ID: 1133625168

View in Genome Browser
Species Human (GRCh38)
Location 16:7564221-7564243
Sequence CTGTGTTCTCAGATGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2522
Summary {0: 1, 1: 4, 2: 73, 3: 595, 4: 1849}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133625168_1133625174 3 Left 1133625168 16:7564221-7564243 CCCTCTTCCATCTGAGAACACAG 0: 1
1: 4
2: 73
3: 595
4: 1849
Right 1133625174 16:7564247-7564269 AAAGGCACTCAAGCCGGGCGTGG 0: 1
1: 0
2: 7
3: 49
4: 385
1133625168_1133625175 6 Left 1133625168 16:7564221-7564243 CCCTCTTCCATCTGAGAACACAG 0: 1
1: 4
2: 73
3: 595
4: 1849
Right 1133625175 16:7564250-7564272 GGCACTCAAGCCGGGCGTGGTGG 0: 1
1: 0
2: 9
3: 110
4: 903
1133625168_1133625173 -2 Left 1133625168 16:7564221-7564243 CCCTCTTCCATCTGAGAACACAG 0: 1
1: 4
2: 73
3: 595
4: 1849
Right 1133625173 16:7564242-7564264 AGAAAAAAGGCACTCAAGCCGGG 0: 1
1: 0
2: 3
3: 34
4: 436
1133625168_1133625172 -3 Left 1133625168 16:7564221-7564243 CCCTCTTCCATCTGAGAACACAG 0: 1
1: 4
2: 73
3: 595
4: 1849
Right 1133625172 16:7564241-7564263 CAGAAAAAAGGCACTCAAGCCGG 0: 1
1: 0
2: 1
3: 29
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133625168 Original CRISPR CTGTGTTCTCAGATGGAAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr