ID: 1133616323

View in Genome Browser
Species Human (GRCh38)
Location 16:7480022-7480044
Sequence CTGAGTCAGCACATGGACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133616323_1133616325 3 Left 1133616323 16:7480022-7480044 CCGATGTCCATGTGCTGACTCAG 0: 1
1: 0
2: 1
3: 11
4: 235
Right 1133616325 16:7480048-7480070 ACAACTGCCTTTCTTCTGAATGG 0: 1
1: 0
2: 4
3: 19
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133616323 Original CRISPR CTGAGTCAGCACATGGACAT CGG (reversed) Intronic
900410281 1:2509589-2509611 CTGAGTGGCCACAGGGACATTGG + Intronic
901428636 1:9199091-9199113 CTGAGTCAGCACTGGTGCATTGG + Intergenic
902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG + Intergenic
903142492 1:21347366-21347388 CTGGGTCAGCACCTGGGCAAGGG - Intergenic
903548180 1:24140336-24140358 CAGACTCAACACATGTACATAGG - Intronic
904407673 1:30303860-30303882 CTGAGTTAGGACCTGAACATAGG + Intergenic
905339568 1:37269032-37269054 CTAAGTCTGCACATGGTCAGGGG + Intergenic
905950353 1:41945654-41945676 CAGAATCAGAACATGGAGATTGG + Intronic
906049249 1:42857030-42857052 CAGAGTCAGCAAAGGGAGATAGG - Intergenic
906237424 1:44220349-44220371 GCGAGTGAGCACATGCACATGGG + Intronic
906507334 1:46389961-46389983 CAGAATCAGAACATGGAGATTGG - Intergenic
906718405 1:47987719-47987741 CTGAGTGAGCACATGCCCAGGGG + Intronic
907044774 1:51294117-51294139 CTGCCTGGGCACATGGACATGGG + Intronic
907602565 1:55785624-55785646 CAGAATCAGAACATGGAGATTGG - Intergenic
907999940 1:59669893-59669915 CTGAGTCAGCCCAGGGATGTAGG - Intronic
910590998 1:88928014-88928036 CAGAATCAGAACATGGAGATTGG + Intergenic
910832144 1:91471671-91471693 CTGAGTCCTCACATGGAAAAAGG - Intergenic
911156420 1:94641922-94641944 CAGAGTCAGCACATCCACAAGGG + Intergenic
912499391 1:110112117-110112139 CTGTGCCAGCACCTGGACCTGGG - Intergenic
914601602 1:149211560-149211582 CTGAGTAAGCACTTGGACCATGG + Intergenic
920114042 1:203607333-203607355 TTGAGGCAGCACAAGGACACCGG + Intergenic
920425246 1:205869838-205869860 CAGAATCAGAACATGGAGATTGG - Intergenic
922684724 1:227630313-227630335 CAGAATCAGAACATGGAGATTGG - Intronic
923955571 1:239014796-239014818 ATGAGTCAGAACATGGACATGGG - Intergenic
1062926638 10:1320942-1320964 CTGTGGCAGCACAGGGTCATTGG + Intronic
1065199647 10:23300743-23300765 CAGAATCAGAACATGGAGATTGG - Intronic
1067761642 10:49052929-49052951 ATGAATCACCACATTGACATAGG + Intronic
1068611294 10:59063341-59063363 CTGAGTCCCGACAGGGACATAGG - Intergenic
1068748351 10:60561790-60561812 CTCAGTCACCACAGGGACTTGGG - Intronic
1071054893 10:81498177-81498199 CTGAGTCAGTTCATGGGCACGGG + Intergenic
1072378111 10:94838195-94838217 CAGAATCAGAACATGGAGATTGG - Intronic
1072471959 10:95721281-95721303 CAGAATCAGAACATGGAGATTGG - Intronic
1076870936 10:133194396-133194418 CTCAGCCAGCACATCGCCATTGG - Intronic
1077235297 11:1479221-1479243 CTGAGCCAGCACTTGGCCACAGG + Intronic
1078571842 11:12465269-12465291 CTGAGGCAGCACATGGCAAAGGG - Intronic
1079601355 11:22316003-22316025 CAGAATCAGAACATGGAGATTGG - Intergenic
