ID: 1133608754

View in Genome Browser
Species Human (GRCh38)
Location 16:7413477-7413499
Sequence TGAGGTCAACACTACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133608750_1133608754 10 Left 1133608750 16:7413444-7413466 CCAGAAACTTTGCATTTCTCACA 0: 1
1: 2
2: 51
3: 405
4: 1603
Right 1133608754 16:7413477-7413499 TGAGGTCAACACTACCAGCCTGG 0: 1
1: 0
2: 2
3: 16
4: 178
1133608749_1133608754 11 Left 1133608749 16:7413443-7413465 CCCAGAAACTTTGCATTTCTCAC 0: 1
1: 0
2: 7
3: 55
4: 514
Right 1133608754 16:7413477-7413499 TGAGGTCAACACTACCAGCCTGG 0: 1
1: 0
2: 2
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133608754 Original CRISPR TGAGGTCAACACTACCAGCC TGG Intronic
900573964 1:3373903-3373925 TCTGGTCAACACCAGCAGCCAGG - Intronic
900986300 1:6074743-6074765 TGAGGTCAGGAGTTCCAGCCTGG + Intronic
901483481 1:9541504-9541526 TGAGGTCAGGAGTGCCAGCCTGG - Intronic
902142950 1:14371660-14371682 TGAGGTGAACAGAACCAGACAGG - Intergenic
902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG + Intronic
902835221 1:19043053-19043075 CCAGGTCCACACTGCCAGCCTGG + Intergenic
905140292 1:35838260-35838282 GGAGCTCAAGACCACCAGCCTGG - Intronic
907414619 1:54305670-54305692 TGAGCTCAGAAGTACCAGCCTGG - Intronic
908437303 1:64119422-64119444 TGAGGTCAGCAGTTCCAGACTGG + Intronic
908538828 1:65103615-65103637 TGAGGACATGTCTACCAGCCTGG - Intergenic
909787035 1:79626602-79626624 TGAGGTCAAGACTCCCACACAGG - Intergenic
910437367 1:87218921-87218943 TGATGTCAATACTACCACCCTGG - Intergenic
921187430 1:212682752-212682774 TGTGGTCAACACCACCACCACGG - Intergenic
922489465 1:226004195-226004217 TGAGGTCAAGAGTTCAAGCCTGG + Intergenic
1064298872 10:14104154-14104176 TGAGGTCTACACTGCCATCAAGG + Intronic
1066061989 10:31732308-31732330 TGAGGTCATCACAAGAAGCCAGG - Intergenic
1068313338 10:55308263-55308285 TGAGCTCACCACTACCAGACAGG + Intronic
1072233375 10:93431953-93431975 AGAGTTCAAGACCACCAGCCTGG - Intronic
1072703610 10:97663609-97663631 TGAGGTCAGGAGTTCCAGCCTGG + Intronic
1072966563 10:99978779-99978801 GGAGTTCAAGACCACCAGCCTGG - Intronic
1074455492 10:113592250-113592272 TGAAGTCATAACTGCCAGCCCGG + Exonic
1075741912 10:124701178-124701200 TGAGCTCAACAGCCCCAGCCAGG - Intronic
1081107608 11:39090393-39090415 TGAGATCAATAATAACAGCCTGG - Intergenic
1082018854 11:47514137-47514159 TGAGGTCAGGAGTTCCAGCCTGG - Intronic
1083278841 11:61613046-61613068 GGAGTTCAAGACCACCAGCCTGG - Intergenic
1085618110 11:78017216-78017238 TGAGTTCCACACCACCACCCTGG - Exonic
1086431412 11:86740266-86740288 TGAGGTTAACACAGCCAGTCAGG - Intergenic
1087028846 11:93681759-93681781 TGAGGTCAGGAGTTCCAGCCTGG - Intronic
1088207308 11:107407935-107407957 ACAGGTCAACACTCCCAGCTAGG + Intronic
1089379781 11:118020054-118020076 GGAGTTCAAGACGACCAGCCTGG + Intergenic
1089416643 11:118297629-118297651 TAAGGTCAAAACTGCCAGTCAGG + Intergenic
