ID: 1133612353

View in Genome Browser
Species Human (GRCh38)
Location 16:7445333-7445355
Sequence CAGATTAAGAGAGGAGTAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133612353_1133612365 24 Left 1133612353 16:7445333-7445355 CCCGCTACTCCTCTCTTAATCTG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1133612365 16:7445380-7445402 TTATGCACCAGCTCCATTTGAGG 0: 1
1: 0
2: 2
3: 14
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133612353 Original CRISPR CAGATTAAGAGAGGAGTAGC GGG (reversed) Intronic
904309841 1:29621853-29621875 CAGATAAAGTGAGGAGCAGTGGG + Intergenic
904376084 1:30083366-30083388 CAGATGGAGAAAGGAGAAGCCGG - Intergenic
904817968 1:33219943-33219965 CAGTATAAGGGAGGAGTAGGGGG - Intergenic
907565086 1:55426952-55426974 GAAATTAAGAGAGGAGCAGTTGG + Intergenic
908565081 1:65345976-65345998 CAGTGAAACAGAGGAGTAGCAGG + Intronic
908565867 1:65355500-65355522 CAGACCAAGAGAGCAGAAGCAGG - Intronic
909088213 1:71192999-71193021 CAGAGGAAGAGAGCAGTAGATGG + Intergenic
911324083 1:96448334-96448356 CTGATTAAGAGTGGGGTGGCAGG - Intergenic
914686299 1:149982823-149982845 AAAAGTAAGAGAGGAGAAGCTGG - Intronic
915940154 1:160113913-160113935 GAGAGTGAGAGGGGAGTAGCGGG - Intergenic
916185815 1:162131769-162131791 AAGATAAAGAGAGGAGGAGAAGG + Intronic
917227296 1:172799022-172799044 CTGATTATGAGAGGTGAAGCTGG + Intergenic
917230771 1:172835048-172835070 TAGATAAAGAGAGCAGTAGGAGG + Intergenic
917711728 1:177692149-177692171 CAGAATAAGAGGGGAGAAGAGGG + Intergenic
920854885 1:209654191-209654213 CAGATAAAGGGAGGAGGAGGAGG - Intergenic
921818381 1:219589439-219589461 AAGAGTAAGGGAGGAGTAGGAGG + Intergenic
924715218 1:246566661-246566683 CAGGTGAGGAGAGGAGGAGCGGG + Exonic
1064377685 10:14811506-14811528 CAGAAAAAGAAATGAGTAGCAGG - Intergenic
1064867373 10:19896082-19896104 CAGATCAAGAGAAGAGGAGTTGG - Intronic
1067159590 10:43813009-43813031 GAGAGAAAGAGAGAAGTAGCAGG + Intergenic
1067433740 10:46263331-46263353 CAGATGAAGGGAGGGGTGGCCGG + Intergenic
1068162936 10:53290708-53290730 CAGAGTAAAAGAGGCGTAGAAGG + Intergenic
1069295736 10:66842237-66842259 TAGATTAAGAAAGTAGCAGCTGG - Intronic
1072352795 10:94574641-94574663 ATGATTCAGAGAGGAGTACCAGG + Exonic
1072426444 10:95334582-95334604 CAGGATAGGAGGGGAGTAGCTGG - Intronic
1072671908 10:97436597-97436619 CAGCATAAAAGAGGAGTCGCAGG - Intronic
1074700203 10:116085925-116085947 AAGAATAAGAAAGGAGAAGCTGG - Intronic
1074909284 10:117892896-117892918 GAGAAGGAGAGAGGAGTAGCTGG - Intergenic
1075091885 10:119448392-119448414 CAGCTTAGGTGAGGAGTGGCCGG - Intronic
