ID: 1133610729

View in Genome Browser
Species Human (GRCh38)
Location 16:7431047-7431069
Sequence CTGGCTTTCTACTAAGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133610724_1133610729 -10 Left 1133610724 16:7431034-7431056 CCACCCTGGTCCTCTGGCTTTCT 0: 1
1: 1
2: 2
3: 43
4: 564
Right 1133610729 16:7431047-7431069 CTGGCTTTCTACTAAGGCACAGG 0: 1
1: 0
2: 1
3: 10
4: 121
1133610723_1133610729 -9 Left 1133610723 16:7431033-7431055 CCCACCCTGGTCCTCTGGCTTTC 0: 1
1: 0
2: 1
3: 47
4: 362
Right 1133610729 16:7431047-7431069 CTGGCTTTCTACTAAGGCACAGG 0: 1
1: 0
2: 1
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133610729 Original CRISPR CTGGCTTTCTACTAAGGCAC AGG Intronic
900701928 1:4053848-4053870 CTGGCTTCCTAGCCAGGCACAGG + Intergenic
903005695 1:20297032-20297054 CAGGCTCTCTTCTAAGGCACTGG + Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905762934 1:40575524-40575546 CCTGCATTCTCCTAAGGCACTGG - Intergenic
909818299 1:80025352-80025374 CTAGTTTTCTCATAAGGCACTGG - Intergenic
916997683 1:170318288-170318310 ATAGCTTTCTATTTAGGCACAGG + Intergenic
917212776 1:172647022-172647044 CTGGCTTGCAAATAAGGCTCAGG + Intergenic
917370904 1:174292975-174292997 CTGGATTTGTACTTAGGCACAGG + Intronic
922002590 1:221494999-221495021 CTGGGTTTCAACTCAGGGACTGG - Intergenic
922147145 1:222957820-222957842 CTTGCTTTCTACTTAGGACCAGG + Intronic
1063320528 10:5047651-5047673 CTGAATCTCTACTAAGACACTGG + Intronic
1064185948 10:13161805-13161827 CTGGCCGTCTACTAAGGAATCGG + Intronic
1066287488 10:33982342-33982364 CTGCCTTTCTGCAAAGGCAGAGG + Intergenic
1067031541 10:42881083-42881105 CTGTCTGTCTTCTATGGCACAGG - Intergenic
1068652221 10:59535081-59535103 CTGGCCTTCTTCTAAGCCCCGGG + Intergenic
1069682749 10:70296823-70296845 CTGGCTTTCTGTGAAGGGACGGG + Intergenic
1069706640 10:70462826-70462848 GTGGCTTGCTGCCAAGGCACAGG + Intergenic
1072744754 10:97932240-97932262 CTGGCTTTCTTCAGAGCCACAGG + Intronic
1075225820 10:120628238-120628260 CTGTCTTTCCCCAAAGGCACAGG + Intergenic
1075783642 10:125033394-125033416 CTCGCTTGCTACTAAAGCTCAGG - Intronic
1076494717 10:130889421-130889443 CTGTCTTTCTCCTTACGCACAGG - Intergenic
1078146838 11:8727436-8727458 CTGGCTTTCAACTAACTCTCTGG + Intronic
1083031037 11:59592679-59592701 CTGGATTTCTTCTAAGGTATAGG + Intronic
1084629552 11:70338562-70338584 CTCGCTTCCTACTAAGCTACAGG - Intronic
1088560146 11:111106460-111106482 CTGGCTTGCAAGTAAGGCAAAGG + Intergenic
1092448719 12:8582420-8582442 CTGGCTTTATCCTAAGCAACTGG - Intergenic
1093187531 12:16038395-16038417 TTGGCATCCTGCTAAGGCACTGG - Intergenic
1093277299 12:17145978-17146000 CTGACTTTCAGCTATGGCACTGG + Intergenic
1095448193 12:42303062-42303084 CTGCCTTTCTGCAAGGGCACAGG + Intronic
1100668125 12:96777764-96777786 CTACATTTCTGCTAAGGCACTGG + Intronic
1101594586 12:106152886-106152908 CTGGCTTCCTAATAATGCCCAGG - Intergenic
1106501625 13:30334853-30334875 CTGGCTGGCTCCCAAGGCACTGG + Intergenic
1107649087 13:42526223-42526245 CTGGCCTTGTGCTAAGGCAATGG + Intergenic
1108285608 13:48905199-48905221 CTGGATACCTACTAAGGTACTGG + Intergenic
1110931532 13:81224350-81224372 TAGCCTTTGTACTAAGGCACTGG + Intergenic
1112277702 13:98036415-98036437 CTCACCTTCTACTATGGCACAGG - Intergenic
1113684932 13:112276538-112276560 CTGGCTTTATCCTAAGGGAATGG - Intergenic
1119020566 14:71108658-71108680 CTGGCTGGCTACTGAGGCCCGGG - Exonic
