ID: 1133627132

View in Genome Browser
Species Human (GRCh38)
Location 16:7581244-7581266
Sequence TCTGTTCTGCAGGAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133627132_1133627137 -1 Left 1133627132 16:7581244-7581266 CCTTCCAACTCCTGCAGAACAGA 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1133627137 16:7581266-7581288 AGATACCCTCGGGCACTTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133627132 Original CRISPR TCTGTTCTGCAGGAGTTGGA AGG (reversed) Intronic
900462336 1:2807681-2807703 GCTGTTCTGCAGGTGGGGGAGGG - Intergenic
900814003 1:4829338-4829360 TCTGCTCTGGAGGAGGTGGGAGG - Intergenic
902966915 1:20011872-20011894 TCTGTTCTCCAGGGGGTGGTGGG + Intergenic
904319142 1:29685185-29685207 TCTGATCAGCAGGAGGTGGGGGG + Intergenic
905053591 1:35074323-35074345 TGTATTCTGCAGCTGTTGGATGG + Intronic
905474141 1:38213964-38213986 TCTGCTCTGCAGGCCTTGGCTGG + Intergenic
905619251 1:39428035-39428057 CCTGTTCTGCAGGAGATGTCAGG - Exonic
906299713 1:44673207-44673229 TCTGTTCTGCGGGAGTCTAAGGG + Intronic
907563040 1:55408707-55408729 TCTATTCTACAGGATTTTGATGG + Intergenic
908660621 1:66431619-66431641 TCTGTTCTGATGGAGGTGGTAGG + Intergenic
909582238 1:77250230-77250252 TGTATTCTGCAGCTGTTGGATGG - Intergenic
911080942 1:93929902-93929924 TGTATTCTGCAGTTGTTGGATGG - Intergenic
911241115 1:95468044-95468066 TGTATTCTGCAGCTGTTGGATGG + Intergenic
912932844 1:113980191-113980213 CCTTTTCTGCAGGAGTGGAAGGG + Intronic
913244578 1:116860357-116860379 TCTGGTGGGCAGGAGTTGGGGGG + Intergenic
913587938 1:120294571-120294593 TATATTCTGCAGTTGTTGGATGG + Intergenic
913620247 1:120603798-120603820 TATATTCTGCAGTTGTTGGATGG - Intergenic
914569954 1:148906435-148906457 TATATTCTGCAGTTGTTGGATGG + Intronic
914602875 1:149223833-149223855 TATATTCTGCAGTTGTTGGATGG - Intergenic
915908424 1:159896807-159896829 CTTGTGCTCCAGGAGTTGGATGG - Intronic
917701315 1:177584409-177584431 ACTGATCTGCATGATTTGGATGG - Intergenic
921138417 1:212283831-212283853 TCTATTCTGCAGGTATTGGGTGG + Intergenic
921307709 1:213813669-213813691 TGTGTTCTTCAGGAGAAGGAGGG + Intergenic
922210212 1:223480659-223480681 TCTGTGCAGCAGGAGCTGGAGGG - Intergenic
922657960 1:227402263-227402285 CCTGTTCTGGTGGAGGTGGAGGG - Intergenic
922977916 1:229800644-229800666 TCTGGACTGGTGGAGTTGGAGGG + Intergenic
924321181 1:242852613-242852635 TATATTCTGCTGTAGTTGGATGG + Intergenic
924838795 1:247685806-247685828 TGTATTCTGCAGCTGTTGGATGG + Intergenic
1062967743 10:1623048-1623070 TGTGCTGAGCAGGAGTTGGAAGG + Intronic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1063484151 10:6403413-6403435 TGGGCTCTGCAGGTGTTGGATGG - Intergenic
1063910713 10:10827122-10827144 TTTGTTTTGCAGGAGTTAGAAGG + Intergenic
1063975458 10:11412053-11412075 TCTGCTCTGCAAGAATTGGATGG + Intergenic
1065184029 10:23155293-23155315 TCTGTTCTGTAGCTGATGGAAGG + Intergenic