1089617826 11:119704981-119705003 TGAGGTCAGGACTATCACCCTGG - Intronic
1091654843 12:2338009-2338031 TTAAGTCCACACTTCCAGCCTGG + Intronic
1094554751 12:31487489-31487511 GGAGTTCAAGACCACCAGCCTGG + Intronic
1096162749 12:49393886-49393908 GGAGTTCAACACCACCAGCCTGG - Intronic
1096670585 12:53196152-53196174 TGAAGTGAACACCAGCAGCCGGG + Exonic
1097868383 12:64578928-64578950 TGAGGTCAGGAGTTCCAGCCTGG + Intergenic
1099605067 12:84794265-84794287 TGAGCTGAACACTACTAGCTCGG + Intergenic
1103546446 12:121705114-121705136 TGAGGTCAGAAAGACCAGCCTGG - Intergenic
1104921840 12:132294658-132294680 TGGGGTCAGGACTTCCAGCCAGG + Intronic
1107286729 13:38802100-38802122 TGAAGACAAGTCTACCAGCCTGG - Intronic
1114500681 14:23166106-23166128 AGAGGTCAAAACTACAAACCTGG + Intronic
1115232973 14:31181471-31181493 ACAGGTGCACACTACCAGCCTGG - Intronic
1116135940 14:40923719-40923741 TGAGGTCAGGAGTTCCAGCCTGG - Intergenic
1116837207 14:49781156-49781178 TGAGGTCAGGAGTTCCAGCCTGG + Intronic
1117537324 14:56714486-56714508 TTAGGTCAACAATGGCAGCCGGG + Intronic
1120421549 14:84292487-84292509 GGAGTTCAAGACGACCAGCCTGG - Intergenic
1123467368 15:20526942-20526964 TGAAGTCAAAACTACCACTCAGG + Intergenic
1123650746 15:22474100-22474122 TGAAGTCAAAACTACCACTCAGG - Intergenic
1123741155 15:23282942-23282964 TGAAGTCAAAACTACCACTCAGG - Intergenic
1123745843 15:23319616-23319638 TGAAGTCAAAACTACCACTCAGG + Intergenic
1124116776 15:26851014-26851036 GGAGTTCAAGACGACCAGCCTGG - Intronic
1124278114 15:28342933-28342955 TGAAGTCAAAACTACCACTCAGG + Intergenic
1124304587 15:28568675-28568697 TGAAGTCAAAACTACCACTCAGG - Intergenic
1124533479 15:30525135-30525157 TGAAGTCAAAACTACCACTCAGG - Intergenic
1124765179 15:32482510-32482532 TGAAGTCAAAACTACCACTCAGG + Intergenic
1130870770 15:87970211-87970233 TGATGTCACCTCCACCAGCCTGG + Intronic
1133608754 16:7413477-7413499 TGAGGTCAACACTACCAGCCTGG + Intronic
1134184910 16:12077065-12077087 GGAGTTCAACACCACCAGTCTGG + Intronic
1135142785 16:19935945-19935967 TGAGGTCCAGACAACCAGCTGGG - Intergenic
1135742169 16:24985332-24985354 TGAGTTCAGCACTTCCAACCAGG + Intronic
1135885907 16:26307553-26307575 TGATGTCAACACTGCCAGTTGGG - Intergenic
1140468057 16:75197865-75197887 AGAGGTCCTCACTGCCAGCCTGG + Intergenic
1141984943 16:87573643-87573665 TGGGTTGAACACTACCAGCTGGG + Intergenic
1143127194 17:4650266-4650288 AGAGTTCAAGACCACCAGCCTGG - Intergenic
1143965047 17:10751050-10751072 GGAGTTCAAGACCACCAGCCTGG + Intergenic
1146072080 17:29691841-29691863 TGAAGTCAAGACTTTCAGCCGGG + Intronic
1146994068 17:37302508-37302530 TGAGGTCAAGAGTTCCAGACCGG - Intronic
1149007660 17:51822207-51822229 TGAGGTCACCACAACTAGCCTGG + Intronic
1150510706 17:65749558-65749580 TAACCTTAACACTACCAGCCTGG - Intronic
1151994380 17:77599357-77599379 TGAGGTTTACGCCACCAGCCTGG + Intergenic
1153309793 18:3666981-3667003 TGAGGTCAGGAGTACCAGCCTGG - Intronic