1079963987 11:26958203-26958225 CTGAGCCACCACAAGGCCATAGG + Intergenic
1081070536 11:38604586-38604608 CAGAATCAGAACATGGAGATTGG + Intergenic
1082124775 11:48419315-48419337 CCAAGTCACCAAATGGACATAGG - Intergenic
1082251275 11:49983393-49983415 CCAAGTCACCATATGGACATAGG + Intergenic
1082579082 11:54844492-54844514 CAGAGTCAGCAAAGGGAGATAGG + Intergenic
1082740618 11:56906975-56906997 CTGAGTAAGAACATGGGCAATGG + Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089609632 11:119662312-119662334 AGGAGTCAGCACTTGGACCTAGG - Exonic
1089775504 11:120832711-120832733 CTGAGTCAGAACATGCACACTGG + Intronic
1091859948 12:3772090-3772112 CTGAGAGTGCACAGGGACATTGG - Intergenic
1092294041 12:7184039-7184061 CAGAATCAGAACATGGAGATTGG + Intergenic
1092469490 12:8765301-8765323 CAGAATCAGAACATGGAGATTGG - Intronic
1095138935 12:38639323-38639345 CAGAATCAGAACATGGAGATTGG + Intergenic
1095283889 12:40387103-40387125 CAGAATCAGAACATGGAGATTGG + Intergenic
1096209477 12:49753050-49753072 ATGAGTGACCATATGGACATAGG - Exonic
1096352108 12:50909103-50909125 CAGAATCAGAACATGGAGATTGG - Intergenic
1097149698 12:56967577-56967599 CAGAATCAGAACATGGAGATTGG - Intergenic
1097377302 12:58856170-58856192 CAGAATCAGAACATGGAGATTGG - Intergenic
1098956568 12:76695125-76695147 CTGACTCAGATCATGGAGATTGG - Intergenic
1098967838 12:76811724-76811746 CTCAGTCAGCAGATGGCCAAGGG - Intronic
1100745090 12:97636818-97636840 CTGACTCTGGACATGGAAATAGG - Intergenic
1102423584 12:112823260-112823282 GTGAGTAAGCACATGGGCTTTGG + Intronic
1103803012 12:123551710-123551732 CAGAATCAGAACATGGAGATTGG + Intergenic
1105365726 13:19762750-19762772 ATGAGTCAGAAAATGGACAAAGG - Intronic
1105507389 13:21022327-21022349 CTGACTCAGTACATGCACTTAGG - Intronic
1108154217 13:47568947-47568969 ATGATTCAGGACATAGACATTGG + Intergenic
1108876643 13:55057196-55057218 CAGAATCAGAACATGGAGATTGG + Intergenic
1109931715 13:69225045-69225067 CAGAATCAGAACATGGAGATTGG + Intergenic
1111806148 13:93042326-93042348 CAGAGTCAGAACATGGAGATGGG + Intergenic
1114535030 14:23417362-23417384 CTGAGACAGACCCTGGACATGGG - Intronic
1115909421 14:38239173-38239195 CTGAGTCAACACATGGAAGATGG + Intergenic
1119778561 14:77263183-77263205 CTGAGCCAGCACAAAGAGATGGG + Intergenic
1120618715 14:86736945-86736967 GAGAGTCAGCACAGGGAGATAGG - Intergenic
1121579333 14:95015188-95015210 CTGAGTCACCACATGGAGAGCGG - Intergenic
1121639130 14:95473543-95473565 CAGAGGCAACACATGGACAAAGG + Intronic
1122297128 14:100711991-100712013 CTGAGAGAGCACATGGAGAGGGG + Intergenic
1122362950 14:101178216-101178238 CTCAGGCAGAACATGGACACGGG + Intergenic
1122421975 14:101583430-101583452 CTGAGACAGCACCTGAGCATGGG - Intergenic
1122507372 14:102240204-102240226 CAGAGTCAGCAAAGGGAGATAGG - Intronic
1130444132 15:83982935-83982957 ATGAGTCAGCTCATGGAAACCGG + Exonic
1130799145 15:87243454-87243476 CTGAGTCTCCACATGGATAAGGG - Intergenic
1133616323 16:7480022-7480044 CTGAGTCAGCACATGGACATCGG - Intronic