1066171901 10:32857303-32857325 TATGTTCTGCTGCTGTTGGATGG - Intronic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1069786484 10:70991334-70991356 TCTGATCTCCAGGAGGCGGAGGG + Intergenic
1070016568 10:72539265-72539287 TGTATTCTGTAGCAGTTGGATGG - Intronic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1070450670 10:76554079-76554101 TCTGTTCTGCTGGAGTGGTGGGG - Intronic
1074141042 10:110672678-110672700 TCTTTTCTCCTGGAGTGGGAAGG + Intronic
1074179083 10:111042095-111042117 TATGTTCTGCTGCTGTTGGATGG - Intergenic
1074500347 10:114017976-114017998 TCTATTCTGTAGGAAGTGGAGGG - Intergenic
1075734897 10:124658589-124658611 GCTGTTCTCCAGGACTTGTATGG - Intronic
1076788589 10:132764478-132764500 TCAGTCCTGCAGGGGTGGGAGGG + Intronic
1077287693 11:1775092-1775114 TCTGGTCTGCAGGCTTTGGAGGG + Intergenic
1078401669 11:11033823-11033845 GATGTTCTGCAGCAGTTGAATGG + Intergenic
1078706806 11:13751678-13751700 TATATTCTGCAGTTGTTGGATGG - Intergenic
1080046714 11:27816359-27816381 TCTGTTCTGCTCTAGTGGGATGG - Intergenic
1080556305 11:33420553-33420575 GCTGTTCTGAAGAAGTTGTATGG + Intergenic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1080926246 11:36759551-36759573 TTTGTTCTACTGGCGTTGGAAGG + Intergenic
1082900477 11:58244958-58244980 TGTATTCTGCAGCTGTTGGATGG + Intergenic
1085917384 11:80905703-80905725 TATATTCTGCAGTTGTTGGATGG - Intergenic
1087061185 11:93979404-93979426 CCTGTTCTGCAGGAGCTTGCTGG + Intergenic
1088359822 11:108978368-108978390 TCCATTCTTCAGGAGTTAGAAGG - Intergenic
1088812225 11:113399594-113399616 ACTCTTCAGCAGGTGTTGGATGG - Exonic
1089032104 11:115342395-115342417 TGTGTCCTGAAGGAGATGGAAGG + Intronic
1089887515 11:121842345-121842367 TCTCTTAGGCAGGATTTGGATGG - Intergenic
1090726316 11:129530403-129530425 GCTGTTGTGCAAGAGCTGGAGGG + Intergenic
1090894790 11:130962171-130962193 TATATTCTGCAGTTGTTGGATGG + Intergenic
1091686679 12:2567427-2567449 TCTGTTCTGGCCGAGGTGGATGG + Intronic
1093379938 12:18479972-18479994 TGTGTTCAGCTGGAGTGGGAAGG + Intronic
1093951811 12:25170653-25170675 TGTATTCTGCAGTTGTTGGATGG - Intronic
1094013366 12:25832877-25832899 TCTTTTCTGCTAGAGTTAGAGGG + Intergenic
1094057138 12:26279189-26279211 TCTGTGCTGCAGGAACTGAAGGG + Intronic
1095986883 12:48004805-48004827 GGAGTTCTGCCGGAGTTGGAGGG + Intergenic
1096888366 12:54741446-54741468 TGTATTCTGCAGTTGTTGGATGG + Intergenic
1098856456 12:75658083-75658105 TGTGTTCTTCAAGAGATGGAGGG - Intergenic
1100203367 12:92323189-92323211 TATATTCTGCAGTTGTTGGATGG + Intergenic
1100697021 12:97105770-97105792 TATATTCTGCAGTTGTTGGATGG + Intergenic
1100748463 12:97671367-97671389 TCTTTTCTGCAGGACTTCTAAGG - Intergenic
1101162305 12:101991302-101991324 TATATTCTGCAGCAGTTGGATGG + Intronic
1101254785 12:102966261-102966283 TCTGGTCTTCAGGAGTGGGGTGG - Intergenic
1101572865 12:105971162-105971184 TGTGTTGTGGAGGAATTGGACGG + Intergenic
