ID: 1133611865

View in Genome Browser
Species Human (GRCh38)
Location 16:7441116-7441138
Sequence TGCCTTCCTCTATATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133611859_1133611865 17 Left 1133611859 16:7441076-7441098 CCTAAGATATCCTCTTTAAAGAG 0: 1
1: 0
2: 0
3: 23
4: 218
Right 1133611865 16:7441116-7441138 TGCCTTCCTCTATATGAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 131
1133611861_1133611865 7 Left 1133611861 16:7441086-7441108 CCTCTTTAAAGAGAAATGGAACA 0: 1
1: 0
2: 2
3: 22
4: 338
Right 1133611865 16:7441116-7441138 TGCCTTCCTCTATATGAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133611865 Original CRISPR TGCCTTCCTCTATATGAGGT GGG Intronic
902718510 1:18289283-18289305 TGCCTTCCGCTTTATGACTTTGG + Intronic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
903886560 1:26544230-26544252 TGCCTACCTCTGTCTGTGGTTGG + Intronic
905116438 1:35645328-35645350 GGCCTTCCACTATATCAGGGAGG - Intergenic
908962638 1:69717634-69717656 TCCCTCCCTCAATATGAAGTTGG - Intronic
912145804 1:106792687-106792709 TCCCCTCCTCTATATGTGCTGGG - Intergenic
912753930 1:112308797-112308819 TGCCTTTCTCCATCTGAGCTGGG + Intergenic
914322244 1:146576446-146576468 TGCCTTCCTTTCCAAGAGGTTGG - Intergenic
917793124 1:178512637-178512659 TGGGTTACTCTGTATGAGGTGGG - Intergenic
923481913 1:234393357-234393379 TGGCTTCCTCTAGTGGAGGTGGG - Exonic
1070462238 10:76681766-76681788 TGACTTCTTTTATATGAGGCTGG + Intergenic
1071039907 10:81294907-81294929 TGACTTCCTCCATTTAAGGTTGG + Intergenic
1072646474 10:97259281-97259303 AGCCTTCAGCTTTATGAGGTTGG - Intronic
1074183701 10:111083773-111083795 TGCCATCCCCAAGATGAGGTTGG - Intergenic
1078515445 11:12018089-12018111 TGCCTTCCTGTGGATGTGGTTGG + Intergenic
1081606439 11:44530028-44530050 AGCCTTCCTCTTTTTCAGGTAGG - Intergenic
1082973041 11:59043592-59043614 TGCCTACCTGTTTTTGAGGTCGG - Intergenic
1082977435 11:59087156-59087178 TGCCTACCTGTTTTTGAGGTCGG - Intergenic
1083665214 11:64270410-64270432 AGCCTTCCTCTAAGTGAGATCGG + Intronic
1092614713 12:10206265-10206287 TTCCTTCTGCTATGTGAGGTTGG + Intergenic
1094465187 12:30746034-30746056 TGCCTGCTTCTCTTTGAGGTGGG - Intronic
1097438245 12:59577190-59577212 TTCCTTCCCCCATATGTGGTAGG + Intergenic
1098106317 12:67071098-67071120 TGCCTTTCTCTATATAAAATTGG - Intergenic
1100133738 12:91528202-91528224 TGTGTTCCTCTTTGTGAGGTGGG + Intergenic
1104114701 12:125738176-125738198 AGCCTTCCTCTTTCTCAGGTCGG + Intergenic
1105933346 13:25073755-25073777 TTCCTTCCTCTTTTTGAGGGGGG - Intergenic
1112371964 13:98802120-98802142 TGCCTTCCTGTTTCTGAGGAAGG + Intronic
1116864955 14:50024474-50024496 TGCCTTCCTTTCTTTGAGTTTGG - Intergenic
1117110147 14:52444476-52444498 TGCCTTCATCTGGATGAGGAAGG - Intronic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118310525 14:64689103-64689125 TGCCTTCCTGTATGTCAGGAAGG - Intergenic
1118432578 14:65735090-65735112 TGCCTACCTACATGTGAGGTTGG - Intronic
1121511474 14:94516112-94516134 TGGCTTCCTCCACATGAGCTGGG + Exonic
1121838281 14:97111774-97111796 TGCTTTCCTCCATCTGAGTTTGG + Intergenic
1122004558 14:98691325-98691347 TGCCTGTCTCTCTATGAGGTAGG - Intergenic
1122500081 14:102191549-102191571 GGCCTTTCTCTATCTGGGGTGGG + Intronic
1126480607 15:49115309-49115331 TGACTTCCTCTCTTTGAGTTTGG - Intronic
1128177281 15:65566961-65566983 TGCCTTCATCTACACAAGGTGGG - Intronic
1128870133 15:71148683-71148705 TTCCTCACTCTGTATGAGGTGGG - Intronic
1130694401 15:86115952-86115974 TGTCATCCTATACATGAGGTTGG + Intergenic
1132720225 16:1312081-1312103 TGCCCTCCTCTAAGTGAGGGGGG - Intronic
1133310200 16:4840674-4840696 TTCCTTCCTAACTATGAGGTAGG + Intronic
1133611865 16:7441116-7441138 TGCCTTCCTCTATATGAGGTGGG + Intronic
1134180937 16:12047109-12047131 TTCTTTCCTCTCTGTGAGGTGGG + Intronic
1134813674 16:17188380-17188402 TGCCTTCTTACAAATGAGGTAGG - Intronic
1135307674 16:21380871-21380893 TTCTTTCCTCTCTGTGAGGTGGG + Intergenic
1136047620 16:27627179-27627201 TGCCTTGTTCTATATCAGCTGGG - Intronic
1136304418 16:29359991-29360013 TTCTTTCCTCTCTGTGAGGTGGG + Intergenic
1140011381 16:71134722-71134744 TGCCTTCCTTTCCAAGAGGTTGG + Intronic
1145885680 17:28381082-28381104 TGCTCTCCCCTATATGAGGCCGG + Intronic
1147213589 17:38886369-38886391 TGCCTTCCTCTGCCTGGGGTTGG + Intronic
1151952434 17:77362586-77362608 GGCCTTCCTCTTGAGGAGGTGGG - Intronic
1153324847 18:3808006-3808028 TGCCCTCCTCCAAATGATGTGGG - Intronic
1154096948 18:11426694-11426716 TGCCTTTCTATATATCAGTTAGG - Intergenic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1159014618 18:63090914-63090936 TGTCTCCCTCCATCTGAGGTTGG + Intergenic
1160338007 18:78059986-78060008 TGCCTTCCTCAATTGCAGGTGGG + Intergenic
1160533827 18:79580758-79580780 AGCCTTCCTCGATCTGAGCTCGG + Intergenic
1164137133 19:22426087-22426109 TGCCTACCTCTGTCTGAAGTTGG - Intronic
1167531737 19:50022010-50022032 TTCCCTCCACTCTATGAGGTAGG + Intronic
1168487254 19:56774395-56774417 TGCCCTCCTTTATATCAGATTGG - Intergenic
925681584 2:6427828-6427850 GCCCTTCCTATACATGAGGTAGG + Intergenic
926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG + Intronic
927178310 2:20425598-20425620 TGTCTGCCTCTCTTTGAGGTGGG - Intergenic
931793705 2:65689595-65689617 TGCCTTGTTCAATATGAGGGCGG + Intergenic
937361162 2:121231120-121231142 TGTCTGCCTCTATATGATGTGGG - Intronic
941582214 2:167313259-167313281 TGCCTTCTTCTATAAAAAGTAGG - Intergenic