1134366760 16:13585972-13585994 CAGAGAAACCACATGGACATTGG - Intergenic
1134631922 16:15762568-15762590 CTGAGTCAGTTCCTGGACAGAGG - Intronic
1135224701 16:20645743-20645765 CAGAATCAGAACATGGAGATTGG + Intronic
1136689351 16:32017724-32017746 CAGAGTCAGCTCTTGGACACTGG + Intergenic
1136789943 16:32961266-32961288 CAGAGTCAGCTCTTGGACACTGG + Intergenic
1136879869 16:33892670-33892692 CAGAGTCAGCTCTTGGACACTGG - Intergenic
1139940375 16:70601220-70601242 CTGAGGCAGCACATGCACAGAGG - Intronic
1203092146 16_KI270728v1_random:1222729-1222751 CAGAGTCAGCTCTTGGACACTGG + Intergenic
1142605669 17:1079843-1079865 CAGAGGCAGCCCATGGCCATGGG - Intronic
1145966842 17:28925213-28925235 CTGAGTCACCACAAGGTCAGAGG - Intronic
1146480931 17:33204318-33204340 CTGACTTAGCAGCTGGACATGGG - Intronic
1146598390 17:34188888-34188910 CTGAGTCAGCGAAGGGAGATAGG - Intergenic
1146743197 17:35304702-35304724 CTGACTCAGATCATGGAGATTGG + Intergenic
1147786029 17:42979570-42979592 CTCAATAAGCACGTGGACATCGG + Exonic
1149274126 17:55015279-55015301 CAGAATCAGAACATGGAGATTGG - Intronic
1151148694 17:72065103-72065125 CAGAGACAGCCCATGGATATTGG - Intergenic
1153401506 18:4688157-4688179 CAGAATCAGAACATGGAGATTGG + Intergenic
1153522127 18:5963143-5963165 CCAAGTCAGCACAGGGACAGTGG + Intronic
1156021979 18:32609811-32609833 CTGGTTTAGCACATGGACACAGG - Intergenic
1156493748 18:37512261-37512283 CACGCTCAGCACATGGACATTGG - Intronic
1158449910 18:57555008-57555030 CTGTGTCAGCACATAGTCAGAGG - Intronic
1158858461 18:61568364-61568386 ATGAATCAGGACATAGACATGGG - Intergenic
1158970947 18:62665837-62665859 TTGAGTTAGCACTTGAACATCGG + Intergenic
1159733536 18:72063293-72063315 CTAATTCAGCACATTGACATTGG - Intergenic
1163195628 19:15717639-15717661 CTGTGTCAAAACATGGACCTGGG + Intergenic
1163360796 19:16844925-16844947 CTGAGAGAGTGCATGGACATGGG + Intronic
1163716350 19:18874638-18874660 CTGAGTCATGACAAGGACATGGG + Intronic
1167133297 19:47601483-47601505 CTGAGTCACCAGATGAACCTAGG - Intergenic
924974179 2:157834-157856 CAGAATCAGAACATGGAAATTGG - Intergenic
925294296 2:2767454-2767476 CTTGGTCAGCACTTGGACATCGG - Intergenic
926415717 2:12647783-12647805 CTGAGGCAGCATTTGGACAGAGG - Intergenic
926690030 2:15726665-15726687 GTGAGGCAGCACATGGACCTTGG - Intronic
927712236 2:25333014-25333036 CTGGGTCCCCACATGGACAGGGG + Intronic
928677013 2:33660283-33660305 CAGAATCAGAACATGGAGATTGG + Intergenic
932917633 2:75875184-75875206 CAGAATCAGAACATGGAGATTGG + Intergenic
934145843 2:89093304-89093326 CTAAGTCAGCCCAGGGTCATTGG + Intergenic
934223417 2:90107264-90107286 CTAAGTCAGCCCAGGGTCATTGG - Intergenic
935238801 2:101160684-101160706 TTGAGTCAGAAGCTGGACATGGG + Intronic
936387341 2:112042010-112042032 CAGAATCAGAACATGGAGATTGG - Intergenic
936491979 2:112979728-112979750 CTGCTTGAGCACATGGAGATGGG - Intronic
938241724 2:129747546-129747568 CTGAGTCAGCTCCAGGACTTGGG - Intergenic
939071545 2:137550198-137550220 CTGAGGGAGCATATTGACATAGG - Intronic