1079786801 11:24683397-24683419 CAGATTATCAGAGGAGTTTCAGG - Intronic
1079879236 11:25903764-25903786 CAGAATAAGAGATGAGTGGTAGG + Intergenic
1080369541 11:31619078-31619100 CAGAAAAATAGAGTAGTAGCTGG + Intronic
1080587678 11:33696382-33696404 CAGAGAATGAGAGCAGTAGCTGG - Intergenic
1082020126 11:47525781-47525803 CACATTAAGAGAAGAGAGGCTGG + Intronic
1085422855 11:76379242-76379264 CAGATTAATAGAGGAGGAGATGG - Intronic
1086902071 11:92379081-92379103 CATATGGAGAGAGGAGTGGCAGG - Intronic
1088784501 11:113168649-113168671 CAGATTAAACCAGGAGCAGCAGG - Intronic
1089432379 11:118435437-118435459 CTGATTAAGAGAGGGGGAGGAGG - Intergenic
1090958667 11:131536621-131536643 CAGATTGATGGATGAGTAGCAGG - Intronic
1091151787 11:133335762-133335784 TGGATTAAGAGAGGAGGTGCAGG + Intronic
1091174846 11:133548698-133548720 TGTATTAAGAGAGGAGAAGCGGG + Intergenic
1092391184 12:8081324-8081346 CTGATTAAGAGTGGGGTGGCAGG + Intergenic
1095294070 12:40508528-40508550 CAGAATATGAGAGGAGTGACAGG + Intronic
1096080551 12:48829642-48829664 CACATTAAGAGAAGAGTAGAGGG - Intergenic
1096136985 12:49210754-49210776 CAGATTAAAAGACAAGAAGCCGG + Intronic
1099767895 12:87012859-87012881 CAGATTCACAGAAGAATAGCAGG - Intergenic
1100679215 12:96900659-96900681 CTGATTAAGACTGGAGTGGCAGG + Intergenic
1100766933 12:97876825-97876847 CAGCTTAAGGGAGGATTAGTTGG - Intergenic
1100981680 12:100167114-100167136 CACATTGAGAGAGGAGAAGGAGG - Intergenic
1101676485 12:106921617-106921639 TAGATTAAGTGAGGAGAAACTGG - Intergenic
1102326850 12:111993106-111993128 CAGGTTAAGAGAGCAGTGGGGGG - Intronic
1102918619 12:116774959-116774981 AAGCTTAAGAGAGGAGCAACAGG + Intronic
1103948236 12:124538798-124538820 CAGGGTCAGAGAGGAGGAGCGGG - Intronic
1107450286 13:40502253-40502275 CTGGTAAGGAGAGGAGTAGCAGG + Intergenic
1107564369 13:41586909-41586931 CTGATTAAGAGAGGATTAATAGG + Intronic
1114259278 14:21025524-21025546 TAGATTAAGAAAGGAGGAGGTGG + Intronic
1114728219 14:24962077-24962099 CAGAGAAAGAGAGGAGAAGAAGG - Intronic
1114769708 14:25414719-25414741 GAAATTAAAAGAAGAGTAGCAGG - Intergenic
1117579462 14:57137676-57137698 CAGATTATAAGGGGAGGAGCTGG - Intergenic
1118079250 14:62339364-62339386 CAGATTTAGACAGGAGAACCAGG - Intergenic
1118102929 14:62626417-62626439 CAGGTTAATGGAGGAGAAGCTGG + Intergenic
1118168509 14:63361515-63361537 GAGAAAAGGAGAGGAGTAGCGGG + Intergenic
1119477626 14:74940202-74940224 CAGCTAAAGAGAGGAGAGGCAGG + Intergenic
1123799439 15:23804928-23804950 CACAGCAAGAGAGGAGTTGCAGG + Intergenic
1123984193 15:25630475-25630497 TTTATTAAGAGAGGAGTAACTGG + Intergenic