1157535681 18:48455731-48455753 TGAGGTCAATGCTGGCAGCCTGG - Intergenic
1158038691 18:53066999-53067021 TCAGGAGAACACTACCAGCAGGG + Intronic
1159851463 18:73531073-73531095 TGGGCTCAACCCTACCAGCTGGG + Intergenic
1160796912 19:949883-949905 TGAGGTCAGGAGTCCCAGCCTGG - Intronic
1161690529 19:5730706-5730728 GGAGTTCAATACCACCAGCCTGG + Intronic
1161909661 19:7183760-7183782 TGAGGTCCACAATGCCAGACTGG + Intronic
1162121571 19:8472794-8472816 TGAGGTCAGGAGTTCCAGCCCGG - Intronic
1162820950 19:13223401-13223423 TGAGGTCAGGATGACCAGCCTGG - Intronic
1163004060 19:14386480-14386502 GGAGATCAAGACTACCATCCTGG + Intronic
1163798530 19:19350992-19351014 GGAGTTCAAGACCACCAGCCTGG + Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1167671913 19:50858447-50858469 TGGGGTCAAGACTACGGGCCAGG - Exonic
1168001923 19:53453659-53453681 TGAGGTCAAAAGTACGAGGCTGG + Intronic
927070064 2:19518760-19518782 TGAGGTGAATGCTACAAGCCAGG - Intergenic
927342468 2:21997836-21997858 TGAGGACACCACCACCAGCGAGG - Intergenic
927997046 2:27494080-27494102 GGAGGTGAACACCACCACCCGGG - Exonic
929130555 2:38565497-38565519 GGAGTTCAAGACCACCAGCCTGG + Intronic
929792537 2:45034261-45034283 TGAGGTCCCCAATGCCAGCCAGG + Intergenic
930761856 2:55047118-55047140 GGAGTTCAAGACCACCAGCCTGG + Intronic
932939988 2:76152673-76152695 TAAGGGTAACACTGCCAGCCAGG + Intergenic
933884479 2:86705359-86705381 GGAGATCAAGACCACCAGCCTGG - Intronic
935502131 2:103854755-103854777 TGAGGTCAGGAGTTCCAGCCTGG - Intergenic
939638564 2:144612010-144612032 TGAGGTCAGGAGTTCCAGCCTGG - Intergenic
940275124 2:151932048-151932070 TAAAGTCAACATTAACAGCCTGG - Intronic
940309012 2:152257454-152257476 TGAGGTTAGCTCTACCACCCAGG + Intergenic
943180643 2:184536348-184536370 TTCCGTCAACACTACAAGCCAGG - Intergenic
945294771 2:208159796-208159818 GGAGATCAACACTACCAGCCTGG - Intergenic
945756338 2:213851684-213851706 TGGGATTAGCACTACCAGCCAGG + Intronic
946142277 2:217701807-217701829 TGGGGTCTACACTGCCAGCTAGG - Intronic
948456561 2:238107197-238107219 TGTGGTCCACAGCACCAGCCAGG - Intronic
1172141600 20:32726179-32726201 GGAGTTCAAGACCACCAGCCTGG + Intronic
1172463491 20:35137665-35137687 TGAGGTCAACTCATCCATCCGGG + Intronic
1172674943 20:36662425-36662447 TGAGGTCAGGAGTTCCAGCCTGG - Intronic
1172710647 20:36920550-36920572 TGAGGTCAACAGTACAAGTTTGG + Intronic
1173367169 20:42396769-42396791 TGAGGTCAGGAGTTCCAGCCTGG - Intronic
1173461867 20:43249324-43249346 TGGGGTCCTCACTGCCAGCCAGG + Intergenic
1174237461 20:49105565-49105587 GGAGTTCAAGACCACCAGCCTGG - Intergenic
1179480849 21:41677700-41677722 TGAGCCCAAGAATACCAGCCTGG + Intergenic
1182607568 22:31518194-31518216 GGAGTTCAAGACCACCAGCCTGG - Intronic
1183058255 22:35319997-35320019 TGGGGTCAGCACTGACAGCCAGG + Intronic
1183731637 22:39621783-39621805 GGAGTTCAGCTCTACCAGCCTGG + Intronic
1183914910 22:41110021-41110043 TGAGGTCAAGAGTTCGAGCCTGG - Intronic
