ID: 1133618400

View in Genome Browser
Species Human (GRCh38)
Location 16:7501871-7501893
Sequence CTGTAGCTATAGAGGTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133618392_1133618400 24 Left 1133618392 16:7501824-7501846 CCCTATTGCACTGTAAATCTCTA 0: 1
1: 0
2: 1
3: 21
4: 224
Right 1133618400 16:7501871-7501893 CTGTAGCTATAGAGGTACCTGGG 0: 1
1: 0
2: 1
3: 3
4: 91
1133618393_1133618400 23 Left 1133618393 16:7501825-7501847 CCTATTGCACTGTAAATCTCTAG 0: 1
1: 0
2: 1
3: 5
4: 136
Right 1133618400 16:7501871-7501893 CTGTAGCTATAGAGGTACCTGGG 0: 1
1: 0
2: 1
3: 3
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133618400 Original CRISPR CTGTAGCTATAGAGGTACCT GGG Intronic
910150777 1:84141425-84141447 CTATTGCTATAGAAGTACTTCGG - Intronic
917246327 1:173004944-173004966 CTGTGGCTAAACTGGTACCTAGG + Intergenic
921727917 1:218544121-218544143 CCGTAGCCATAGGGGCACCTTGG + Intergenic
1064024627 10:11837495-11837517 CTGCAGCAATATAGGTACATGGG + Intronic
1068395842 10:56460321-56460343 CTGTAACTATAGGGGTAATTAGG + Intergenic
1068548138 10:58375373-58375395 ATGTAGCTAAAGTGGTACTTAGG - Intergenic
1069562274 10:69439310-69439332 CTGTGGCTATAGAGGAAGGTGGG - Intergenic
1076562110 10:131373766-131373788 CTGTATCTTTAGGGGTCCCTGGG - Intergenic
1077425812 11:2476415-2476437 CTGTAGCTATAAATTTGCCTCGG - Intronic
1081184550 11:40026105-40026127 CAGAAGCTGTAGAGATACCTGGG + Intergenic
1085749285 11:79146533-79146555 CTCTAGCCACCGAGGTACCTAGG + Intronic
1087513377 11:99127057-99127079 CTGAAGCTGTAGAGGTAAGTTGG - Intronic
1091054246 11:132403799-132403821 CTGCAGCTATAGAGCTCACTGGG + Intergenic
1093776798 12:23084846-23084868 CTGGAGCTATAGGGGTGACTGGG - Intergenic
1096603153 12:52744863-52744885 CTGGAGCAACAGAGGTACCCAGG - Intergenic
1102847684 12:116204774-116204796 CTGTAGATATAGAGATACTTAGG + Intronic
1106856076 13:33854581-33854603 CTGTAGCTATGGAACTACTTGGG - Intronic
1107435309 13:40376359-40376381 CTGAAGCTATAGAGGATCTTAGG + Intergenic
1108686484 13:52823824-52823846 CTGCAGCTATAGAGATGCCTTGG - Intergenic
1111600853 13:90472164-90472186 CTTAAGCTCGAGAGGTACCTGGG + Intergenic
1112905800 13:104419763-104419785 CTGAGGCAATAGAGGTGCCTGGG - Intergenic
1112928818 13:104710854-104710876 CAGTAGCTTTAGGGGTACCATGG - Intergenic
1119772282 14:77227716-77227738 CTGTAGCACTAGAGGTTTCTGGG - Intronic
1121518902 14:94572188-94572210 CTGTCCCTACAGAGGTACATGGG + Intronic
1121577434 14:94999801-94999823 CTGTAGCTACACAAGAACCTGGG + Intergenic
1133618400 16:7501871-7501893 CTGTAGCTATAGAGGTACCTGGG + Intronic
1135152984 16:20026021-20026043 CATTAGCTGTTGAGGTACCTTGG - Intergenic
1135378032 16:21967214-21967236 CTGTACCTATGGAGTAACCTTGG - Intronic
1137052590 16:35726461-35726483 CTCTAACTATAGAGACACCTGGG - Intergenic
1140813605 16:78600929-78600951 CTGTAGCTTTGGAGGTACCTGGG + Intronic
1140918653 16:79516774-79516796 CTGGAGCTCTAGAGGTTCCATGG + Intergenic
1144083213 17:11783458-11783480 CCTTAGATATGGAGGTACCTTGG + Intronic
1148488805 17:48009850-48009872 CTGCATCTATAGAGGAAACTTGG - Intergenic
1149397651 17:56261361-56261383 CTGGAGTTATAGAGCTACCCAGG - Intronic
1155001700 18:21693986-21694008 CTGCAGCATTAGAGGTGCCTTGG - Intronic
1155343697 18:24838061-24838083 CTGCAGCTCTAGAAGCACCTGGG - Intergenic
1162088359 19:8261991-8262013 CTTTAGCTGCAGAGGTTCCTGGG - Exonic
1164381211 19:27738402-27738424 ATCTAATTATAGAGGTACCTGGG - Intergenic
926226456 2:10970665-10970687 TTGCAGTTATAAAGGTACCTTGG + Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
928778756 2:34795087-34795109 CTGCAGCTAAAGAGTCACCTTGG - Intergenic
931119115 2:59196915-59196937 CTGTGGGGATAGAGGTGCCTTGG + Intergenic
933689887 2:85171865-85171887 CAGTAGCTACTGAGGTACCAGGG - Intronic