941863326 2:170307952-170307974 TGCCTTCCTATTTCTGAAGTAGG - Intronic
942111132 2:172683743-172683765 TGACTTCATCTTTAAGAGGTTGG + Intergenic
942578982 2:177396064-177396086 TGACTTACTCTATATGGGGGTGG + Intronic
946971725 2:225100852-225100874 TGCCTTGCTCTGTCTGAGGAAGG + Intergenic
1173451456 20:43167822-43167844 TGCCAACAACTATATGAGGTTGG + Intronic
1173460968 20:43243171-43243193 TGCCTTCTTTTATCTGGGGTGGG + Intergenic
1179101218 21:38357050-38357072 AGGATGCCTCTATATGAGGTAGG + Intergenic
1179588716 21:42390815-42390837 TGCCTTCATCTTCATGAGGCTGG - Intronic
1182921503 22:34084216-34084238 TGACTCCATCTTTATGAGGTAGG + Intergenic
950013871 3:9742820-9742842 TGCCTGCCTCTAACTGTGGTGGG + Intronic
951404681 3:22281193-22281215 TGACTTCCTCTTTATCAGTTTGG + Intronic
952882800 3:37995729-37995751 TCCCTTCCTGTAGCTGAGGTGGG - Exonic
956039101 3:65127501-65127523 TTCCTTCCTATATATTAGGAAGG - Intergenic
956114183 3:65902337-65902359 TTCATTCTACTATATGAGGTTGG - Intronic
957520915 3:81317230-81317252 TGCCTTACTTTATTTTAGGTAGG + Intergenic
957721270 3:84003015-84003037 TGACTTCCTCTTTATCAGTTTGG + Intergenic
958721964 3:97854812-97854834 TGACTTCCTCTATACGAATTTGG + Intronic
964644182 3:158940619-158940641 TGACTTCCTCTTTATGAATTTGG - Intergenic
965013290 3:163125045-163125067 TGCCTCCATCTATAAGAGGTAGG + Intergenic
969615120 4:8247616-8247638 TGCGTTCCTGCATAGGAGGTGGG - Intergenic
972862770 4:43191277-43191299 TGCGTTCATCTATAGGAGTTTGG + Intergenic
973147215 4:46842277-46842299 TGCTTTCCTCTATGTGCAGTGGG + Intronic
974563699 4:63555405-63555427 CTCTTTCCTATATATGAGGTTGG - Intergenic
975035411 4:69674345-69674367 TGCCTCCATCTATAAGAGGCAGG + Intergenic
976068067 4:81212774-81212796 TGTCTAGGTCTATATGAGGTTGG + Intronic
977964835 4:103133415-103133437 TGCATTCATCTATGTGAGGCTGG - Intronic
978329434 4:107596732-107596754 AGCCTTCCTATCTATGAAGTGGG + Intronic
978712367 4:111799947-111799969 TGCGTTGCTTTCTATGAGGTGGG + Intergenic
983771215 4:171551576-171551598 TGCCTTCCTCTATATCAGACAGG - Intergenic
985160462 4:187038998-187039020 TGCCAACCTCTCTATAAGGTAGG - Intergenic
985879956 5:2631194-2631216 TGTCTTCCTCTTCATGAAGTAGG + Intergenic
986844529 5:11737255-11737277 TGCATTTTTCTATATCAGGTTGG - Intronic
987451246 5:18086554-18086576 TCCCTTCCTCTATATAAGCAGGG - Intergenic
989697845 5:44224710-44224732 AGTCTTCCTCTTGATGAGGTGGG + Intergenic
991103291 5:62817172-62817194 TGCCTTCCACTATAGGAGAGGGG - Intergenic
993955918 5:94232910-94232932 TGCCTTCCTGTATAAAAGTTAGG + Intronic
994717925 5:103346361-103346383 TCCCTTCCTCTAGATAAGTTAGG + Intergenic
994992172 5:107010866-107010888 TTCCTTCCTTTATATTAGGTTGG - Intergenic
995483958 5:112620211-112620233 CTCCTTCCACCATATGAGGTTGG + Intergenic