1106372927 13:29154011-29154033 CCTGTTCAGAAGGTGTTGGAGGG + Intronic
1107070642 13:36264925-36264947 TGTGTTCTGGTGGTGTTGGATGG + Intronic
1107091338 13:36484226-36484248 TGTATTCTGCAGGTGTTGGATGG + Intergenic
1107419524 13:40233554-40233576 ACTTTTCTGTAGGAATTGGATGG + Intergenic
1107651484 13:42549617-42549639 TCTCTTCTGAAGGTGTGGGAGGG + Intergenic
1108344258 13:49529513-49529535 TCTGTTCAGAGGGTGTTGGATGG - Intergenic
1109738797 13:66523641-66523663 GCTGCTCTGTAGGAGTTGGCAGG + Intronic
1110825795 13:79970337-79970359 ACAGTTCTGCAGGGGTGGGAAGG + Intergenic
1116048815 14:39778937-39778959 TGTATTCTGCAGTTGTTGGATGG + Intergenic
1116380238 14:44258670-44258692 TCTGTTCTGCATGATGTGCAGGG + Intergenic
1119865985 14:77974899-77974921 TCAGTTGTGCATGATTTGGAAGG - Intergenic
1120201429 14:81541531-81541553 GCAGTTCTGCTGGAGTTGGCTGG - Intergenic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1124269116 15:28265001-28265023 TCTCTCCTGCAGAAGTTGAATGG - Intronic
1124412197 15:29445735-29445757 TCCCTTCTCCAGGAGTGGGATGG - Intronic
1125901645 15:43353708-43353730 TCTGTTCTTCTGGAGTTTTATGG - Exonic
1126231076 15:46325845-46325867 CCTTGTCTGCAGGATTTGGAAGG - Intergenic
1126286792 15:47022099-47022121 TGTGTTCTGCTGCTGTTGGATGG - Intergenic
1127763008 15:62158580-62158602 TGTATTCTGCAGCTGTTGGATGG - Intergenic
1127811523 15:62569309-62569331 TCTGGCCTGTAGGAGTTGAATGG - Intronic
1129171250 15:73809586-73809608 TCTGTTCTCCAGCATCTGGAAGG - Intergenic
1129615726 15:77097712-77097734 TCTATCCTGCAGGAGAGGGAAGG + Intergenic
1130092500 15:80832836-80832858 TCTGTTCTGCATCAGTTGAGAGG + Intronic
1130386550 15:83417068-83417090 TCTGCGCTGCAGGTGTTGGTAGG + Intergenic
1130779789 15:87023658-87023680 TATATTCTGCAGTTGTTGGATGG - Intronic
1130957914 15:88639983-88640005 CCTGTTCTCCAGGACTGGGAGGG - Intronic
1131326790 15:91455903-91455925 TCTGCTCTGGTGGAGTTGGCAGG + Intergenic
1131669161 15:94600745-94600767 TCTATTCTGGAGGAGGGGGAAGG - Intergenic
1132004270 15:98212629-98212651 TCTCTTCTGCAGAAGCTGCAAGG + Intergenic
1132094648 15:98973386-98973408 TGTATTCTGCAGCTGTTGGATGG - Intronic
1133627132 16:7581244-7581266 TCTGTTCTGCAGGAGTTGGAAGG - Intronic
1134654209 16:15935042-15935064 TCTTTTCTGCAGAAGTGGAAAGG + Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1138252314 16:55510436-55510458 TGTGTTCTGCGGGGGTTGGGGGG + Intronic
1140745363 16:77975937-77975959 TCTGTTCTACAGCAGTGGAAAGG - Intronic
1143286735 17:5795618-5795640 TCGGTTCTGCAGGGCCTGGATGG - Intronic
1143551141 17:7631224-7631246 TCTGTGCTGCTGGAGGTGGATGG + Exonic
1143969297 17:10783262-10783284 GGTGTTCAGCAGGAGTAGGAAGG - Intergenic
1144036964 17:11375906-11375928 TCAGTTCAGCAGGTGGTGGAAGG + Intronic
1145992706 17:29088690-29088712 TCTGCTCTGCCAGAGATGGAAGG + Intronic
1146637186 17:34515052-34515074 TCCTGGCTGCAGGAGTTGGATGG - Intergenic
1148897527 17:50847938-50847960 TCTGTTCTGCAGGATGGGGGTGG + Intergenic
1150885698 17:69082980-69083002 TTTGTTTTTCAGGTGTTGGATGG + Exonic
1152595094 17:81234038-81234060 TCTGTTCTGCAGCTTTTGCAGGG - Exonic
1153095136 18:1392337-1392359 TCTGTGCTCCAGGAGCTGGAGGG - Intergenic
1153666069 18:7368610-7368632 TCTGTTCCCCAGGGCTTGGAAGG + Intergenic
1153815617 18:8787476-8787498 CCTGATCTGCAGTAGTGGGACGG + Intronic
1154085460 18:11300784-11300806 TCAGTTCTGCAGGGCTTGGGAGG - Intergenic
1155272753 18:24156819-24156841 TCTGTACCCCAGGAGATGGAAGG + Exonic
1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG + Intergenic
1156291625 18:35752930-35752952 TCTGTTCTGCAGCCAATGGAGGG - Intergenic
1157493932 18:48142249-48142271 CCTGTCCTGCAGGGGCTGGAAGG + Intronic
1159101390 18:63962845-63962867 TCTGTGTTGAAGGAGATGGAGGG + Intronic
1159285828 18:66349357-66349379 TCTGTTTTTCAGGAGTTGCCAGG - Intergenic
1159361378 18:67408392-67408414 AATGTTCTGAAGGAGTGGGAAGG + Intergenic
1159497709 18:69227429-69227451 TATGTTCTTCAGGAATGGGAAGG + Intergenic
1159507074 18:69352208-69352230 TCTCTTCTACAGGTTTTGGAGGG - Intergenic
1159569547 18:70096561-70096583 GCTGGTCTGCTGGAGTTGGCTGG + Intronic
1160219578 18:76964527-76964549 TATATTCTGCAGTTGTTGGATGG + Intronic
1161319866 19:3636196-3636218 CTTGTCCTGCAGGAGTTGGGGGG + Intronic
1161338204 19:3725992-3726014 CCTGATCTCCAGGAGTGGGAAGG - Intronic
1161504341 19:4635984-4636006 TCTGTTCTGCAGGAGCCTGTGGG - Intergenic
1162349787 19:10141869-10141891 GCTGTTCTGCAGGAGCTTTACGG - Intronic
1164125473 19:22311657-22311679 TGTATTCTGCAGTTGTTGGATGG + Intronic
1164555278 19:29246378-29246400 GCTGTTCTGTAGGTGTGGGATGG + Intergenic
1165622001 19:37255961-37255983 TCTGTTTTGCATGCATTGGAAGG + Intergenic
1166537788 19:43585906-43585928 TCTGTTCTTTTGGAGTTTGAGGG - Exonic
1166665170 19:44675408-44675430 TGTGTTTTGCAGGAGATGTAGGG - Intronic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925419060 2:3696263-3696285 TATTTTCTGTAGGAGTTGGCGGG + Exonic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
926349325 2:11981072-11981094 TGTGGTTTGCATGAGTTGGACGG - Intergenic
928321888 2:30290531-30290553 TCTGTGTTGCTGGAGTGGGATGG - Intronic
929040505 2:37739828-37739850 TCAGTTCTGCATGGCTTGGAAGG + Intergenic
930780497 2:55220445-55220467 TCTGTTCTTCAGGACTGAGAGGG - Intronic
930954462 2:57188306-57188328 TCTGTTCTGGAGGATTTTGATGG - Intergenic
931553907 2:63478364-63478386 TATATTCTGCAGTTGTTGGATGG - Intronic
932054902 2:68433594-68433616 TCATTTGTGCAGGAGTTGGCTGG - Intergenic
932533158 2:72559965-72559987 TGTGTTCTTCAGAAGTTGGCTGG - Intronic
933399824 2:81781264-81781286 TATATTCTGCAGCTGTTGGATGG + Intergenic
937252270 2:120532496-120532518 TCTGGTCTGCAGGTCTTTGAGGG - Intergenic
937332406 2:121039821-121039843 TTCGTTCTGCAGGAAGTGGAAGG - Intergenic