939460247 2:142489773-142489795 CAGAGTCAGCAAAGGGAGATGGG + Intergenic
942580457 2:177411439-177411461 CAGAATCAGAACATGGAGATTGG - Intronic
942830766 2:180235777-180235799 CAGAATCAGAACATGGAGATTGG + Intergenic
943720636 2:191200030-191200052 CAGAGCCAGCACCTGGAAATGGG + Intergenic
944039378 2:195336848-195336870 CAGAATCAGAACATGGATATTGG - Intergenic
945520986 2:210827041-210827063 CTGAGTCATAAAATGAACATTGG - Intergenic
1170781085 20:19426020-19426042 CACAGTTAGCACATGGACCTGGG - Intronic
1173898058 20:46565899-46565921 CTGAGTAAACAAATGGCCATAGG - Intronic
1174209056 20:48862486-48862508 CTGAGGCAGAACCTGCACATTGG + Intergenic
1174463547 20:50699787-50699809 CTGGGTGAGCACATGGACCCTGG + Intergenic
1175956297 20:62611265-62611287 CTGGATCAGCCCGTGGACATGGG - Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176691490 21:9916355-9916377 CAGGTTCTGCACATGGACATGGG - Intergenic
1177896223 21:26858188-26858210 CAGAATCAGAACATGGACATTGG + Intergenic
1178179214 21:30140629-30140651 CTTAGTCAAAACAAGGACATGGG + Intergenic
1179259164 21:39743144-39743166 CAGAATCAGAACATGGAGATTGG - Intergenic
1179547001 21:42119135-42119157 ATGTGTCAGCACATGGACGCTGG + Exonic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1180163294 21:46007416-46007438 CTGAGGCAGGACGTGCACATGGG - Intergenic
1182461818 22:30488809-30488831 CAGAGGCAGCCCCTGGACATGGG + Intergenic
1182691199 22:32164641-32164663 CAGAGTCAGGAAATTGACATTGG - Intergenic
951200717 3:19873296-19873318 CAGAATCAGAACATGGAGATTGG - Intergenic
952329517 3:32351128-32351150 CTGACACAGCAGATGAACATGGG + Intronic
952922260 3:38293728-38293750 CAGAATCAGAACATGGAAATTGG - Intronic
958016294 3:87943103-87943125 CAGAATCAGAACATGGAGATTGG - Intergenic
958106237 3:89076987-89077009 ATGATTCAGGACATAGACATGGG + Intergenic
958629834 3:96671147-96671169 CAGAATCAGAACATGGAGATAGG - Intergenic
961627033 3:128271240-128271262 ATGAGGCAGCACAGGGACACAGG - Intronic
963187915 3:142439377-142439399 CAGAATCAGAACATGGAGATTGG + Intronic
964223338 3:154369977-154369999 CTGACTCAGATCATGGAGATTGG + Intronic
964953397 3:162324478-162324500 CAGATTCAGAACATGGAGATTGG + Intergenic
965054827 3:163698800-163698822 CAGAATCAGAACATGGAGATTGG - Intergenic
966353466 3:179055946-179055968 CAGAATCAGAACATGGAGATTGG + Intronic
967623531 3:191661709-191661731 CAGAATCAGAACATGGAGATTGG + Intergenic
968391209 4:194416-194438 CAGAATCAGAACATGGAGATTGG - Intergenic
972099873 4:35401600-35401622 ATGAGTGAGAACATGGACACAGG + Intergenic
972781378 4:42289656-42289678 CAGAATCAGAACATGGAGATTGG - Intergenic
974520435 4:62975129-62975151 CAGAATCAGAACATGGAGATTGG + Intergenic
975258364 4:72267117-72267139 CTGAGTCAGTGAATGGATATTGG + Intergenic
975313849 4:72930413-72930435 CAGAATCAGAACATGGAGATTGG - Intergenic
975839679 4:78460103-78460125 TTGAGATAGGACATGGACATGGG + Intronic
976189810 4:82477136-82477158 CAGAATCAGAACATGGAGATTGG + Intergenic
976464745 4:85354489-85354511 CAGAATCAGAACATGGAGATTGG - Intergenic
