ID: 1133611548

View in Genome Browser
Species Human (GRCh38)
Location 16:7438370-7438392
Sequence GGTGAGCATGATGGTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133611543_1133611548 3 Left 1133611543 16:7438344-7438366 CCATGGTTTGGGTCCTCTGGGGC 0: 1
1: 0
2: 4
3: 19
4: 175
Right 1133611548 16:7438370-7438392 GGTGAGCATGATGGTGAGACAGG 0: 1
1: 0
2: 1
3: 29
4: 267
1133611545_1133611548 -10 Left 1133611545 16:7438357-7438379 CCTCTGGGGCCACGGTGAGCATG 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1133611548 16:7438370-7438392 GGTGAGCATGATGGTGAGACAGG 0: 1
1: 0
2: 1
3: 29
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133611548 Original CRISPR GGTGAGCATGATGGTGAGAC AGG Intronic