938182250 2:129193592-129193614 TATGGTCTGCTGGAGTGGGACGG + Intergenic
939915763 2:148041218-148041240 CCAGTTCAGCGGGAGTTGGAGGG + Intronic
940172316 2:150842749-150842771 CCTGTTCTGGAGGAGGTGGCAGG + Intergenic
940506658 2:154563675-154563697 TTTGTTCTGCAGCTATTGGATGG + Intergenic
941002385 2:160215618-160215640 GCTTTTCAGCAGGATTTGGAGGG - Intronic
944910608 2:204306820-204306842 TCTTCTCTGCAGTAGTTGCAGGG - Intergenic
944929343 2:204500624-204500646 TCTATTCTGCCAGAGTGGGAAGG + Intergenic
945136037 2:206628287-206628309 TTTGATCTGCTGGAGTTGAAGGG + Intergenic
945853210 2:215034928-215034950 TCTGTTATGCTGGAGTGGGGTGG - Intronic
946186866 2:217985994-217986016 TGTGTTCTGAAGGAGCTGTAAGG - Intronic
946859231 2:223984620-223984642 TCTGTTCTGCAGAAATTTCATGG - Intronic
947457023 2:230264859-230264881 CCTGTTCTGCTGGAGGTGAAGGG + Intronic
948835456 2:240624077-240624099 TCTGATCTGCCAGAGGTGGAAGG + Intronic
1169327972 20:4691921-4691943 TGTATTCTGCAGCTGTTGGATGG + Intronic
1170388715 20:15849278-15849300 TCTTTCTTGCAGGAGTGGGAGGG + Intronic
1170886511 20:20344187-20344209 ACGGTTCTGCAGGAATGGGAGGG - Intronic
1171513535 20:25707688-25707710 TGTGTTCTGCAGCTGTTTGATGG + Intergenic
1173404956 20:42756626-42756648 TCTGTTCTGCAGCAATGGAATGG - Exonic
1177576890 21:22969146-22969168 TCTGTTCTGCTGAAGTGGGACGG - Intergenic
1178258296 21:31075390-31075412 TCAGTTCTAAAGGAGTAGGAAGG + Intergenic
1179308062 21:40172863-40172885 TGTCTTCTACAGGAGTTGGGTGG + Intronic
1179319561 21:40277072-40277094 TCTGGCCTGGAGGAGTTGGGTGG + Intronic
1179808503 21:43855084-43855106 TCTGTTTTGCCGGAGCTGGAAGG - Intergenic
1179942485 21:44649104-44649126 TCTGTCCAGCAGGCGGTGGAGGG - Intronic
1181086105 22:20440113-20440135 TCTGGTCTGCAGGGGCAGGAAGG - Intronic
1181975996 22:26730273-26730295 TCAGTTCTGCAGGGCTGGGAAGG - Intergenic
1182712355 22:32330849-32330871 TCTGGTGTGTAGGTGTTGGAGGG + Intergenic
1182741343 22:32570196-32570218 ACTGTCCTGCAGGACTTGGGAGG + Intronic
1183510625 22:38232662-38232684 TCTGTACTGCAGGGGCTGGCGGG - Intronic
1184207368 22:43014038-43014060 TCTTTTCAGAAGGAGTTGGTTGG - Intronic
950886367 3:16366305-16366327 GCTGTTGTGGAGGAGTTGGGTGG - Intronic
950991115 3:17438597-17438619 TCTGTTCTGCATGGCTTGGGAGG - Intronic
952046243 3:29324553-29324575 TCTGTCCTGCTGGAGTGGGTAGG + Intronic
952704721 3:36365705-36365727 TCTGTTCTGCAGTACTAGGTAGG - Intergenic
952748922 3:36808343-36808365 TCTGTTTTGCAGGATTTGTCTGG - Intergenic
954898116 3:53994842-53994864 TCAGCTCTGAAGGACTTGGAGGG - Intergenic
955408791 3:58642674-58642696 TGTGTCCTGCAGGAGATGCAGGG + Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
958715571 3:97775898-97775920 TATATTCTGCAGCTGTTGGATGG + Intronic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
959611684 3:108302227-108302249 TCTGTTCTGTTGTAGTAGGAGGG + Intronic
961203243 3:125060973-125060995 TCTGGTTTGCATGGGTTGGATGG + Intergenic
961340976 3:126218038-126218060 TCCCTTCTGCAGGGGTTGGGTGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962401627 3:135065168-135065190 TGTATTCTGCAGTTGTTGGATGG + Intronic
962634687 3:137318851-137318873 TCAGTTCTGCTGGAGTTTGCTGG + Intergenic
962847949 3:139287508-139287530 TCTGTTCTGCAGGGAGTGGAAGG - Intronic
962983948 3:140517704-140517726 TCTGCTCTGGTGGAGGTGGAGGG + Intronic
966284749 3:178281420-178281442 TGTGTTCTGCTGCAGTTGGATGG - Intergenic
966794691 3:183702117-183702139 TCTGTTCTGTAGTAGTTAGGGGG - Intronic
966895449 3:184441423-184441445 TCTCTGCTGTAGGAGTTTGAGGG + Intronic
968629990 4:1645359-1645381 TCTCTTCTGCAGGGTTGGGAGGG - Intronic
970860205 4:20693808-20693830 TCTGATATGAAGGAGTTGGCAGG + Intergenic
971530142 4:27677344-27677366 TGTATTCTGCAGTTGTTGGATGG + Intergenic
971801124 4:31292888-31292910 TGTGTTCTGCAGCAATTGGAAGG + Intergenic
972890960 4:43555272-43555294 TGTATTCTGCAGCAGTTGGATGG + Intergenic
973244297 4:47994142-47994164 TATATTCTGCAGTTGTTGGAAGG + Intronic
973673535 4:53241081-53241103 CCTCTTCTGCAGGAGTTGTTGGG - Intronic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
974501937 4:62716611-62716633 TGTATTCTGCAGGCGTTGGGTGG - Intergenic
974509638 4:62821982-62822004 TCTCTTCTTCAGGTTTTGGATGG + Intergenic
975194104 4:71502795-71502817 TGTATTCTGTAGCAGTTGGATGG + Intronic
975356783 4:73415631-73415653 TCTGTTCTGGAGGATTTTTAGGG + Intronic
975504183 4:75120110-75120132 TGTATTCTGCAGCTGTTGGATGG - Intergenic
978214273 4:106179705-106179727 TGTATTCTGCAGCTGTTGGATGG + Intronic
978629995 4:110733172-110733194 TCTATTCTGGAAGAGTTGGTAGG - Intergenic
981953395 4:150439653-150439675 TCTGCTTTGCTGCAGTTGGAAGG + Intronic
982234109 4:153236163-153236185 ACAGTTCTGCAGGACTGGGAAGG - Intronic
983546275 4:168967692-168967714 TCTGTACTGGAGCAGGTGGATGG + Intronic
983577699 4:169276234-169276256 TTTGGTCTGCAGTAGTGGGAAGG + Intergenic
985025087 4:185732588-185732610 TCAGTTCTGCAGATGTGGGAAGG + Intronic
987904181 5:24054173-24054195 TGTATTCTGCAGCTGTTGGATGG - Intronic
988344833 5:30023352-30023374 TGTATTCTGCAGTTGTTGGATGG - Intergenic
989494636 5:42098391-42098413 TGTATTCTGCAGCTGTTGGAGGG + Intergenic
991516928 5:67447366-67447388 TGTGTTCTGCTGTTGTTGGATGG + Intergenic
995183885 5:109252347-109252369 TCTGTTCTGCTGGGGGTGGGAGG + Intergenic
995725483 5:115177714-115177736 TCTGTTTTGTGGGGGTTGGAGGG - Intronic
995883443 5:116867613-116867635 TCTGGTGGGCAGGAGTTGGGGGG + Intergenic
996031857 5:118714377-118714399 CCTGTTCTGCTGGAGGTGGCAGG - Intergenic
996424736 5:123302014-123302036 TATATTCTGCAGCTGTTGGATGG - Intergenic
997096151 5:130914369-130914391 TGTATTCTTCAGCAGTTGGATGG - Intergenic
998276214 5:140755753-140755775 TGTATTCTGCAGCTGTTGGATGG + Intergenic
1001971623 5:175959887-175959909 TCTGTTCTCTCGGAGTTGGTGGG - Exonic
1002100094 5:176853329-176853351 CCTGGTCTGCAGGAGCTGGCGGG + Intronic
1002245819 5:177883890-177883912 TCTGTTCTCTCGGAGTTGGTGGG + Intergenic
1004325349 6:14669598-14669620 TCTGTGCTGAGGGAATTGGAAGG + Intergenic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1007296061 6:40821506-40821528 TCTGTTCTCCTGGAGATGGGAGG + Intergenic
1007722616 6:43894197-43894219 TATGCTCTGCAGGAGTGGCAGGG + Intergenic
1008740607 6:54602881-54602903 ACTGTTCTGCATGACTTGGAAGG + Intergenic
1009969068 6:70607175-70607197 TGTATTCTGCAGTTGTTGGATGG - Intergenic
1010008772 6:71026648-71026670 TGTATTCTGCAGTTGTTGGATGG + Intergenic
1010164874 6:72903796-72903818 TGTATTCTGCAGTTGTTGGATGG + Intronic
1010670910 6:78684969-78684991 ACTGTGCTGCATGGGTTGGAAGG + Intergenic
1010811213 6:80300679-80300701 TATATTCTGCAGTAGTTGGATGG - Intronic
1011394843 6:86895527-86895549 TGTGTTCTGCAGTTGTTGGATGG - Intergenic
1011416014 6:87121012-87121034 TCTGTTCTTCAGAAGTTGGGTGG - Intergenic
1016516167 6:144895067-144895089 TCTGTTCTGCAGGGCTGGGAAGG + Intergenic
1016518378 6:144922567-144922589 GCTGTTGTGCAGGACTCGGAGGG + Intergenic
1016733938 6:147455627-147455649 TCTGTTATGGAGGAGGAGGAAGG + Intergenic
1017893898 6:158662738-158662760 TCTTTTCTGCAGGTATTGAACGG + Exonic
1018183752 6:161246778-161246800 TCTGTTCTGTAAGAAGTGGAAGG - Intronic
1020620449 7:10511805-10511827 TGTGTTCTGCTGCTGTTGGATGG + Intergenic
1022503042 7:30894477-30894499 TCTGATCTCCAGGATTTGGGAGG - Intergenic
1023542015 7:41275660-41275682 TCTGTTCTGCAGCACTGGGTGGG + Intergenic
1023875532 7:44284414-44284436 TCTGTTCTGCTGGTGTTGAGTGG - Intronic
1024360804 7:48465343-48465365 TTTGTTCTGCAGGATGTGGTTGG + Intronic
1024372293 7:48599883-48599905 TGTATTCTGTAGTAGTTGGATGG + Intronic
1024623932 7:51188265-51188287 TCTGTTCTCCAGCAGTGGTAGGG + Intronic
1024730364 7:52246948-52246970 TCTGTACTCCAGGATTTGTAGGG + Intergenic
1026231891 7:68491093-68491115 TCTGCTTTGCAGCTGTTGGAAGG - Intergenic
1026953950 7:74365195-74365217 GCTCTCCTGCAGGGGTTGGATGG + Intronic
1029404868 7:100368627-100368649 TCTGTGCTTCAGGAGGTTGAGGG + Intronic
1030421796 7:109315879-109315901 TGTATTCTGCAGCAGTTGGTTGG - Intergenic
1030610371 7:111682110-111682132 TCTGCTCTGTATGAGTTGAAAGG + Intergenic
1031761200 7:125715697-125715719 TCTGTTCTGGTGGAGGTGGCTGG + Intergenic
1033454511 7:141490539-141490561 ACTGTTCTGGAGGTGTTGGCAGG - Intergenic
1033556260 7:142490726-142490748 TCCGTCCTGCTGGAGTTGCATGG + Intergenic
1033558627 7:142510179-142510201 TCTATCCTGATGGAGTTGGATGG + Intergenic
1033761918 7:144444939-144444961 TCTGTTCTGTAGTTGTTGGATGG + Intergenic
1033967776 7:146998492-146998514 TGTATTCTGCAGCTGTTGGATGG + Intronic
1034030161 7:147752906-147752928 TCTGCTCTACAGAAATTGGAAGG - Intronic
1034550599 7:151818306-151818328 TCTGTTATTCAGGGGTTGGGGGG - Intronic
1034682967 7:152944776-152944798 TGTATTCTGCAGTTGTTGGATGG + Intergenic
1035050740 7:155997874-155997896 TCTGTTCTGGGGGTGCTGGAAGG + Intergenic
1037179680 8:15990514-15990536 TGTGTTCTGCAGCAGTTAGATGG + Intergenic
1037197840 8:16213598-16213620 TCTGAACAGCAGGAGTTGTAGGG - Intronic
1039608888 8:38903545-38903567 TTTGTTCTGCAGAAGTGGGAAGG + Intronic
1039891808 8:41690589-41690611 CCTCTCCTGCAGGTGTTGGAAGG - Exonic
1041392848 8:57362463-57362485 TCAATTCTGCAGGAGGTGGGAGG + Intergenic
1044246567 8:89954276-89954298 TCTGTTCTCCAGGAGTTTATTGG + Intronic
1044731542 8:95232374-95232396 TGGGTTCTGCAGGGCTTGGAAGG - Intergenic
1045883106 8:107064514-107064536 TCAGATCTGCTGGAGTTTGATGG + Intergenic
1047089161 8:121554809-121554831 TCTCTTCTGTAAGAGTTGGGAGG + Intergenic
1050424738 9:5501650-5501672 TCCCTTCTGCAGGAGTTGTTGGG - Intergenic
1051073356 9:13200877-13200899 TGTATTCTGCAGCTGTTGGACGG + Intronic
1051131945 9:13872375-13872397 TGTTTTCTGCAGTTGTTGGATGG + Intergenic
1054351584 9:64021294-64021316 TCTGTCCTGCAGCAGCTGCACGG + Intergenic
1056812426 9:89775068-89775090 ACTGATCTGCAAGAGCTGGAGGG - Intergenic
1057413709 9:94842427-94842449 TCTGTTCTGCTGTTATTGGATGG + Intronic
1057684968 9:97223103-97223125 TATGTTCTGCTGTTGTTGGATGG - Intergenic
1059388002 9:113980130-113980152 TCTGGGCAGCAGGAGCTGGAAGG + Intronic
1059990857 9:119864025-119864047 TATGTTCTGTAGTTGTTGGATGG - Intergenic
1061820192 9:133223216-133223238 TCTGTGCTGCAGGTGATTGAAGG + Intergenic
1062240440 9:135534706-135534728 TCTGCACTGCAGGTGTTTGAAGG - Intergenic
1186862361 X:13685747-13685769 TCTATGCTGCAGGCATTGGAGGG + Intergenic
1187223266 X:17350756-17350778 TGTATTTTGCAGGTGTTGGATGG + Intergenic
1190243500 X:48676103-48676125 TTTGATCTGCAGGAGTAGGACGG - Intergenic
1190248181 X:48704551-48704573 ACTGTTCTCCAGGAGGTGAAGGG + Intronic
1190308525 X:49100872-49100894 TTTGATCTGCAGGAGTAGGACGG - Intronic
1190768064 X:53491993-53492015 TCTGTTCTGGTGTAGTTGGGTGG + Intergenic
1193175413 X:78387183-78387205 TGTATTCTGCAGCTGTTGGATGG - Intergenic
1193590130 X:83379195-83379217 TGTATTCTGCAGTTGTTGGATGG + Intergenic
1194910798 X:99642019-99642041 CCTGCTCTGCAGGAGCTGGCTGG - Intergenic
1195556432 X:106230478-106230500 TGTATTCTGCCGCAGTTGGATGG + Intergenic
1196675525 X:118416651-118416673 TGTATTCTGCAGTTGTTGGATGG + Intronic
1196938403 X:120752279-120752301 TCTTTTCTGAAGGAGTGGAATGG + Intergenic
1196947994 X:120847735-120847757 TATATTCTGCAGTTGTTGGATGG + Intergenic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1197361494 X:125509568-125509590 TATGTTCTGCTGCAGTTGGGTGG - Intergenic
1197476092 X:126927424-126927446 TATATTCTGCAGTTGTTGGATGG + Intergenic
1197805400 X:130393915-130393937 TCTATTCTGCAGGGGACGGAAGG - Intergenic
1198044313 X:132885211-132885233 TCTGGTATCCAGGAGTTGGTGGG + Intronic
1198844109 X:140891100-140891122 TCTTTTCTGTAGGAGATGAAAGG - Intergenic