950228766 3:11257857-11257879 TGAGGCCAAGACTTGCAGCCTGG - Intronic
950653965 3:14425240-14425262 TGAGGTCACCACTTGCAGCTGGG + Intronic
950785252 3:15428494-15428516 TGAGGTCACCTATACCACCCGGG + Intronic
953565065 3:44025250-44025272 GGAGGTCCACTCTACCAGCGTGG - Intergenic
953952966 3:47206571-47206593 TGAGGGCAGGACTACTAGCCTGG + Intergenic
954396779 3:50297229-50297251 TGAGGTCAGCACAAGCATCCAGG + Exonic
955488637 3:59460487-59460509 TGGGTTCAAACCTACCAGCCTGG - Intergenic
957709879 3:83842253-83842275 TGAGGTCAGGAGGACCAGCCTGG - Intergenic
959059884 3:101606477-101606499 TGAGGTGATCAAGACCAGCCTGG - Intergenic
959830721 3:110858556-110858578 TGAAGCCCACACTACCAGCCAGG + Intergenic
960893660 3:122478510-122478532 GGAGTTCAAGACCACCAGCCTGG + Intronic
966822068 3:183932956-183932978 GGAGTTCAAGACCACCAGCCTGG + Intronic
967997387 3:195177013-195177035 TCACATCAGCACTACCAGCCAGG + Intronic
968113545 3:196070465-196070487 TAAGGTCAGAGCTACCAGCCTGG - Intronic
968177123 3:196560449-196560471 TGAGGTCATCAAGACCAGCCTGG - Intronic
969369741 4:6724093-6724115 TGATGTCAACACTGACACCCAGG + Intergenic
969428366 4:7138898-7138920 TGTACTCATCACTACCAGCCTGG + Intergenic
970107746 4:12603973-12603995 GGAGGTCAGCACTACCTCCCTGG - Intergenic
971364779 4:25968916-25968938 TGAGGTCAGGAGTATCAGCCTGG + Intergenic
972688291 4:41372026-41372048 AGAGGTGAACACAACCAGCCAGG + Intronic
976071198 4:81241682-81241704 TGATGCCATCACAACCAGCCAGG + Intergenic
978515100 4:109560627-109560649 TGAGGTCAAGACTCCGGGCCCGG + Intronic
978866576 4:113520194-113520216 TCAGGTGATCACGACCAGCCTGG + Intronic
986597352 5:9437564-9437586 TGAGGTCAGGAGTTCCAGCCTGG - Intronic
988292081 5:29300338-29300360 TGAGGACAACACTACCGGGATGG + Intergenic
988531937 5:32035540-32035562 GGAGGTCAACATCAGCAGCCTGG - Intronic
991189349 5:63851276-63851298 TCTGGTCAACACTGCAAGCCAGG + Intergenic
991352186 5:65730764-65730786 TGAGGTCAAGAGTTCCAGCCTGG - Intronic
991583869 5:68183151-68183173 TGAGGTCAGCAGTTCCAGCCTGG - Intergenic
994366345 5:98921941-98921963 GGAGTTCAAGACCACCAGCCTGG + Intronic
998905963 5:146905448-146905470 GGAGTTCAAGACCACCAGCCTGG - Intronic
1001597230 5:172906148-172906170 TGGGGCCAACACTACAAGCAAGG + Intronic
1002486182 5:179538746-179538768 TGAGGCCAAGAGTTCCAGCCTGG + Intergenic
1005772469 6:29088058-29088080 TGAGGTCAAGACTAACACCTAGG + Intergenic
1006354349 6:33545728-33545750 TGATGTGAACCCTACCATCCAGG - Intergenic
1006741059 6:36309298-36309320 TGGGATCAACAATCCCAGCCTGG + Intergenic
1007309684 6:40935391-40935413 TGAGGTGCTCACTGCCAGCCTGG - Intergenic
1007544757 6:42685097-42685119 TGAGGTCAGGAGTTCCAGCCTGG + Intronic
1007647991 6:43397533-43397555 ACAGGTCACCACTTCCAGCCTGG + Intergenic
1009772192 6:68158065-68158087 TGAGGTCAAAAAGACCAGCCTGG + Intergenic
1010283176 6:74043520-74043542 TCAGGTCACCACTACTAGCATGG + Intergenic
1010425327 6:75723018-75723040 GGAGTTCAAGACCACCAGCCTGG + Intergenic