977376142 4:96206545-96206567 CTTAGGAAGGACATGGACATAGG - Intergenic
977618043 4:99106966-99106988 CTGAATTAGAACATGGAAATTGG - Intergenic
978586835 4:110283074-110283096 CAGAATCAGAACATGGAGATTGG - Intergenic
982056856 4:151559421-151559443 CTGAGTCAGCACAGGGCAGTGGG - Intronic
982436716 4:155388708-155388730 CTGAGCCGGACCATGGACATAGG + Intergenic
983631607 4:169855075-169855097 CTGATTCAGTACATGTACAGTGG + Intergenic
984764104 4:183386330-183386352 CTGAGGCAGCACAGGGCCAGAGG - Intergenic
985246825 4:187987275-187987297 CTGAGTCAACTCAGGCACATTGG + Intergenic
985719616 5:1482383-1482405 CTGAGGCAGGACATGGGCAGGGG + Intronic
986128398 5:4904907-4904929 CTGTGTCATCACCTGGACCTGGG + Intergenic
988148084 5:27337122-27337144 CTATGAGAGCACATGGACATAGG + Intergenic
990892216 5:60661838-60661860 CAGAATCAGAACATGGAGATTGG + Intronic
991377981 5:65986202-65986224 CTGAGTAAGCAGCTGGATATAGG - Intronic
993437032 5:87910184-87910206 TGGAGTGTGCACATGGACATGGG - Intergenic
995465612 5:112447170-112447192 CAGAATCAGAACATGGAGATTGG + Intergenic
995549881 5:113270350-113270372 CGAAGTCAGCACAGGTACATGGG - Intronic
996052927 5:118952377-118952399 AAGAGTCAGCAAAGGGACATAGG + Intronic
998256298 5:140591391-140591413 CTGAGTCAGGACATGGGGCTGGG + Intronic
1003100616 6:3173739-3173761 GTGAGTCAGCAAAGGGAGATAGG - Intergenic
1004045526 6:12019241-12019263 CTGAGTAAGCAAAGGGACAGAGG + Intronic
1004236789 6:13881488-13881510 CAGAATCAGAACATGGAGATTGG + Intergenic
1004333872 6:14746285-14746307 CTGAGCCAGGAAATTGACATTGG - Intergenic
1005316381 6:24606530-24606552 CTGTGCCAGGACATGGACAAGGG + Intronic
1005323696 6:24679585-24679607 CAGAATCAGAACATGGAAATTGG - Intronic
1008582402 6:52918852-52918874 CAGATTCAGAACATGGAGATTGG - Intergenic
1009057765 6:58358644-58358666 CTGAGTCAGCACAGTGACTCTGG - Intergenic
1009544749 6:65008090-65008112 CAGACTCAGAACATGGAGATTGG + Intronic
1011189809 6:84717115-84717137 CAGAATCAGAACATGGAGATTGG - Intronic
1011539893 6:88418043-88418065 CAGAATCAGAACATGGAGATTGG - Intergenic
1012930488 6:105311149-105311171 CAGAGAGAGCAGATGGACATTGG - Intronic
1013022209 6:106231461-106231483 CAGAATCAGAACATGGAGATTGG + Intronic
1016114456 6:140262765-140262787 GAGAGTCAGCAAAGGGACATAGG + Intergenic
1016307309 6:142697494-142697516 CTGAGTCAGCCCACAGGCATCGG + Intergenic
1016343284 6:143084837-143084859 CAGAATCAGAACATGGAGATTGG - Intronic
1016444749 6:144120200-144120222 CAGAATCAGAACATGGAGATTGG - Intergenic
1017020532 6:150136537-150136559 CTGAGTAAGCAGTTGGACATAGG + Intergenic
1018278994 6:162164305-162164327 CTGAGGCAGGAGATGGAGATGGG - Intronic
1018432670 6:163735250-163735272 CTGAGTAGGCACAGGGACCTCGG - Intergenic
1018687485 6:166315270-166315292 CAGAATCAGAACATGGAGATTGG + Intergenic
1018761015 6:166894392-166894414 CAGAATCAGAACATGGAGATTGG + Intronic
1020859010 7:13464648-13464670 CAGAGTCAGCTAGTGGACATAGG - Intergenic
1020905758 7:14062425-14062447 GTAAGTCAACACATGGACACAGG + Intergenic