1124478647 15:30058863-30058885 CAGAAAAAGAGAGGAAAAGCTGG + Intergenic
1125519096 15:40338389-40338411 CAGAGAAAGGGAGGAGGAGCAGG + Intronic
1126547659 15:49890407-49890429 CAGTTTAGGAGAGGGGTGGCAGG + Intronic
1128089774 15:64911735-64911757 CAGGTTAAGAGAGCAGGAGGAGG + Intronic
1128453925 15:67822437-67822459 CAGATTGAGAGAGGAAGAGAAGG + Intronic
1131513206 15:93060973-93060995 CAGCCAAAGAGAGGAGCAGCTGG - Intronic
1133612353 16:7445333-7445355 CAGATTAAGAGAGGAGTAGCGGG - Intronic
1137377684 16:47967575-47967597 GAGCTTAAGAGAGCAGTAGCAGG - Intergenic
1139872441 16:70118365-70118387 AAGGTTGAGAGAGGAATAGCTGG + Intronic
1140363331 16:74362934-74362956 AAGGTTGAGAGAGGAATAGCTGG - Intergenic
1140812031 16:78587757-78587779 CAGATCAAGACAGTATTAGCTGG - Intronic
1140878357 16:79174350-79174372 AAGATTAAGAAGGGACTAGCCGG + Intronic
1142328392 16:89433599-89433621 CAGAGTAAGAGAGAAGGAACGGG + Intronic
1142656499 17:1398200-1398222 CAGATTAAGAGGGGAACATCTGG + Intronic
1143940583 17:10537022-10537044 CAGAGTCAGAGAGGATTATCAGG - Intronic
1144741556 17:17585561-17585583 CTGATTAAGAGCGGGGTGGCAGG - Intronic
1148204488 17:45771343-45771365 CAGAGGAAGACAGGAGGAGCTGG - Intergenic
1149378866 17:56072808-56072830 CAGATGAGGAGAGGAGAAGGTGG + Intergenic
1153627511 18:7035755-7035777 GAGATGAAGAGAAGAGTGGCGGG + Intronic
1157733707 18:50027651-50027673 CAGATTAAGTGACTAGTACCTGG + Intronic
1158880958 18:61779317-61779339 GAGAGTGAGAGAGCAGTAGCTGG - Intergenic
1159361950 18:67416712-67416734 TAGATCAAGAGAGAAGTACCTGG + Intergenic
1159540501 18:69768341-69768363 CAGAGAAAGAGAGGAGCATCTGG + Intronic
1161748306 19:6075219-6075241 CAGATTAAGACAGGAGGAGAAGG + Intronic
1162744489 19:12791078-12791100 CAGAATACGAGAGGGGTAGGAGG - Intronic
1164526231 19:29015565-29015587 CAGAAAAAGAGAGGAGGAGAGGG - Intergenic
1164986163 19:32650186-32650208 CAGATGAAGAGAGGAGCATTTGG + Intronic
1166965888 19:46529125-46529147 CAGTTCAAGAGATGAGTGGCTGG + Intronic
1168122216 19:54257821-54257843 CAGATTAAGACAGGAGTGGTTGG + Intronic
925763644 2:7210250-7210272 CAGCATCAGAGCGGAGTAGCAGG + Intergenic
926577861 2:14601860-14601882 CAGAGTAAGAGGGGAGTATGGGG + Intergenic
926946916 2:18198450-18198472 CAGATAAATAGAGGAGTAGATGG - Intronic
928097687 2:28414508-28414530 CAGAATGAGCCAGGAGTAGCAGG + Exonic
928244286 2:29614066-29614088 CAGAGAAAGTGAGGAGGAGCTGG + Intronic
928766289 2:34650445-34650467 CAGATGAATGGAGGAGCAGCAGG - Intergenic
929104060 2:38346739-38346761 CACAGCAAGAGGGGAGTAGCAGG - Intronic
929909799 2:46080003-46080025 GAGATTAAGGGAGGAGGAGGTGG + Intronic
931246597 2:60497722-60497744 CAGAGAAAGAGAAGAGTAGGAGG - Intronic
932010659 2:67974406-67974428 TAGATGAAGGGAGGAGGAGCAGG + Intergenic
933023686 2:77226255-77226277 CAGAGCAGGAGAGGAGTAGAAGG - Intronic
935801107 2:106697293-106697315 CTGATTAAGAGTGGGGTGGCAGG + Intergenic
937007028 2:118526355-118526377 CAGGTGATGACAGGAGTAGCTGG - Intergenic
937208253 2:120250858-120250880 TATATTCAGAGAGGAGTGGCAGG - Intronic
937924803 2:127159730-127159752 CATATGAAGAGAGTTGTAGCTGG - Intergenic
938157312 2:128952402-128952424 CAGCTTAACAGAGTAGTAGGAGG - Intergenic
943880854 2:193142024-193142046 CAGATTAACATAGGTGTACCTGG + Intergenic
944350591 2:198722538-198722560 CAGATTAAGAGATGAGGAAGAGG + Intergenic
944954508 2:204792847-204792869 CAGATTAAGAGAGATGTAGGAGG - Intronic
948015260 2:234684124-234684146 CATAAAAAGAGAGGAGTAGGGGG + Intergenic
1169879713 20:10333251-10333273 CAAATTAAGAGAGAAGTTGCTGG + Intergenic
1170129132 20:13000219-13000241 CAGATTGAGAGGAGAGTAGTCGG + Intergenic
1170465782 20:16621408-16621430 CAGATGAAGAAAGGTTTAGCAGG + Intergenic
1170701487 20:18707826-18707848 CAGCTGAAGAGAAGAGTAGAGGG + Intronic
1177376662 21:20279321-20279343 CAGATGAAGAGAGGGGCATCGGG + Intergenic
1178639127 21:34331991-34332013 CAGATGAGGAGCGGAGTGGCCGG + Intergenic
1180909193 22:19436879-19436901 CAGAGTAACAGAGGAGTGGTGGG + Intronic
1181432750 22:22893173-22893195 CAGATGAACAGATGAATAGCTGG + Intronic
1182342994 22:29639586-29639608 CTCATTAAGAGAGGACTGGCCGG + Intronic
1182549977 22:31095654-31095676 CAGAGTATGAGGGGAGCAGCTGG - Intronic
1183005121 22:34894870-34894892 CAGAGATAGAGAGAAGTAGCTGG - Intergenic
1183379338 22:37483145-37483167 GAGAGGAAGAGAGGAGGAGCGGG - Intronic
1185022833 22:48390080-48390102 GTGATTCAGAGAGGAGTGGCTGG + Intergenic
951428712 3:22581306-22581328 CAGAACAAGAGAAAAGTAGCAGG + Intergenic
951555295 3:23915707-23915729 AAGATTAATAGAGGAACAGCAGG - Intronic
953963337 3:47283164-47283186 CAGAGAAAGAGAGGTCTAGCAGG + Intronic
954859613 3:53676307-53676329 GAAAGTAAGAGGGGAGTAGCAGG - Intronic
955060316 3:55487571-55487593 CAGACCCAGAGAGGAGGAGCTGG - Exonic
956782402 3:72614414-72614436 CAGATTTGGAGAGCAGCAGCTGG - Intergenic
959514398 3:107249202-107249224 TGGATTCAGAGAGCAGTAGCGGG + Intergenic
960453621 3:117842249-117842271 CACAATAAGAGAGGAGGAGTGGG + Intergenic
960522704 3:118674036-118674058 CAGGATTAGAGAGGTGTAGCTGG + Intergenic
960808031 3:121602840-121602862 CATGTTAAGAGATCAGTAGCTGG + Intronic
961457801 3:127032913-127032935 GAGATTCAGGGAGGAGTGGCAGG - Intronic
963200724 3:142583353-142583375 CAGAATAAAAGGAGAGTAGCAGG + Intergenic