1011725943 6:90210943-90210965 TGAAGTCAGGAGTACCAGCCTGG + Intronic
1011818318 6:91220139-91220161 AGAGTTCAAGACCACCAGCCTGG + Intergenic
1012386721 6:98691203-98691225 TGTGGTAAGCTCTACCAGCCTGG + Intergenic
1013516524 6:110891950-110891972 TGAGGTCAAGAGTTCGAGCCTGG - Intronic
1018783971 6:167093710-167093732 TGAGGTCAACACTCACACCACGG - Intergenic
1019857332 7:3622269-3622291 GGAGTTCGACACCACCAGCCTGG + Intronic
1023913368 7:44570629-44570651 TCTGGGCTACACTACCAGCCAGG + Intronic
1024662716 7:51514008-51514030 TGAGGTCAGGAGGACCAGCCTGG + Intergenic
1027051264 7:75022586-75022608 TGAGGTCAGGAGTACCAGCCTGG + Intronic
1028177685 7:87676492-87676514 GGAGTTCAAGACAACCAGCCTGG + Intronic
1029662371 7:101971234-101971256 TGAGCAGAACACAACCAGCCAGG - Intronic
1032631004 7:133651892-133651914 TGAGGTCAGCAAGACCAGCCTGG - Intronic
1033122561 7:138678863-138678885 TGAGGTCAAAAGAAGCAGCCAGG - Intronic
1033349348 7:140549465-140549487 TGAGGTCAGGAGTTCCAGCCTGG - Intronic
1033840762 7:145370866-145370888 TGATGCCAACACTACCTACCAGG + Intergenic
1034869085 7:154667511-154667533 TGAGGTCAGGAGTTCCAGCCTGG + Intronic
1038500580 8:28040358-28040380 TGATATCAACACTACCAGATAGG + Intronic
1040417169 8:47205878-47205900 TGAGGCCAGCACCTCCAGCCTGG + Intergenic
1041067666 8:54098006-54098028 TGAGGTCAAGAGTTCCAGACTGG + Intronic
1041905381 8:63027234-63027256 TGAGGTCAACACTTCCTCCAGGG + Exonic
1044454170 8:92373068-92373090 TTAGGTCTACACTACCTGCCAGG + Intergenic
1045096695 8:98805363-98805385 TGAGGTCAGGAGTTCCAGCCTGG + Intronic
1047402921 8:124561215-124561237 TGAGGTCAGCCTGACCAGCCTGG + Intronic
1047477525 8:125248441-125248463 TGAGGTCAGCAAGATCAGCCTGG + Intronic
1049227335 8:141461854-141461876 GGAGTTCAAGACCACCAGCCTGG + Intergenic
1049754670 8:144304851-144304873 TGAGGTCAGGAGTTCCAGCCTGG - Intronic
1051793089 9:20830882-20830904 GGAGTTCAAGACAACCAGCCTGG - Intronic
1057244222 9:93440664-93440686 TGAGGTCAAGAGTTCGAGCCTGG - Intergenic
1058263023 9:102860160-102860182 TGTGGTCATAATTACCAGCCAGG + Intergenic
1058314462 9:103547364-103547386 TGAGGTCAACAAGACCAGCCAGG - Intergenic
1059229605 9:112706813-112706835 TGAGGCCATCAAGACCAGCCTGG - Intronic
1059487135 9:114635468-114635490 AGAGTTCAACACCAGCAGCCTGG + Intronic
1059734842 9:117090766-117090788 TGAGGTCAGGACTCACAGCCAGG + Intronic
1060997355 9:127882732-127882754 TGAGCTCAGCCCCACCAGCCAGG - Intergenic
1062311634 9:135941108-135941130 TCAGGTCAAAAGTCCCAGCCGGG + Intronic
1185952277 X:4450394-4450416 TGAGGTCAACACTTCCTGGCTGG + Intergenic
1188317107 X:28688414-28688436 GGAGTTCAACACTACTAGCCTGG - Intronic
1190760388 X:53433663-53433685 TGAGGTCACCAACACCGGCCTGG - Intronic
1196825108 X:119734753-119734775 TGAGGCCAAAAGTTCCAGCCTGG - Intergenic
1198010615 X:132549872-132549894 TGCTGTCTACACTACCTGCCTGG + Intergenic
1198499924 X:137233662-137233684 TGAGGTCAACGCCACCAGTGTGG - Intergenic