1022623484 7:32009286-32009308 CTGAGTCAGGAGATGGAGTTGGG + Intronic
1023253351 7:38289191-38289213 CTGAGTCTGCACCTGGAAAGGGG + Intergenic
1023439326 7:40170102-40170124 CAGAATCAGAACATGGAGATTGG - Intronic
1024910253 7:54439398-54439420 CACAGTCAGCACATTGACACTGG + Intergenic
1025713522 7:63932243-63932265 CACAGTAAGCACATGGACAAGGG - Intergenic
1028588616 7:92474510-92474532 CAGAATCAGAACATGGAGATTGG - Intronic
1029690713 7:102179527-102179549 CTGAAGCAGCACCTGGACAGGGG - Intronic
1030843522 7:114382958-114382980 CAGAATCAGAACATGGAGATTGG - Intronic
1031296358 7:120009512-120009534 GAGAGTCAGCACAGGGAGATAGG - Intergenic
1031471494 7:122173788-122173810 CAGAATCAGAACATGGAGATTGG + Intergenic
1032426121 7:131823486-131823508 CAGAATCAGAACATGGAGATTGG - Intergenic
1034563383 7:151895493-151895515 CAGTGTCAGAACATGGACAGAGG - Intergenic
1036280182 8:7393674-7393696 CTGAGTCAGCGTAGGGAGATAGG + Intergenic
1036341343 8:7918209-7918231 CTGAGTCAGCGTAGGGAGATAGG - Intergenic
1036445807 8:8821033-8821055 GTGAGTCAGCACAGGGAAGTGGG + Intronic
1036822864 8:11954038-11954060 CTGAGTGAGAACATTGACTTGGG + Intergenic
1037670281 8:21009591-21009613 CTGAGTCAGTACCTGGGCAGGGG - Intergenic
1037897519 8:22668033-22668055 ATTAATCAGCCCATGGACATAGG - Intronic
1038481796 8:27907085-27907107 CCCAGGCAGCACATGGGCATTGG - Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1041663899 8:60424155-60424177 CAGAATCAGAACATGGAGATTGG - Intergenic
1042056080 8:64766140-64766162 CAGAATCAGAACATGGAGATTGG + Intronic
1042058776 8:64794553-64794575 CTGTGTCCTCACATGGACAAAGG + Intronic
1043363694 8:79505781-79505803 CCGAGACAGCATATGGACACAGG - Intergenic
1045929313 8:107604218-107604240 CTGACTCAGATCATGGAGATTGG - Intergenic
1046934787 8:119875278-119875300 CGGAGTCAGCAAAGGGAGATGGG + Intronic
1047382230 8:124373786-124373808 CTGAATCAGAACGTAGACATTGG + Intergenic
1048163500 8:132041635-132041657 CTGGATCAGCACAGGGAAATTGG + Exonic
1050670825 9:7995562-7995584 CTGAGGCAGGAGATGGAGATGGG - Intergenic
1051272997 9:15373276-15373298 CTCAGTAAGAACATGGTCATAGG - Intergenic
1058128022 9:101219015-101219037 CTGAGTCAGCAGAGGAACAGAGG + Intronic
1058961517 9:109996769-109996791 CTGTGTGTGCACATGCACATGGG + Intronic
1059058137 9:111005814-111005836 CTGAGACATCAGCTGGACATTGG - Intronic
1203355034 Un_KI270442v1:129119-129141 TAGAATCTGCACATGGACATTGG - Intergenic
1186009975 X:5119162-5119184 CTTAGTGAGCACATGGGGATTGG - Intergenic
1191167119 X:57402781-57402803 CAGAATCAGAACATGGAGATTGG - Intronic
1192950549 X:76011740-76011762 GTGAGTCATCACAGGCACATTGG + Intergenic
1193171998 X:78347607-78347629 CAGAATCAGAACATGGAGATTGG - Intergenic
1193306681 X:79959240-79959262 CAGAATCAGAACATGGAGATTGG + Intergenic
1194818883 X:98480828-98480850 CTGAGTAAGCAGATGGGAATTGG + Intergenic
1199049927 X:143225203-143225225 CATAGTCAGCAAATGGAAATGGG + Intergenic
1201240279 Y:11952223-11952245 AGGAGTCAGCACAGGGACATAGG + Intergenic
1201981749 Y:19916638-19916660 CTGACTCAGATCATGGAGATTGG - Intergenic