935132291 2:100269542-100269564 CTGAACCTATAGAAGTAGCTTGG - Intergenic
935418758 2:102845258-102845280 CTGCAGCTATAGACAGACCTGGG + Intergenic
938392002 2:130914233-130914255 CCGTAGATATAGAAGCACCTTGG + Intronic
938959511 2:136328667-136328689 CTGCAGCTATGGTGGAACCTTGG + Intergenic
945193103 2:207210606-207210628 CTTTAGTTATATATGTACCTAGG - Intergenic
1169988370 20:11472232-11472254 CTGGAGGTAAAGAGCTACCTGGG - Intergenic
1182354433 22:29716055-29716077 GTGAAGCTATGGAGGGACCTAGG - Intergenic
950853883 3:16087722-16087744 CTGGAGCAAGAGAGGTACCGCGG - Intergenic
952195071 3:31066901-31066923 CTGTAGCCATAATGGTACATGGG + Intergenic
957139945 3:76341266-76341288 CTGCAGCGATACAGGTTCCTTGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
973638789 4:52883915-52883937 CTGTAGCTCTCTAGGTACCCAGG + Intronic
975599580 4:76085400-76085422 GTGTGGCTATTGAGGTGCCTAGG + Intronic
988519304 5:31931590-31931612 CTGTAGCTATGGAAGTAGATGGG + Intronic
989982627 5:50662706-50662728 CTGTAGCTTTAGTATTACCTAGG + Intergenic
992587158 5:78252334-78252356 CTGTGGCTGTACTGGTACCTAGG - Intronic
995755130 5:115495064-115495086 CTGTGGCTCTAGAGGCACTTTGG - Intergenic
996358006 5:122617910-122617932 CTGTAGCTAAAGAGTCAACTTGG + Intergenic
996566132 5:124881155-124881177 CTGTAGCTAAAGGGGAACGTGGG - Intergenic
1004221799 6:13753704-13753726 CTGTAGGCCTGGAGGTACCTGGG + Intergenic
1005018215 6:21393594-21393616 CTGTAGCTCCAGACGTGCCTGGG - Intergenic
1005852655 6:29833352-29833374 CTGTAGCTGCAGAGGCATCTGGG - Intergenic
1005876244 6:30011869-30011891 CTGTAGCTGCAGAGGCATCTGGG - Intergenic
1008642028 6:53474030-53474052 CTGTAGCTGATGTGGTACCTAGG + Intergenic
1012400860 6:98842442-98842464 CAGTCGCAAAAGAGGTACCTTGG + Intergenic
1015219667 6:130789693-130789715 GTGAAGCTAGAGAGGTAACTAGG - Intergenic
1015420798 6:133005873-133005895 CTGTAGTGAGAGTGGTACCTAGG + Intergenic
1016037475 6:139397824-139397846 CTGGAGGTATAGAGCTAACTAGG - Intergenic
1017128019 6:151084082-151084104 ATGTAGCTATAGATGTAGCCAGG - Intronic
1017648471 6:156560530-156560552 CTTTTGCTTTAAAGGTACCTTGG + Intergenic
1019037483 6:169073545-169073567 CTGTGGCTATAGAAGTATTTGGG + Intergenic
1020730645 7:11874751-11874773 CTCTATCTGTAGAGGGACCTAGG - Intergenic
1024012384 7:45280016-45280038 CTGTAGCTATAGAGTAATCCTGG + Intergenic
1024454941 7:49594693-49594715 TTGGAGCTATTGAGGTAGCTGGG + Intergenic
1030744709 7:113151250-113151272 CTGTAGGTCTAGAGGTACTATGG + Intergenic
1037606603 8:20443015-20443037 CAGTAGCTAGAGAGGGAACTGGG + Intergenic
1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG + Intergenic
1040555520 8:48474494-48474516 CTGGAGCTAGAGATTTACCTTGG + Intergenic
1042000391 8:64116847-64116869 CAATAGCTATAAAGATACCTAGG + Intergenic
1042726862 8:71888377-71888399 CTGTGGCCATACTGGTACCTAGG + Intronic
1043749031 8:83911851-83911873 CTGCAGCTATAGAGTTAAGTAGG + Intergenic
1044488609 8:92784517-92784539 CTGTAACTATAAAAGTAACTTGG - Intergenic
1044777159 8:95702057-95702079 AGGTAGCTATAGAGCTACCTTGG + Intergenic
1045200882 8:99980027-99980049 ATGTAGCTAGAGAGATATCTAGG + Intronic
1050450552 9:5776855-5776877 ATGTAAGTATAGAGGAACCTAGG + Intronic
1051380745 9:16455902-16455924 CTGTAGCTATAATGGTTCCATGG + Intronic
1052654048 9:31333668-31333690 CTGTAGCTAAAGAGTCAACTTGG - Intergenic
1057832644 9:98418814-98418836 CTGTAGCTACAAAGCTCCCTTGG - Intronic
1060226666 9:121795734-121795756 CTGCAGCTAAAGAGTTAACTTGG - Intergenic
1187322522 X:18252883-18252905 CTGGAGCTATACAGGAAGCTGGG + Intronic
1191242396 X:58199689-58199711 CTTTAGCGATAGAGACACCTGGG + Intergenic
1193049906 X:77088858-77088880 CTGGAGCTATAAAGGGAACTAGG + Intergenic
1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG + Intronic