic
1061737801 9:132674221-132674243 GTTTCCAGTTGACCACTATTAGG - Intronic
1187995847 X:24925658-24925680 ATTTTCTGTTGATTACAGTTTGG - Intronic
1189130229 X:38490741-38490763 GTTTTCAGGTGAGTTCAGTTTGG - Intronic
1194698559 X:97085889-97085911 GTTTTCAGTTGATCAGAAGTAGG + Intronic
1195757853 X:108216938-108216960 GTTTTCAGTTCAAGGCAGTTGGG - Intronic
1198430934 X:136565448-136565470 GTTGTCAGTTGACTTCAGTCTGG + Intergenic
1198775116 X:140171556-140171578 GTTTTCTGTAGAAAACAGTTTGG - Intergenic
1200879044 Y:8193250-8193272 TTTTTCAGATGAACACATTTGGG + Intergenic
1201322722 Y:12717881-12717903 CTTTTCAGTAGACCATAGTGGGG + Intronic