970172498 4:13303738-13303760 CAGGTTAAGTTAGGAGTGGCTGG - Intergenic
970574752 4:17416478-17416500 AGGATCCAGAGAGGAGTAGCTGG - Intergenic
970863886 4:20737194-20737216 CAGGTACAGAGAGGAGAAGCTGG + Intronic
970889785 4:21030100-21030122 CACAGTAAGAGGTGAGTAGCAGG + Intronic
971218335 4:24682387-24682409 CAGAGTCTGAGAGGGGTAGCAGG - Intergenic
971908710 4:32764820-32764842 CAGATTAAGAAATGAGTAGGGGG + Intergenic
975102413 4:70529392-70529414 CAAATTAATAGAAAAGTAGCTGG - Intronic
976159332 4:82182023-82182045 CAGGTTAAGTGAAAAGTAGCAGG + Intergenic
978373232 4:108050280-108050302 CAGCTTAAGAGAGGAGGAGAAGG + Intronic
978373348 4:108050977-108050999 CAGCTTAAGAGAGGAGGAGAAGG - Intronic
980559392 4:134453278-134453300 GAGATTAAGAGATCTGTAGCTGG + Intergenic
980883215 4:138734724-138734746 AACACTAAGAGAGGAGTAGGAGG - Intergenic
981404279 4:144349691-144349713 CAGAATAAGAGAAGGGTAGTGGG + Intergenic
981943857 4:150317673-150317695 CAGATTATCAGAGAAGTAGAGGG - Intronic
981963487 4:150572212-150572234 CAGAATAAAATAGGAGTAGAAGG - Intronic
982558526 4:156899957-156899979 CAGATTACCAGAAGAGTAGAAGG - Intronic
986672014 5:10150884-10150906 CAGGTGAAGAGAGGAGGTGCTGG + Intergenic
987107208 5:14651900-14651922 CTGATTAAGAGTGGGGTGGCAGG + Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
988889395 5:35598627-35598649 CAGAATCAGGGAGGAGTCGCAGG + Intergenic
991292394 5:65045392-65045414 TAGATTGAGATAGGAGAAGCAGG - Intergenic
992089862 5:73307282-73307304 CAGATTGGGAGAGGAGGAGTGGG - Intergenic
993728235 5:91392620-91392642 CAGATGATGAGAGGAGTGGGAGG + Intergenic
995609816 5:113897579-113897601 CTGGTTAAGGGAGGAGCAGCTGG + Intergenic
996272616 5:121625150-121625172 AAGATTAAGAAAGGAGAAGAAGG + Intergenic
998208293 5:140175175-140175197 CAGAGCAAGTGAGGAGCAGCCGG - Exonic
998549660 5:143065061-143065083 CAAATTAAGGGAGGAGTGGGAGG + Intronic
999807245 5:155093654-155093676 CAGAATAACAAGGGAGTAGCTGG + Intergenic
1000809582 5:165844757-165844779 ACGACTAAGACAGGAGTAGCAGG + Intergenic
1001201699 5:169723569-169723591 CAAAGTGAGTGAGGAGTAGCAGG - Intronic
1001271508 5:170315794-170315816 CAGATTAACTGAGGAATGGCTGG - Intergenic
1001831482 5:174793155-174793177 GAGAGTAAGGGAGGAGAAGCAGG + Intergenic
1002503433 5:179662393-179662415 CAGATTAAAAGAGAAAAAGCAGG - Intergenic
1002937419 6:1685388-1685410 CAAAGTAATAGAGGAGTATCTGG + Intronic
1003235729 6:4293942-4293964 CAGATAAAGAGTGGTGCAGCTGG - Intergenic
1003553853 6:7122621-7122643 CAGAAAAAGTGAGGAGTAGAAGG - Intronic
1004729823 6:18346793-18346815 CAGATTAAGAAATCAGCAGCTGG - Intergenic