998347706 5:141478593-141478615 TTCCTTCCTCAATATGATGTAGG - Intronic
999348232 5:150843387-150843409 TGGTTTCCTCTGCATGAGGTTGG - Intergenic
1004160386 6:13207625-13207647 TGCCTTCTTGGATGTGAGGTAGG - Intronic
1005364937 6:25067205-25067227 TGTCTTCCTCTACGTGAGGCAGG - Intergenic
1006852187 6:37106796-37106818 TCTTTTCCTCTATATGTGGTGGG - Intergenic
1007794622 6:44337584-44337606 TGCCTTCCTCTATGGGATTTGGG + Intronic
1012246362 6:96930578-96930600 TGCCTTCCTCAAAATGATGGTGG + Intronic
1013838251 6:114358750-114358772 TGCCTTCATCTATTTGAAGGAGG - Intergenic
1021424028 7:20478584-20478606 TCCCTTCTTCAATATGAAGTGGG - Intergenic
1023558490 7:41447962-41447984 TGCCCTCCTATAATTGAGGTTGG + Intergenic
1023701620 7:42897281-42897303 TGACTTCCTCTTTATCAGCTTGG - Intergenic
1024937465 7:54725468-54725490 TGCCTTTCTCTATAATATGTAGG - Intergenic
1026127655 7:67593690-67593712 TGCCATCCTCCCAATGAGGTTGG - Intergenic
1029707750 7:102284716-102284738 TGCGCTCCTCTATCTGAGGCTGG - Intergenic
1032852846 7:135809921-135809943 TGTCTTCCTCATTATCAGGTTGG - Intergenic
1033067983 7:138174153-138174175 TCCCTCCCTTTATATGAGATAGG - Intergenic
1033848431 7:145463515-145463537 TGCCTTCCACCATGTGAGGATGG + Intergenic
1036988441 8:13564698-13564720 TGACTTCCTCTTTCTGGGGTTGG + Intergenic
1037309991 8:17545011-17545033 TGGCTTCATCTATATAATGTAGG + Intronic
1037464346 8:19144717-19144739 TGCCTTCCTTGAGATGAGGTGGG - Intergenic
1039249167 8:35642908-35642930 TGCTTTACTCTATCTGGGGTGGG - Intronic
1039319977 8:36418848-36418870 TGAATACCTCTATATGAGGTAGG - Intergenic
1041207451 8:55512857-55512879 TGCCTTCCTCTCTACCTGGTAGG + Intronic
1041327788 8:56687627-56687649 TCACTTCCTTTATGTGAGGTAGG + Intergenic
1042193227 8:66209069-66209091 TGCTTTTCTCTATATGGGATTGG + Intergenic
1042211958 8:66389871-66389893 TGCCTGCCTCCAACTGAGGTTGG - Intergenic
1045348375 8:101315571-101315593 TGTCTCCCTCTATATCTGGTTGG + Intergenic
1050766742 9:9143744-9143766 AGCCTTCCTCTCTCTGAGGATGG - Intronic
1051243251 9:15082386-15082408 TGCCTACCACAATCTGAGGTGGG - Intergenic
1057820197 9:98324191-98324213 TGCCTTCCTCCGTGTGAGCTGGG - Intronic
1059455281 9:114396720-114396742 TCCCTTCCACAAAATGAGGTTGG - Intergenic
1062100381 9:134724933-134724955 TGCCATCCTCCAGATGGGGTTGG + Intronic
1187412175 X:19061084-19061106 TCCCCTCCTCCATATGAGGAAGG - Intronic
1192004873 X:67199727-67199749 TGTCTCCCTCTATCTGAGGTGGG + Intergenic
1196342829 X:114615897-114615919 TGCCTCCCTCTAGATGGGGTAGG - Intronic
1198796798 X:140405770-140405792 TGCCTTCCTCTTTATGGATTTGG + Intergenic
1199004588 X:142680318-142680340 TGCCTGTCTCTATTTGAGATGGG - Intergenic
1199179535 X:144837080-144837102 AGCCTTCCAATATATGAAGTTGG - Intergenic