1125159080 15:36622780-36622802 CTGGCCTTCTAGTAAGGGGCAGG + Intronic
1129832328 15:78679146-78679168 ATGGACTTCTACTATGGCACTGG - Intronic
1130356298 15:83133846-83133868 ATAGCTTTCTCCTAAGGCATAGG - Exonic
1130621766 15:85470367-85470389 CTGGCGTTTTAAAAAGGCACTGG - Intronic
1132508634 16:325331-325353 CTGGCTTTCTTCACTGGCACAGG + Intronic
1133610729 16:7431047-7431069 CTGGCTTTCTACTAAGGCACAGG + Intronic
1134019636 16:10912595-10912617 CTGGCTTTTTTCTGGGGCACAGG - Intronic
1138821061 16:60260540-60260562 CTGGGCTTCTACTAAGGTCCAGG - Intergenic
1139019467 16:62729319-62729341 GTGGCTTTCTTGTAAAGCACTGG - Intergenic
1141686158 16:85571148-85571170 CTGCCTTTCTAACAAGGCACAGG + Intergenic
1141918157 16:87114910-87114932 CTGGCTTTCTTCAAAGCCACCGG + Intronic
1142259408 16:89035819-89035841 CTGGCTTAGGACTAAGCCACAGG + Intergenic
1149777524 17:59369873-59369895 CTGGGTGTCTACTAAGGGGCAGG + Intronic
1151683687 17:75634825-75634847 CTGACTTTCAACTCAGGCTCAGG + Intronic
1151758113 17:76086268-76086290 CTGGCTGCCTGCTAAGCCACAGG + Intronic
1153992678 18:10414243-10414265 CTGGGTTTCTCCTAAGGCAAGGG + Intergenic
1154138193 18:11799428-11799450 CTAGCTTTCTACAATAGCACAGG + Intronic
1155581681 18:27315472-27315494 CTGACTTTCAAATAAGGCATGGG + Intergenic
1158090885 18:53711840-53711862 CTGGCTTTCTCCACAGGCAGTGG + Intergenic
1163425125 19:17236652-17236674 CTGGCTCTCTCCTATGGAACAGG + Intronic
1164584125 19:29455286-29455308 ATGGCTTTCTCCAAAGCCACAGG - Intergenic
925376862 2:3392398-3392420 CTGGATCTCTACTGAGCCACAGG - Intronic
926071485 2:9896945-9896967 CTGGCTATCTACTTGGGCTCAGG - Intronic
929445505 2:41997768-41997790 CTGGCTGTCTACCCAGGCATTGG + Intergenic
929541087 2:42822790-42822812 CAGGCTTTCTACAAAACCACAGG - Intergenic
932741862 2:74296988-74297010 AAGGCTTTCTATTAAGACACTGG - Intronic
934160015 2:89240622-89240644 CTGGCTTTCTAATGAGGAAGGGG - Intergenic
934207259 2:89941812-89941834 CTGGCTTTCTAATGAGGAAGGGG + Intergenic
934895335 2:98114559-98114581 CTGCCTTCCTAGTAAGGCAGAGG + Intronic
939161940 2:138601277-138601299 CTGGTTTTCTACAGAAGCACTGG + Intergenic
939805018 2:146764618-146764640 TTATCTTTCTACTAAGGCAAAGG - Intergenic
940271871 2:151899818-151899840 CTGCCATTGTACTAAGGTACAGG - Intronic
946091338 2:217226495-217226517 GTTGCTTAGTACTAAGGCACTGG + Intergenic
947129198 2:226904138-226904160 CTGCCTTTCCACAAAGGCAGAGG - Intronic
947432569 2:230043836-230043858 TTGCCTTTCCACGAAGGCACTGG + Intronic
1179525632 21:41974237-41974259 CTGGCTTTCTTCTGTGCCACAGG - Intergenic
1183759044 22:39799088-39799110 CTGGTTTTATACTCAGGCACTGG + Intronic
1185063608 22:48619990-48620012 CTGGCATTTCACTAAGACACAGG - Intronic
950129681 3:10533668-10533690 CTGGCTTTTCATTCAGGCACCGG + Intronic
950297717 3:11846539-11846561 CTGGCTTTCGTCTACGGCTCCGG - Exonic
950667711 3:14507237-14507259 TGGCCTTTCTACCAAGGCACGGG + Intronic
951856814 3:27206305-27206327 CTCACTTTCTAGTAAGGGACAGG + Intronic
952036549 3:29209321-29209343 CTGGCTTTCTTCTGAGGCTTTGG - Intergenic
952244734 3:31574722-31574744 CTGGATTGCTAATAAGGCAAAGG - Intronic
952931292 3:38362921-38362943 CTGTTTTTCTTCTTAGGCACTGG + Exonic
953492427 3:43363048-43363070 CTGGCTGTTTATCAAGGCACTGG + Intronic
954104606 3:48403226-48403248 CTGGCCTTCTGCTAAGGCCGAGG + Intergenic
955443286 3:58980065-58980087 CAGGCTTTCAACTATGGCAGTGG - Intronic