1004827403 6:19437988-19438010 GAGATCATGAGAGGAGTGGCAGG + Intergenic
1006649536 6:35539441-35539463 CAGATCAAGAGTGGTGTATCAGG - Intergenic
1007563674 6:42831600-42831622 CAGATGAGAAGAGGAGGAGCTGG - Intronic
1010228890 6:73517772-73517794 CTGATTAAGAGTGGGGTGGCAGG + Exonic
1011950929 6:92963035-92963057 TAGGTTAAGAGAGGAGCAGATGG + Intergenic
1018953368 6:168392672-168392694 CAGTATAAGGGAGGAGTACCTGG - Intergenic
1021616834 7:22510574-22510596 CTGATTAAGAGTGGGGTGGCAGG + Intronic
1023067546 7:36393418-36393440 CACTTCAAGAGAGGAGAAGCTGG + Intronic
1024645352 7:51366449-51366471 CAGAGTAGGAGAGGTGTAGTTGG + Intergenic
1027220439 7:76210571-76210593 TAGGTAAAGAGAGGAGAAGCAGG + Intronic
1030514920 7:110527280-110527302 CAGATTATCAGAGGAATAGAGGG + Intergenic
1030982912 7:116207619-116207641 CAGATTAGTATGGGAGTAGCAGG - Intergenic
1031115296 7:117660901-117660923 CAGATTCAAAGATGAGTAACAGG - Intronic
1032561188 7:132894564-132894586 CAGTTAAGGAGAGGAGTAGTGGG - Intronic
1034069803 7:148173266-148173288 GGGATGAAGAGAGGAGGAGCTGG + Intronic
1035045640 7:155963698-155963720 CAGCTTATTAGAGGAGGAGCTGG + Intronic
1035421395 7:158731605-158731627 CAGATTAAAATAGAAGCAGCTGG - Exonic
1035632332 8:1117547-1117569 CAGATTCAGAGAGAAGAAACAGG + Intergenic
1035677454 8:1465414-1465436 CAGATGAAGAGATGAGCAGAGGG + Intergenic
1040054819 8:43048411-43048433 GAGATTAAGAGAAGAGTATTGGG + Intronic
1042612552 8:70614645-70614667 CTTATTCACAGAGGAGTAGCAGG - Intronic
1046506332 8:115142483-115142505 CAGATTAGGAGAGGAGCAGGTGG + Intergenic
1050272974 9:3965787-3965809 CAGAGTGAGAGAGGAGGAGTTGG - Intronic
1053366623 9:37527144-37527166 TAGATTAAGAGAGCAGGGGCCGG - Intronic
1054745285 9:68847815-68847837 CAAATTAAAAGAGTAGAAGCTGG + Intronic
1055278301 9:74644547-74644569 CAGGTTAACAGAGGAGTGGAGGG - Intronic
1055802341 9:80052148-80052170 CAGATTATGAGAAGACTGGCTGG - Intergenic
1055956002 9:81773975-81773997 CAGAATACAAGAGGAGAAGCAGG - Intergenic
1057508353 9:95655720-95655742 AAGAATAAGACAGGAGGAGCAGG - Intergenic
1059322858 9:113482889-113482911 CAGATTAAGGGCCTAGTAGCAGG + Intronic
1060434247 9:123580171-123580193 CACATTAAAAGAGGAGTACCAGG - Intronic
1061784805 9:133020890-133020912 CTGATTAAGAGTGGGGTGGCAGG - Intergenic
1193414766 X:81208565-81208587 CAGATTAAGAGAGAAGCTGCTGG + Intronic
1194188994 X:90811214-90811236 GAGATAAGGAGAGGAGTAGGGGG + Intergenic
1196195637 X:112836128-112836150 CAGAATGAGAAAGGAGAAGCAGG - Intronic
1199982966 X:152930955-152930977 CAGGTAATAAGAGGAGTAGCTGG - Intronic
1200535575 Y:4393115-4393137 GAGATAAGGAGAGGAGTAGGGGG + Intergenic