955663692 3:61328082-61328104 CTGCCTTTCTACAAGGGCAGAGG + Intergenic
957434834 3:80161346-80161368 CATGCTGTCTGCTAAGGCACTGG + Intergenic
961786055 3:129347600-129347622 CTGGCTGTCTAGTGCGGCACTGG + Intergenic
964114136 3:153118000-153118022 CTGGCTATCTACAAAGGCTTAGG + Intergenic
971444713 4:26731017-26731039 CTGCTTTTAGACTAAGGCACAGG - Intronic
976923086 4:90461744-90461766 CTGGCACTCTACTAAGTAACAGG + Intronic
979802379 4:124927071-124927093 CTGCCTTTCTGATAAGGCAGAGG - Intergenic
980036291 4:127886099-127886121 CTGGATTTCTACGAAGTAACTGG - Exonic
981434549 4:144704860-144704882 TTGGCTTTCTTCTGAGACACTGG - Intronic
981758604 4:148168820-148168842 CTGGCTATCTGCTAAGGAGCTGG - Intronic
981779987 4:148417950-148417972 CAGGCTTTCCTCTAAAGCACAGG + Intronic
987128720 5:14840746-14840768 CTGGCTTTCTAATGATGCCCAGG + Intronic
987734941 5:21828484-21828506 CTGGTTTTCTTCTGAGACACAGG + Intronic
987791030 5:22568079-22568101 TTGACTTTTTACTAAGGCACTGG + Intronic
990953172 5:61318712-61318734 CAGTGTTTCCACTAAGGCACTGG + Intergenic
992492775 5:77261144-77261166 CTGGCATTTTTCTAAGCCACTGG - Intronic
995755311 5:115497298-115497320 GTGGCTTTCTCCTAGGGCTCAGG - Intergenic
1000647078 5:163772000-163772022 CTAGCTTTCTTCCAAAGCACAGG - Intergenic
1001395350 5:171415539-171415561 CTGGCTTTTCATTAAGGAACTGG - Intergenic
1003077727 6:2998080-2998102 CTTGCTTTCCACTAAGGCTGGGG + Intronic
1003085492 6:3056905-3056927 CTTGCTTTCCACTAAGGCTGGGG - Intergenic
1011614479 6:89185309-89185331 CTGGCTTTCTACAGCAGCACAGG - Exonic
1012756336 6:103236356-103236378 CTGGGTTTCTACTAACTCAATGG + Intergenic
1015254740 6:131165667-131165689 CTGCCATTTTACTAAGCCACTGG + Intronic
1017255636 6:152330121-152330143 CTGGCTTTCTCATAAGCCAAGGG + Exonic
1017908562 6:158773357-158773379 CCGGCTTCCTTCAAAGGCACTGG - Intronic
1027871170 7:83710254-83710276 CAGGTTTTCTACCCAGGCACTGG + Intergenic
1028859474 7:95632543-95632565 CTGGCTTTATAGTGATGCACTGG - Intergenic
1030209168 7:106979648-106979670 TTGGCTTTCTCCTAAAGCAGTGG - Intergenic
1031317594 7:120275185-120275207 CTGGTGTTCTACTATGTCACGGG + Exonic
1032001257 7:128266982-128267004 CTGGCCTTCTGCCCAGGCACGGG + Intergenic
1032673299 7:134106022-134106044 CTGTCTTTGTGATAAGGCACAGG - Intergenic
1039028838 8:33287536-33287558 CAGGCTTTCTACTAAAGGATTGG + Intergenic
1039188631 8:34946504-34946526 CAGGCTTTCATCTCAGGCACAGG - Intergenic
1044966093 8:97575384-97575406 ATGGCCTTCTCCCAAGGCACTGG - Intergenic
1045318441 8:101063241-101063263 CTGGTTTTGTGCTACGGCACAGG + Intergenic
1048224578 8:132572706-132572728 CTGGGTTTCTACTAATGCACAGG + Intronic
1048661868 8:136613346-136613368 CTGCCTATCTGCTAAGGCAAGGG + Intergenic
1048867477 8:138771380-138771402 CTGGCTTTCTAACAGGCCACAGG + Intronic
1054852401 9:69861513-69861535 CTAGCTTTCTGCTAAGGGAGGGG + Intronic
1059123621 9:111663153-111663175 CAGGTTTTCTTCTAAGGCAGAGG + Intronic
1189579800 X:42394131-42394153 CTTGCTTTTGACTAAGGCAGAGG - Intergenic
1190032453 X:46987453-46987475 CTCCCTTTCTACTAAGGCAGTGG - Intronic
1192248550 X:69392361-69392383 CTGGCTTTTTACAAAGGAACAGG + Intergenic
1197739265 X:129876738-129876760 CTGCCTTTCTGCAAAGGCAGAGG - Intergenic
1197969422 X:132099758-132099780 CTGTCATCCTACTAAGGCAGTGG - Intronic
1200765761 Y:7079426-7079448 CTGGCTTTTAACTAGGGCCCTGG + Intronic